The paperclip triplex: understanding the role of apex residues in tight turns

In this study, we investigate the role of the apex nucleotides of the two turns found in the intramolecular "paperclip" type triplex DNA formed by 5'-TCTCTCCTCTCTAGAGAG-3'. Our previously published structure calculations show that residues C7-A18 form a hairpin turn via Watson-Crick basepairing and residues T1-C6 bind into the major groove of the hairpin via Hoogsteen basepairing resulting in a broad turn of the T1-T12 5'-pyrimidine section of the DNA. We find that only the C6C7/G18 apex triad (and not the T12A13/T1 apex triad) is required for intramolecular triplex formation, is base independent, and occurs whether the purine section is located at the 5' or 3' end of the sequence. NMR spectroscopy and molecular dynamics simulations are used to investigate a bimolecular complex (which retains only the C6C7/G18 apex) in which a pyrimidine strand 5'- TCTCTCCTCTCT-3' makes a broad fold stabilized by the purine strand 5'-AGAGAG-3' via Watson Crick pairing to the T8-T12 and Hoogsteen basepairing to T1-T5 of the pyrimidine strand. Interestingly, this investigation shows that this 5'-AGAGAG-3' oligo acts as a new kind of triplex forming oligonucleotide, and adds to the growing number of triplex forming oligonucleotides that may prove useful as therapeutic agents.     

NMR studies of DNA (R+)n.(Y-)n.(Y+)n triple helices in solution: imino and amino proton markers of T.A.T and C.G.C+ base-triple formation

High-resolution exchangeable proton two-dimensional NMR spectra have been recorded on 11-mer DNA triple helices containing one oligopurine (R)n and two oligopyrimidine (Y)n strands at acidic pH and elevated temperatures. Our two-dimensional nuclear Overhauser effect studies have focused on an 11-mer triplex where the third oligopyrimidine strand is parallel to the oligopurine strand. The observed distance connectivities establish that the third oligopyrimidine strand resides in the major groove with the triplex stabilized through formation of T.A.T and C.G.C+ base triples. The T.A.T base triple can be monitored by imino protons of the thymidines involved in Watson-Crick (13.65-14.25 ppm) and Hoogsteen (12.9-13.55 ppm) pairing, as well as the amino protons of adenosine (7.4-7.7 ppm). The amino protons of the protonated (8.5-10.0 ppm) and unprotonated (6.5-8.3 ppm) cytidines in the C.G.C+ base triple provide distinct markers as do the imino protons of the guanosine (12.6-13.3 ppm) and the protonated cytidine (14.5-16.0 ppm). The upfield chemical shift of the adenosine H8 protons (7.1-7.3 ppm) establishes that the oligopurine strand adopts an A-helical base stacking conformation in the 11-mer triplex. These results demonstrate that oligonucleotide triple helices can be readily monitored by NMR at the individual base-triple level with distinct markers differentiating between Watson-Crick and Hoogsteen pairing. Excellent exchangeable proton spectra have also been recorded for (R+)n.(Y-)n.(Y+)n 7-mer triple helices with the shorter length permitting spectra to be recorded at ambient temperature.(ABSTRACT TRUNCATED AT 250 WORDS)     

NMR structural studies of intramolecular (Y+)n.(R+)n(Y-)nDNA triplexes in solution: imino and amino proton and nitrogen markers of G.TA base triple formation.

