共查询到20条相似文献,搜索用时 15 毫秒
1.
Quantitative analysis of red cell pyridine nucleotides has been unreliable in the past because of technical problems in extracting them in the presence of hemoglobin. A simple alcoholic extraction procedure for analysis of pyridine nucleotides in red blood cells is described in this paper. Pyridine nucleotides extracted in the presence of hemoglobin in solution show recoveries of NADH, NAD, and NADP averaging over 70%, while recoveries of NADPH were about 60%. In order to show that these techniques could detect actual intracellular differences in nucleotides inside red cells, two experiments were performed in which the ratios of the nucleotides would be predictably altered. Intact cells incubated in the presence of methylene blue show a decrease in the ratio, and intact cells incubated in the presence of hydrazine and lactate show an increase in the ratio. The changes in pyridine nucleotide ratios in these experiments are in the expected direction and were easily detected. Levels of pyridine nucleotides in red blood cells of normal human adults are also presented. 相似文献
2.
A nuclear exoribonuclease from Novikoff ascites cells was used to study the hydrolysis of single-stranded heteropolymers containing [14C]adenylic acid and either uridylic acid or cytidylic acid and heteropolymers of [14C]adenylic acid and one of the corresponding 2′--methylated nucleotides. The results of these studies indicate that both the rate and extent of hydrolysis are greatly inhibited by the presence of 2′--methylated nucleotides. Restriction of exonuclease activity by 2′--methylated nucleotides provides a possible mechanism for rRNA processing. 相似文献
3.
A range of metabolite concentrations have been determined in the liver of the adult and fetal guinea pig during the latter half of gestation. Adenine nucleotides showed little change during development of the fetal liver and the only major difference from the adult was a low ADP concentration. The hexose phosphates, particularly fructose 1,6-diphosphate, were higher and the triose phosphates in the glycolytic pathway after glyceraldehyde 3-phosphate were lower in the fetal liver. Cytosolic ratios were comparable in both adult and fetal livers as were cytosolic ratios for the last 15–20 days of gestation. The metabolite concentrations have been used to indicate that glycolysis in the fetal guinea pig liver is controlled largely by hexokinase, glyceraldehyde 3-phosphate dehydrogenase, and pyruvate kinase. 相似文献
4.
Upon illumination of suspensions of intact chloroplasts, fluorescence of 9-aminoacridine was quenched, light scattering was increased, chlorophyll fluorescence was decreased after an initial increase, and chloroplast ratios were increased. The response of 9-aminoacridine fluorescence quenching and light scattering to light intensity, anaerobiosis and inhibition of electron transport by DCMU was similar to that shown by chloroplast ratios. It is discussed under what conditions 9-aminoacridine fluorescence quenching or light scattering can be used to monitor changes in the phosphorylation state of the chloroplast adenylate system. 相似文献
5.
The crystal structure of an orthorhombic form of 2′-0-methyl cytidine was determined from three dimensional X-ray diffraction data. The two molecules in each asymmetric unit have C2- C3- puckered furanose rings. This differs from the C3- puckering observed for cytidine (1) and it may have some relevance to the kinks that appear at the two 2′-0-methylated nucleotides in the anticodon phosphate ester backbone of the phe tRNA structure (2). This work and other studies (3,4) show that the presence of a 2′-0-methyl group does not prevent the furanose moiety from adopting its most commonly observed configurations. 2′-0-methyl nucleotides make up a small percentage of the residues in HnRNA, rRNA, tRNA and mRNA and therefore their conformational nuances are of interest. 相似文献
6.
Since coupling between phosphorylation and electron transport cannot be measured directly in intact chloroplasts capable of high rates of photosynthesis, attempts were made to determine ratios from the quantum requirements of glycerate and phosphoglycerate reduction and from the extent of oxidation of added NADH via the malate shuttle during reduction of phosphoglycerate in light. These different approaches gave similar results. The quantum requirement of glycerate reduction, which needs 2 molecules of ATP per molecule of NADPH oxidized was found to be pH-dependent. 9–11 quanta were required at pH 7.6, and only about 6 at pH 7.0. The quantum requirement of phosphoglycerate reduction, which consumes ATP and NADPH in a ratio, was about 4 both at pH 7.6 and at 7.0. ratios calculated from the quantum requirements and the extent of phosphoglycerate accumulation during glycerate reduction were usually between 1.2 and 1.4, occasionally higher, but they never approached 2.Although the chloroplast envelope is impermeable to pyridine nucleotides, illuminated chloroplasts reduced added NAD via the malate shuttle in the absence of electron acceptors and also during the reduction of glycerate or CO2. When phosphoglycerate was added as the substrate, reduction of pyridine-nucleotides was replaced by oxidation and hydrogen was shuttled into the chloroplasts to be used for phosphoglycerate reduction even under light which was rate-limiting for reduction. This indicated formation of more ATP than NADPH by the electron transport chain. From the rates of oxidation of external NADH and of phosphoglycerate reduction at very low light intensities ratios were calculated to be between 1.1 and 1.4.Fully coupled chloroplasts reduced oxaloacetate in the light at rates reaching 80 and in some instances 130 μmoles · mg?1 chlorophyll · h?1 even though ATP is not consumed in this reaction. The energy transfer inhibitor phlorizin did not significantly suppress this reduction at concentrations which completely inhibited photosynthesis. Uncouplers stimulated oxaloacetate reduction by factors ranging from 1.5 to more than 10. Chloroplasts showing little uncoupler-induced stimulation of oxaloacetate reduction were highly active in photoreducing CO2. Measurements of light intensity dependence of quantum requirements for oxaloacetate reduction gave no indication for the existence of uncoupled or basal electron flow in intact chloroplasts. Rather reduction is brought about by loosely coupled electron transport. It is concluded that coupling of phosphorylation to electron transport in intact chloroplasts is flexible, not tight. Calculated ratios were obtained under conditions, where coupling should be expected to be optimal, i.e. at low phosphorylation potentials . Flexible coupling implies, that ratios should decrease with increasing phosphorylation potentials inside the chloroplasts. 相似文献
7.
Carmel M. Roberts Samuel P. Bessman 《Biochemical and biophysical research communications》1980,93(2):617-624
Creatine phosphate, nucleotides and glycolytic phosphate esters were estimated in extract of beating, in situ freeze clamped, to day fetal rat hearts by automated phosphate ester chromatography. Creatine phosphate increased more than 4-fold to almost 9 n moles per mg. protein at days, while ATP remained relatively constant at about 19 to 21 n moles per mg. protein. Most other nucleotides decreased as gestation advanced. ATP rather than creatine phosphate appears to be the major energy source of fetal rat heart. Except for glucose-6-phosphate, which increased, the glycolytic phosphate esters decreased only very slightly with advancing gestational age, suggesting a relatively stable basal glycolytic activity. Methodology includes correction for phosphate esters of whole blood trapped in extracts of in situ freeze clamped tissues. 相似文献
8.
The potencies of (?)--Δ9-THC, (+)--Δ9-THC, (+)--Δ9-THC, (?)--Δ8-THC and (+)--Δ8-THC were compared in several different species. (?)--Δ9-THC was 100 times more potent than (+)--Δ9-THC in depressing schedule-controlled responding in monkeys. The (+)- isomers were less effective than their corresponding (?)- isomers in the dog static-ataxia test, but potency ratios could not be determined due to a lack of dose-responsiveness of the (+)- isomers. However, it appeared that their potency differed by at least ten fold. The potency of (+)--Δ9-THC in the dog static-ataxia test was comparable to that of (+)--Δ9-THC. The hypothermia in mice produced by the (?) isomers of -Δ9-THC and -Δ8-THC were 9.1 and 30.4 times greater than that produced by their respective (+)-isomers. Also, the potency ratio of the (+)- and (?)--Δ9-THC was 5.6 as measured by depression of spontaneous activity in mice. The magnitude of the potency ratios of the THC stereo-isomers is dependent upon the species and the pharmacological test used. 相似文献
9.