We reported previously on NMR studies of (Y+)n.(R+)n(Y-)n DNA triple helices containing one oligopurine strand (R)n and two oligopyrimidine strands (Y)n stabilized by T.AT and C+.GC base triples [de los Santos, C., Rosen, M., & Patel, D. J. (1989) Biochemistry 28, 7282-7289]. Recently, it has been established that guanosine can recognize a thymidine.adenosine base pair to form a G.TA triple in an otherwise (Y+)n.(R+)n(Y-)n triple-helix motif. [Griffin, L. C., & Dervan, P. B. (1989) Science 245, 967-971]. The present study extends the NMR research to the characterization of structural features of a 31-mer deoxyoligonucleotide that folds intramolecularly into a 7-mer (Y+)n.(R+)n(Y-)n triplex with the strands linked through two T5 loops and that contains a central G.TA triple flanked by T.AT triples. The G.TA triplex exhibits an unusually well resolved and narrow imino and amino exchangeable proton and nonexchangeable proton spectrum in H2O solution, pH 4.85, at 5 degrees C. We have assigned the imino protons of thymidine and amino protons of adenosine involved in Watson-Crick and Hoogsteen pairing in T.AT triples, as well as the guanosine imino and cytidine amino protons involved in Watson-Crick pairing and the protonated cytidine imino and amino protons involved in Hoogsteen pairing in C+.GC triples in the NOESY spectrum of the G.TA triplex. The NMR data are consistent with the proposed pairing alignment for the G.TA triple where the guanosine in an anti orientation pairs through a single hydrogen bond from one of its 2-amino protons to the 4-carbonyl group of thymidine in the Watson-Crick TA pair.(ABSTRACT TRUNCATED AT 250 WORDS)     

Proton exchange and base pair opening in a DNA triple helix

Nuclear magnetic resonance spectroscopy has been used to characterize opening reactions and stabilities of individual base pairs in two related DNA structures. The first is the triplex structure formed by the DNA 31-mer 5'-AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT-3'. The structure belongs to the YRY (or parallel) family of triple helices. The second structure is the hairpin double helix formed by the DNA 20-mer 5'-AGAGAGAACCCCTTCTCTCT-3' and corresponds to the duplex part of the YRY triplex. The rates of exchange of imino protons with solvent in the two structures have been measured by magnetization transfer from water and by real-time exchange at 10 degrees C in 100 mM NaCl and 5 mM MgCl2 at pH 5.5 and in the presence of two exchange catalysts. The results indicate that the exchange of imino protons in protonated cytosines is most likely limited by the opening of Hoogsteen C+G base pairs. The base pair opening parameters estimated from imino proton exchange rates suggest that the stability of individual Hoogsteen base pairs in the DNA triplex is comparable to that of Watson-Crick base pairs in double-helical DNA. In the triplex structure, the exchange rates of imino protons in Watson-Crick base pairs are up to 5000-fold lower than those in double-helical DNA. This result suggests that formation of the triplex structure enhances the stability of Watson-Crick base pairs by up to 5 kcal/mol. This stabilization depends on the specific location of each triad in the triplex structure.     

Nuclear magnetic resonance structural studies of intramolecular purine.purine.pyrimidine DNA triplexes in solution. Base triple pairing alignments and strand direction

Recently, P.A. Beal and P.B. Dervan, expanding on earlier observations by others, have established the formation of purine.purine.pyrimidine triple helices stabilized by G.GC, A.AT and T.AT base triples where the purine-rich third strand was positioned in the major groove of the Watson-Crick duplex and anti-parallel to its purine strand. The present nuclear magnetic resonance (n.m.r.) study characterizes the base triple pairing alignments and strand direction in a 31-mer deoxyoligonucleotide that intramolecularly folds to generate a 7-mer (R/Y-)n.(R+)n(Y-)n triplex with the strands linked by two T5 loops and stabilized by potential T.AT and G.GC base triples. (R and Y stand for purine and pyrimidine, respectively, while the signs establish the strand direction.) This intramolecular triplex gives well-resolved exchangeable and non-exchangeable proton spectra with Li+ as counterion in aqueous solution. These studies establish that the T1 to C7 pyrimidine and the G8 to A14 purine strands are anti-parallel to each other and align through Watson-Crick A.T and G.C pair formation. The T15 to G21 purine-rich third strand is positioned in the major groove of this duplex and pairs through Hoogsteen alignment with the purine strand to generate T.AT and G.GC triples. Several lines of evidence establish that the thymidine and guanosine bases in the T15 to G21 purine-rich third strand adopt anti glycosidic torsion angles under conditions where this strand is aligned anti-parallel to the G8 to A14 purine strand. We have also recorded imino proton n.m.r. spectra for an (R-)n.(R+)n(Y-)n triplex stabilized by G.GC and A.AT triples through intramolecular folding of a related 31-mer deoxyoligonucleotide with Li+ as counterion. The intramolecular purine.purine.pyrimidine triplexes containing unprotonated G.GC, A.AT and T.AT triples are stable at basic pH in contrast to pyrimidine.purine.pyrimidine triplexes containing protonated C+.GC and T.AT triples, which are only stable at acidic pH.     

Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH.     

Proton NMR and optical spectroscopic studies on the DNA triplex formed by d-A-(G-A)7-G and d-C-(T-C)7-T.

Triplex and duplex formation of two deoxyribohexadecamers d-A-(G-A)-G (a) and d-C-(T-C)-T (b) have been studied by UV, CD, fluorescence, and proton NMR spectroscopy. Optical studies of a and b at dilute concentrations (microM range) yielded results similar to those seen for polymers of the same sequence, indicating that these hexadecamers have properties similar to the polymers in regard to triplex formation. The CD spectra of concentrated NMR samples (mM range) are similar to those observed at optical concentrations at both low and high pH, making possible a correlation between CD and NMR studies. In NMR spectra, two imido NH-N hydrogen bonded resonance envelopes at 12.6 and 13.7 ppm indicate that only the duplex conformation is present at pH greater than 7.7. Four new NH-N hydrogen-bonded resonance envelopes at 12.7, 13.5, 14.2, and 14.9 ppm are observed under acidic conditions (pH 5.6) and the two original NH-N resonances gradually disappear as the pH is lowered. Assignment of these four peaks to Watson-Crick G.C. Hoogsteen T.A Watson-Crick A.T, and Hoogsteen C+.G hydrogen-bonded imidos, respectively, confirm the formation of triple-stranded DNA NMR results also show that triplex is more stable than duplex at the same salt condition and that triplex melts to single strands directly without going through a duplex intermediate. However, in the melting studies, a structural change within the triple-stranded complex is evident at temperatures significantly below the major helix-to-coil transition. These studies demonstrate the feasibility of using NMR spectroscopy and oligonucleotide model compounds a and b for the study of DNA triplex formation.     

Proton NMR and Optical Spectroscopic Studies on the DNA Triplex Formed by d-A-(G-A)7-G and d-C-(T-C)7-T

Abstract

Triplex and duplex formation of two deoxyribohexadecamers d-A-(G-A)₇-G (a) and d-C-(T-C)₇-T (b) have been studied by UV, CD, fluorescence, and proton NMR spectroscopy. Optical studies of a and b at dilute concentrations (μM range) yielded results similar to those seen for polymers of the same sequence, indicating that these hexadecamers have properties similar to the polymers in regard to triplex formation. The CD spectra of concentrated NMR samples (mM range) are similar to those observed at optical concentrations at both low and high pH, making possible a correlation between CD and NMR studies. In NMR spectra, two imido NH-N hydrogen bonded resonance envelopes at 12.6 and 13.7 ppm indicate that only the duplex conformation is present at pH > 7.7. Four new NH-N hydrogen-bonded resonance envelopes at 12.7, 13.5, 14.2. and 14.9 ppm are observed under acidic conditions (pH 5.6) and the two original NH-N resonances gradually disappear as the pH is lowered. Assignment of these four peaks to Watson-Crick G · C, Hoogsteen T · A. Watson-Crick A · T. and Hoogsteen C⁺ · G hydrogen-bonded imidos, respectively, confirm the formation of triple-stranded DNA NMR results also show that triplex is more stable than duplex at the same salt condition and that triplex melts to single strands directly without going through a duplex intermediate. However, in the melting studies, a structural change within the triple-stranded complex is evident at temperatures significantly below the major helix-to-coil transition. These studies demonstrate the feasibility of using NMR spectroscopy and oligonucleotide model compounds a and b for the study of DNA triplex formation.     