Diguanosine nucleotides of fungi that regulate RNA polymerases isolated and partially characterised.
H B LéJohn L E Cameron D R McNaughton G R Klassen 《Biochemical and biophysical research communications》1975,66(2):460-467
Three unusual phosphorylated diguanosine compounds called ‘hot spots’ HS-1, HS-2 and HS-3 (ref. LéJohn, H.B. Proc. Can. Fed. Biol. Soc. 18, 159, 1975) have been isolated as acid-soluble materials from several fungi, and in their vegetative phase. The nucleotides were purified from acid extracts of and . The tentative structures of HS-3 and HS-2 determined are GppppG and GppppGp. HS-1 structure is still in doubt but it is related to HS-2. The structures were deduced from enzymatic digestion and UV analyses of the products, molar ratios of guanosine and phosphate, and chromatographic behaviour on PEI-cellulose. All three compounds accumulated in an inverse manner with rates of RNA synthesis and directly with rates of protein synthesis. The acid-soluble pools of the three compounds fluctuated during the life cycle of , and just prior to sporulation, were excreted into the medium. HS-2 was convertible to HS-3 by acid hydrolysis. 相似文献
10.
Atractyloside-insensitive binding of purine nucleotides is reduced in brown adipose tissue mitochondria of the obese () mouse. Exposure of the mouse to 4°C does not induce the usual increase in binding. Atractyloside-insensitive binding of purine nucleotides is believed to be a measure of the heat-producing proton conductance pathway in brown adipose tissue mitochondria. It is, therefore, suggested that the impaired thermogenesis of the mouse is due to a defect in this pathway in the mitochondria of the brown adipose tissue, the major thermogenic tissues in rodents. The greater metabolic efficiency which would result from a reduced operation of this pathway might be the basis for the obesity in the mouse. 相似文献
11.
Treatment of the eukaryotic organism with low concentrations of Ethidium Bromide causes accumulation of a protein-nucleic acid complex consisting of a DNA polymerase, a RNA polymerase, a deoxyribo-nuclease and a RNA linked DNA fragment. The length of the RNA is about 30 nucleotides, while the DNA part is around 200 nucleotides long. Degradations with ribonucleases and deoxyribonucleases strongly indicate that the RNA exists in a non-hybrid structure with a homogenous base composition and that the DNA is single-stranded. The complex is purified 1100 fold from whole cells and sodium dodecyl sulphate acrylamide gel electrophoresis gives 9 defined bands. The polynucleotide in the isolated complex accounts for only 10?4 of the total cellular DNA.As the complex contains some of the enzymes essential for discontinous DNA replication, in addition to a RNA linked Okazaki fragment, it is concluded that a highly purified has been isolated. 相似文献
12.
tRNA isolated from . grown in a medium containing [75Se] sodium selenosulfate was converted to nucleosides and analysed for selenonucleosides on a phosphocellulose column. Upon chromatography of the nucleosides on phosphocellulose column, the radioactivity resolved into three peaks. The first peak consisted of free selenium and traces of undigested nucleotides. The second peak was identified as 4-selenouridine by co-chromatographing with an authentic sample of 4-selenouridine. The identity of the third peak was not established. The second and third peaks represented 93% and 7% of the selenium present in nucleosides respectively. 相似文献
13.
A mouse MOPC21 cDNA previously cloned in plasmid pMB9(Higuchi , Proc. Natl. Acad. Sci. 73 (1976) 2136–2140; Wall , Nucleic Acid Res. 5 (1978) 3113–3128) and is designated pL21-3 has been extensively characterized. Cleavage of pL21-3 with Hpall has shown the insert to be 910 basepairs long, consistent with the length of the entire variable and constant regions and the untranslated regions. Digestion of pL21-3 with various restriction endonucleases has established that the insert sequence starts from parts of the 5′ leader region and extends downstream to include the untranslated 3′ terminus. 131 nucleotides in the variable region corresponding to amino acids 49–91 have been determined. 相似文献
14.
15.