NMR characterisation of a triple stranded complex formed by homo-purine and homo-pyrimidine DNA strands at 1:1 molar ratio and acidic pH.

Homo-purine (d-TGAGGAAAGAAGGT) and homo-pyrimidine (d-CTCCTTTCTTCC) oligomers have been designed such that they are complementary in parallel orientation. When mixed in a 1:1 molar ratio, the system adopts an antiparallel duplex at neutral pH with three mismatched base pairs. On lowering the pH below 5.5, a new complex is formed. The NMR results show the coexistence of a intermolecular pyrimidine.purine:pyrimidine DNA triplex and a single stranded oligopurine at this pH. The triplex is stabilized by five T.A:T, four C+.G:C and two mismatched triads, namely, C+.G-T and T.A-C. This triplex is further stabilized by a Hoogsteen C+.G base-pair on one end. Temperature dependence of the imino proton resonances reveals that the triplex dissociates directly into single strands around 55 degrees C, without duplex intermediates. Parallel duplexes are not formed under any of the conditions employed in this study.     

Homopurine and homopyrimidine strands complementary in parallel orientation form an antiparallel duplex at neutral pH with A-C,G-T,and T-C mismatched base pairs

DNA sequences d-TGAGGAAAGAAGGT (a 14-mer) and d-CTCCTTTCTTCC (a 12-mer) are complementary in parallel orientation forming either Donahue (reverse Watson-Crick) base pairing at neutral pH or Hoogsteen base pairing at slightly acidic pH. The structure of the complex formed by dissolving the two strands in equimolar ratio in water has been investigated by nmr. At neutral pH, the system forms an ordered antiparallel duplex with five A : T and four G : C Watson-Crick base pairs and three mismatches, namely G-T, A-C, and T-C. The nuclear Overhauser effect cross-peak pattern suggests an overall B-DNA conformation with major structural perturbations near the mismatches. The duplex has a low melting point and dissociates directly into single strands with a broad melting profile. The hydrogen-bonding schemes in the mismatched base pairs have been investigated. It has been shown earlier that in acidic pH, the system prefers a triple-stranded structure with two pyrimidine strands and one purine strand. One of the pyrimidine strands has protonated cytosines, forms Hoogsteen base pairing, and is aligned parallel to the purine strand; the other has nonprotonated cytosines and has base-pairing scheme similar to the one discussed in this paper. The parallel duplex is therefore less stable than either the antiparallel duplex or the triplex, in spite of its perfect complementarity. © 1997 John Wiley & Sons, Inc. Biopoly 41: 773–784, 1997     

Site-resolved energetics in DNA triple helices containing G*TA and T*CG triads

Recognition of specific sites in double-helical DNA by triplex-forming oligonucleotides has been limited until recently to sites containing homopurine-homopyrimidine sequences. G*TA and T*CG triads, in which TA and CG base pairs are specifically recognized by guanine or by thymine, have now extended this recognition code to DNA target sites of mixed base sequences. In the present work, we have obtained a characterization of the stabilities of G*TA and T*CG triads, and of the effects of these triads upon canonical triads, in triple-helical DNA. The three DNA triplexes investigated are formed by the folding of the 31-mers d(GAAXAGGT(5)CCTYTTCT(5)CTTZTCC) with X = G, T, or C, Y = C, A, or G, and Z = C, G, or T. We have measured the exchange rates of imino protons in each triad of the three triplexes using nuclear magnetic resonance spectroscopy. The exchange rates are used to map the local free energy of structural stabilization in each triplex. The results indicate that the stability of Watson-Crick base pairs in the G*TA and T*CG triads is comparable to that of Watson-Crick base pairs in canonical triads. The presence of G*TA and T*CG triads, however, destabilizes neighboring canonical triads, two or three positions removed from the G*TA/T*CG site. Moreover, the long-range destabilizing effects induced by the T*CG triad are larger than those induced by the G*TA triad. These findings reveal the molecular basis for the lower overall stability of G*TA- and T*CG-containing triplexes.     

Analysis of GAA/TTC DNA triplexes using nuclear magnetic resonance and electrospray ionization mass spectrometry

The formation of a GAA/TTC DNA triplex has been implicated in Friedreich's ataxia. The destabilization of GAA/TTC DNA triplexes either by pH or by binding to appropriate ligands was analyzed by nuclear magnetic resonance (NMR) and positive-ion electrospray mass spectrometry. The triplexes and duplexes were identified by changes in the NMR chemical shifts of H8, H1, H4, 15N7, and 15N4. The lowest pH at which the duplex is detectable depends upon the overall stability and the relative number of Hoogsteen C composite function G to T composite function A basepairs. A melting pH (pHm) of 7.6 was observed for the destabilization of the (GAA)2T4(TTC)2T4(CTT)2 triplex to the corresponding Watson-Crick duplex and the T4(CTT)2 overhang. The mass spectrometric analyses of (TTC)6.(GAA)6 composite function(TTC)6 triplex detected ions due to both triplex and single-stranded oligonucleotides under acidic conditions. The triplex ions disappeared completely at alkaline pH. Duplex and single strands were detectable only at neutral and alkaline pH values. Mass spectrometric analyses also showed that minor groove-binding ligands berenil, netropsin, and distamycin and the intercalating ligand acridine orange destabilize the (TTC)6.(GAA)6 composite function (TTC)6 triplex. These NMR and mass spectrometric methods may function as screening assays for the discovery of agents that destabilize GAA/TTC triplexes and as general methods for the characterization of structure, dynamics, and stability of DNA and DNA-ligand complexes.     

NMR structural studies of the ionizing radiation adduct 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) opposite deoxyadenosine in a DNA duplex. 8-Oxo-7H-dG(syn).dA(anti) alignment at lesion site

Proton NMR studies are reported on the complementary d(C1-C2-A3-C4-T5-A6-oxo-G7-T8-C9-A10-C11-C12).d(G13-G14-T15- G16-A17-A18-T19- A20-G21-T22-G23-G24) dodecanucleotide duplex (designated 8-oxo-7H-dG.dA 12-mer), which contains a centrally located 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) residue, a group commonly found in DNA that has been exposed to ionizing radiation or oxidizing free radicals. From the NMR spectra it can be deduced that this moiety exists as two tautomers, or gives rise to two DNA conformations, that are in equilibrium and that exchange slowly. The present study focuses on the major component of the equilibrium that originates in the 6,8-dioxo tautomer of 8-oxo-7H-dG. We have assigned the exchangeable NH1, NH7, and NH2-2 base protons located on the Watson-Crick and Hoogsteen edges of 8-oxo-7H-dG7 in the 8-oxo-7H-dG.dA 12-mer duplex, using an analysis of one- and two-dimensional nuclear Overhauser enhancement (NOE) data in H2O solution. The observed NOEs derived from the NH7 proton of 8-oxo-7H-dG7 to the H2 and NH2-6 protons of dA18 establish an 8-oxo-7H-dG7(syn).dA 18(anti) alignment at the lesion site in the 8-oxo-7H-dG.dA 12-mer duplex in solution. This alignment, which places the 8-oxo group in the minor groove, was further characterized by an analysis of the NOESY spectrum of the 8-oxo-7H-dG.dA 12-mer duplex in D2O solution. We were able to detect a set of intra- and interstrand NOEs between protons (exchangeable and nonexchangeable) on adjacent residues in the d(A6-oxo-G7-T8).d(A17-A18-T19) trinucleotide segment centered about the lesion site that establishes stacking of the oxo-dG7(syn).dA(anti) pair between stable Watson-Crick dA6.dT19 and dT8.dA17 base pairs with minimal perturbation of the helix. Thus, both strands of the 8-oxo-7H-dG.dA 12-mer duplex adopt right-handed conformations at and adjacent to the lesion site, the unmodified bases adopt anti glycosidic torsion angles, and the bases are stacked into the helix. The energy-minimized conformation of the central d(A6-oxo-G7-T8).d(A17-A18-T19) segment requires that the 8-oxo-7H-dG7(syn).dA18(anti) alignment be stabilized by two hydrogen bonds from NH7 and O6 of 8-oxo-7H-dG7(syn) to N1 and NH2-6 of dA18(anti), respectively, at the lesion site.(ABSTRACT TRUNCATED AT 400 WORDS)     