The evidence for the suggested roles of cyclic nucleotides as regulators of cellular proliferation in normal, transformed and neoplastic cells is reviewed. It is concluded that cyclic nucleotides are not universal regulators of cellular proliferation or . The evidence which points to the involvement of cyclic nucleotides in the regulation of other aspects of cellular metabolism in neoplastic cells is presented. Finally, the implications of the experimental evidence for the clinical aspects of cancer is discussed. 相似文献
16.
Toshio Yanagida 《Journal of molecular biology》1981,146(4):539-560
The polarized fluorescence from nucleotides bound to myosin heads in glycerinated muscle fibers of rabbit psoas was measured as the number of myosin heads with bound nucleotides was varied by adding various concentrations of fluorescent ?-ATP, ?-ADP and ?-AMPPNP (1:N6-etheno-ATP, -ADP and -imido ATP). The angles of the absorption and emission dipoles of bound nucleotides to the fiber axis and their angular distribution were determined from the observed values of four components of the polarized fluorescence.The maximum amount of nucleotides bound to the myosin heads in the fiber, Bm, was 170 to 270 μm. The dissociation constant of nucleotides, , increased in the order ?-ATP, ?-ADP, ?-AMPPNP, and was four to six times larger at a sarcomere length (SL) of 2.1 μm than at 3.7 μm.The polarized fluorescence from bound ?-ADP at SL = 2.1 μm was independent of the amount of bound ?-ADP when it was lower than one-half of Bm, indicating a single helical array of myosin heads having ?-ADP. The angles of the absorption dipole, φA, and the emission dipole, φE, to the fiber axis were 69 ° and 66 °, respectively. As the amount of bound ?-ADP exceeded one-half of Bm, the values of the polarized fluorescence showed that the extra ?-ADP bound to myosin heads with a lower affinity and had different angles to the fiber axis: φA and φE were 49 ° and 54 °, respectively. The half-maximum width of the angular distribution of these bound ?-ADP molecules, , was about 20 °.During development of isometric tension in the presence of ?-ATP with Mg2+, the polarized fluorescence was independent of the amount of bound ?-ATP when it was lower than one-third of Bm or when the concentration of free ?-ATP was lower than 100 μm, indicating a single helical array of myosin heads undergoing the ATPase reaction. The angles of bound nucleotides, φA and φE, were 68 ° and 64 °, respectively. The half-maximum width of the angular distribution, , was about 22 °. As the amount of bound nucleotides exceeded one-third of Bm, the polarized fluorescence showed deviation from the values expected for the single helical array.The angles φA and φE for bound ?-AMPPNP were about 58 ° and 62 °, respectively, but the angular distribution was broad; that is, was about 42 °. These angles were independent of the amount of bound ?-AMPPNP.In a stretched fiber with SL = 3.7 μm, the polarized fluorescence showed that the angles of ?-ADP, ?-ATP and ?-AMPPNP bound to myosin heads had almost random distributions; was 90 ° to 100 °, independent of the amount of bound nucleotides. Similar results were obtained with the relaxed fiber in the presence of ?-ATP. 相似文献
17.
Calcium induction of transglutaminase and the formation of epsilon(gamma-glutamyl) lysine cross-links in cultured mouse epidermal cells 总被引:4,自引:0,他引:4
H Hennings P Steinert M M Buxman 《Biochemical and biophysical research communications》1981,102(2):739-745
A lysine tRNA (anticodon U1UU) was isolated from rat liver mitochondria and sequenced. The sequence, pCAUUGCGAm1Am2GCUUAGAGCm2GUUAACCU-t6AAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCAOH, can be written in cloverleaf form. It exhibits many unorthodox features, perhaps the most strikking of which is the small size of the D-arm consisting of only 9 nucleotides. The anticodon loop contains 2 hypermodified nucleotides, U127 (probably 5-methoxycarbonylmethyluridine) and t6A30 (N-[N-(9-β-D-ribofuranosylpurin-6-yl)carbamoyl]threonine). The presence of U1 in the first (“wobble”) position of the anticodon probably prevents the lysine tRNA from reading asparagine (AAY) codons. t6A, which is 3′-adjacent to the anticodon in most tRNAs recognizing codons starting with A, and other modified nucleosides occupy expected positions. We hypothesize that enzymes modifying the wobble position and the position 3′-adjacent to the anticodon recognize specific nucleotides in the anticodon. 相似文献
18.