A novel palindromic triple-stranded structure formed by homopyrimidine dodecamer d-CTTCTCCTCTTC and homopurine hexamer d-GAAGAG.

We have carried out NMR and molecular mechanics studies on a complex formed when a palindromic homopyrimidine dodecamer (d-CTTCTCCTCTTC) and a homopurine hexamer (d-GAAGAG) are mixed in 1:1 molar ratio in aqueous solutions. Such studies unequivocally establish that two strands of each oligomer combine to form a triple-stranded DNA structure with a palindromic symmetry and with six T.A:T and six C+. G:C hydrogen-bonded base triads. The two purine strands are placed head to head, with their 3' ends facing each other in the center of the structure. One-half of each pyrimidine strand contains protonated and the other half contains non-protonated cytosines. The two half segments containing protonated cytosines are hydrogen bonded to each of the two purine hexamers through Hoogsteen T.A and C+.G base pairing. The segments containing non-protonated cytosines are involved in Watson-Crick (A:T and G:C) base pairing. This leads to a palindromic triplex with a C2-dyad symmetry with respect to the center of the structure. The complex is less stable at neutral pH, but the cytosines involved in Hoogsteen base pairing remain protonated even under these conditions. Molecular mechanics calculations using NMR constraints have provided a detailed three-dimensional structure of the complex. The entire stretches of purine, and the pyrimidine nucleotides have a conformation close to B-DNA.     

Internal dynamics in a DNA triple helix probed by (1)H-(15)N-NMR spectroscopy

The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.     

Evidence for a DNA triplex in a recombination-like motif: I. Recognition of Watson-Crick base pairs by natural bases in a high-stability triplex

Data are presented on a triplex type with two parallel homologous strands for which triplex formation is almost as strong as duplex formation at least for some sequences and even at pH 7 and 0.2 M NaCl. The evidence mainly rests upon comparing thermodynamic properties of similar systems. A paperclip oligonucleotide d(A12C4T12C4A12) with two linkers C4 obviously can form a triplex with parallel back-folded adenine strand regions, because the single melting transition of this complex splits in two transitions by introducing mismatches only in the third strand region. Respectively, a hairpin duplex d(A12C4T12) and a single strand d(A12) form a triplex as a 1:1 complex in which the second adenine strand is parallel oriented to the homologous one in the Watson-Crick paired duplex. In this system the melting temperature T(m) of the triplex is practically the same as that of the duplex d(A12)-d(T12), at least within a complex concentration range of 0.2-4.0 microM. The melting behaviour of complexes between triplex stabilizing ligand BePI and the system hairpin duplex plus single strand supports the triplex model. Non-denaturing gel electrophoresis suggests the existence of a triplex for a system in which five of the twelve A-T*A base triads are substituted by C-G*C base triads. The recognition between any substituted Watson-Crick base pair (X-Y) in the hairpin duplex d(A4XA7C4T7YT4) and the correspondingly replaced base (Z) in the third strand d(A4ZA7) is mutually selective. All triplexes with matching base substitutions (Z = X) have nearly the same stability (T(m) values from 29 to 33.5 degrees C), whereas triplexes with non-matching substitutions (Z not equal X) show a clearly reduced stability (T(m) values from 15 to 22 degrees C) at 2microM equimolar oligonucleotide concentration. Most nucleic acid triple helices hitherto known are limited to homopurine-homopyrimidine sequences in the target duplex. A stable triplex formation is demonstrated for inhomogeneous sequences tolerating at least 50% pyrimidine content in the homologous strands. On the basis of the surprisingly similar thermodynamic parameters for duplex and triplex, and of the fact that this triplex type seems to be more stable than many other natural DNA triplexes known, and on the basis of semiempirical and molecule mechanical calculations, we postulate bridging interactions of the third strand with the two other strands in the triplex according to the recombination motif. This triplex, denoted by us 'recombination-like form', tolerates heterogeneous base sequences.     

Structural features and stability of an RNA triple helix in solution.

A 30 nt RNA with a sequence designed to form an intramolecular triple helix was analyzed by one-and two-dimensional NMR spectroscopy and UV absorption measurements. NMR data show that the RNA contains seven pyrimidine-purine-pyrimidine base triples stabilized by Watson-Crick and Hoogsteen interactions. The temperature dependence of the imino proton resonances, as well as UV absorption data, indicate that the triple helix is highly stable at acidic pH, melting in a single sharp transition centered at 62 degrees C at pH 4.3. The Watson-Crick and Hoogsteen pairings are disrupted simultaneously upon melting. The NMR data are consistent with a structural model where the Watson-Crick paired strands form an A-helix. Results of model building, guided by NMR data, suggest a possible hydrogen bond between the 2' hydroxyl proton of the Hoogsteen strand and a phosphate oxygen of the purine strand. The structural model is discussed in terms of its ability to account for some of the differences in stability reported for RNA and DNA triple helices and provides insight into features that are likely to be important in the design of RNA binding compounds.     

Structural studies of the O6meG.C interaction in the d(C-G-C-G-A-A-T-T-C-O6meG-C-G) duplex

One- and two-dimensional nuclear magnetic resonance (NMR) experiments have been undertaken to investigate the conformation of the d(C1-G2-C3-G4-A5-A6-T7-T8-C9-O6meG10-C11-G12) self-complementary dodecanucleotide (henceforth called O6meG.C 12-mer), which contains C3.O6meG10 interactions in the interior of the helix. We observe intact base pairs at G2.C11 and G4.C9 on either side of the modification site at low temperature though these base pairs are kinetically destabilized in the O6meG.C 12-mer duplex compared to the G.C 12-mer duplex. One-dimensional nuclear Overhauser effects (NOEs) on the exchangeable imino protons demonstrate that the C3 and O6meG10 bases are stacked into the helix and act as spacers between the flanking G2.C11 and G4.C9 base pairs. The nonexchangeable base and H1', H2', H2', H3', and H4' protons have been completely assigned in the O6meG.C 12-mer duplex at 25 degrees C by two-dimensional correlated (COSY) and nuclear Overhauser effect (NOESY) experiments. The observed NOEs and their directionality demonstrate that the O6meG.C 12-mer is a right-handed helix in which the O6meG10 and C3 bases maintain their anti conformation about the glycosidic bond at the modification site. The NOEs between the H8 of O6meG10 and the sugar protons of O6meG10 and adjacent C9 exhibit an altered pattern indicative of a small conformational change from a regular duplex in the C9-O6meG10 step of the O6meG.C 12-mer duplex. We propose a pairing scheme for the C3.O6meG10 interaction at the modification site. Three phosphorus resonances are shifted to low field of the normal spectral dispersion in the O6meG.C 12-mer phosphorus spectrum at low temperature, indicative of an altered phosphodiester backbone at the modification site. These NMR results are compared with the corresponding parameters in the G.C 12-mer, which contains Watson-Crick base pairs at the same position in the helix.     