The effect of depurination of polynucleotide templates on the fidelity of DNA synthesis in vitro has been determined. The fidelity of DNA synthesis with Escherichia coli DNA polymerase I, avian myeloblastosis virus DNA polymerase and human placenta DNA polymerase-β is decreased as a result of depurination of the poly[d(A-T)], poly[d(G-C)]and poly[d(A)]templates. The error rate with poly[d(A-T)]increased from to using E. coli Pol I, and from to using the myeloblastosis virus DNA polymerase. Depurination of poly[d(A)]increased the error rate from to using E. coli Pol I, and from to using the DNA polymerase-β from human placenta. Depurination of poly[d(G-C)]resulted in an increase in the error rate with E. coli Pol I from to , and with the virus DNA polymerase from to . This misincorporation is shown to be directly proportional to the extent of depurination. Deletion experiments and alkaline sucrose gradient analyses suggest that the incorporation of complementary and non-complementary nucleotides is dependent on polymerization, and occurs in the same newly synthesized product. Kinetic studies and nearest-neighbor analyses indicate that the incorporation of non-complementary nucleotides occurs randomly as single-base substitutions. The nearest-neighbor studies also suggest that any of the four deoxynucleotides can be incorporated opposite apurinic sites. The number of each nucleotide incorporated relative to the number of apurinic sites was determined to be for dGTP, for dCTP, for dATP and for dTTP with both the poly[d(A-T)] and poly[d(A)] templates. The frequencies of misincorporation relative to the number of apurinic sites with the poly[d(G-C)]template were for dATP, for dTTP, for dGTP and for dCTP. Hydrolysis at the apurinic sites by alkali treatment reversed the effects of depurination on fidelity. The error rates with the depurinated templates were reduced to within 2% of those obtained prior to depurination, providing additional evidence that the misincorporation after depurination results from apurinic sites on the template. These results suggest a possible relationship between depurination of DNA and errors in DNA replication and/or repair. 相似文献
19.
O Brown F Yein D Boehme L Foudin C S Song 《Biochemical and biophysical research communications》1979,91(3):982-990
Quinolinate phosphoribosyl transferase was rapidly inactivated in exposed to hyperbaric oxygen. The enzyme is essential for de novo biosynthesis of NAD in and man. Because of its sensitivity and essentiality, inactivation of this enzyme is proposed as a significant mechanism of cellular oxygen toxicity. Niacin which enters the NAD biosynthetic pathway below the oxygen-poisoned enzyme provided significant protection against the decrease in pyridine nucleotides and the growth inhibition from hyperoxia in and could be useful in cases of human oxygen poisoning. 相似文献
20.
Peter J.M. Van Haastert 《Biochemical and biophysical research communications》1984,124(2):597-604
D. discoideum contains kinetically distinguishable cell surface cAMP binding sites. One class, S, is slowly dissociating and has high affinity for cAMP (Kd = 15 nM, ). A second class is fast dissociating ( about 1 s) and is composed of high affinity binding sites H (Kd ≈ 60 nM), and low affinity binding sites L (Kd = ≈ 450 nM) which interconvert during the binding reaction. Guanine nucleotides affect these three binding types in membranes prepared by shearing D.discoideum cells through Nucleopore filters. The affinity of S for cAMP is reduced by guanine nucleotides from 13 nM to 25 nM, and the number of S-sites is reduced about 50%. The number of fast dissociating sites is not altered by guanine nucleotides, but these sites are mainly in the low affinity state. Half-maximal effects are obtained at about 1 μM GTP, 2 μM GDP and 10 μM Gpp(NH)p(guanyl-5′-yl-imidodiphosphate); ATP and ADP are without effect up to 1 mM. These results indicate that D.discoideum cells have a functionally active guanine nucleotide binding protein involved in the transduction of extracellular cAMP signals via cell surface cAMP receptors. 相似文献