Molecular mechanics calculations on a triple stranded DNA involving C+.G-T and T.A+-C mismatched base triples

We have carried out molecular modeling of a triple stranded pyrimidine(Y). purine(R): pyrimidine(Y) (where ':' refers to Watson-Crick and '.' to Hoogsteen bonding) DNA, formed by a homopurine (d-TGAGGAAAGAAGGT) and homo-pyrimidine (d-CTCCTTTCTTCC). Molecular mechanics calculations using NMR constraints have provided a detailed three dimensional structure of the triplex. The entire stretches of purine and the pyrimidine nucleotides have a conformation close to B-DNA. The three strands are held by the canonical C+.G:C and T.A:T hydrogen bonds. The structure also contains two mismatch C+.G-T and T.A+-C base triples which have been characterized for the first time. In the A+-C base-pair of the T.A+-C triple, both hydrogen donors are situated on the purine (A+(1N) and A+(6N)). We observe a unique hydrogen bonding interaction scheme in case of C+.G-T where one acceptor, G(60), is bonded to three donors (C+(3NH), C+(4NH2) and T(3NH)). Though the C+.G-T base triple is less stable than C+.G:C, it is significantly more stable than T.A:T. On the other hand, T.A+-C is as stable as the T.A:T base triad.     

Structural properties of hybrid triplex of polycation deoxyribonucleic S-methylthiourea (DNmt) strands with a complementary DNA strand, probed by nanosecond molecular dynamics

The replacement of phosphodiester linkages of the polyanion DNA with S-methylthiourea linkers provides the polycation deoxyribonucleic S-methylthiourea (DNmt). Molecular dynamics studies to 1,220 ps of the hybrid triplex formed from octameric DNmt strands d(Tmt)8 with a complementary DNA oligomer strand d(Ap)8 have been carried out with explicit water solvent and Na+Cl- counterions under periodic boundary conditions using the CHARMM force field and the Ewald summation method. The Watson-Crick and Hoogsteen hydrogen-bonding patterns of the A/T tracts remained intact without any structural restraints for triplex structures throughout the simulation. The duplex portion of the triplex structure equilibrated at a B-DNA conformation in terms of the helical rise and other helical parameters. The dynamic structures of the DNmt x DNA x DNmt triplex were determined by examining histograms from the last 800 ps of the dynamics run. These included the hydrogen-bonding pattern (sequence recognition), three-centered bifurcating occurrences, minor groove width variations, and bending of tracts for the hybrid triplex structures. Together with the Watson-Crick hydrogen-bondings, the strong Hoogsteen hydrogen-bondings, the partially maintained three-centered bifurcatings in the Watson-Crick pair, and the medium-strength three-centered bifurcatings in the Hoogsteen pair suggest that the hybrid triplex is energetically favorable as compared to a duplex with similar base stacking, van der Waals interactions, and helical parameters. This is in agreement with our previously reported thermodynamic study, in which only triplex structures were observed in solution. The bending angle measured between the local axis vectors of the first and last helical axis segments is about 20 degrees for the Watson-Crick portion of the averaged structure. Propeller twist (associated with three-centered hydrogen-bonding) up to -30 degrees, native to DNA AT base pairing, was also observed for the triplex structure. The sugar pseudorotation phase angles and the ring rotation angles for the DNA strand are within the C3'-endo domain and C2'-endo domain for the DNmt strand. Water spines are observed in both minor and major grooves throughout the dynamics run. The molecular dynamics simulations of the structural properties of DNmt x DNA x DNmt hybrid triplex is compared to the DNG x DNA x DNG hybrid triplex (In DNG the -O-(PO2-)-O- linkers in DNA is replaced by -NH-C(=N+H2)-NH-).