Ketanserin in the treatment of traumatic vasospastic disease.

The specific serotonin receptor blocker ketanserin was given orally to 12 patients with traumatic vasospastic disease in a double blind crossover study. The effect of treatment was assessed by measuring finger systolic pressure and rewarming time after cold provocation and by medical interview and diaries. Median (range) percentage change in finger systolic pressure after cooling was 50 (0-100)% after treatment with ketanserin compared with 0 (0-90)% after placebo. Median (range) rewarming time after cooling decreased from 320 (236-972)s with placebo to 160 (88-404)s after treatment with ketanserin. These changes were not significant. Ninety five percent confidence intervals for difference between the treatments, however, showed that finger systolic pressure may be 80% better and rewarming time 256 seconds faster after treatment with ketanserin than after placebo. The number of attacks did not differ significantly between the two treatments. Two patients had a feeling of warmth in their hands during treatment with ketanserin. The results suggest that orally administered ketanserin may improve digital circulation in patients with traumatic vasospastic disease, but larger numbers of patients are required to assess the true effect of treatment with ketanserin in this disease.     

Treatment of vasospastic disease with prostaglandin E1.

Prostaglandin E1, a vasodilator and potent inhibitor of platelet aggregation, was administered to 26 patients with severe vasospastic disease of the hands. Patients tolerated infusions well and reported appreciable symptomatic improvement. Five of eight ischaemic ulcers healed in six weeks. Non-invasive studies of blood flow were used to observe haemodynamic changes during and after infusions. The Doppler-derived radial artery pulsatility index fell from 8.8 +/- 0.6 to 4.6 +/0 0.5 (mean +/- SEM), indicating hand vasodilatation. This fall was maintained 24 hours after infusion (5.9 +/- 0.9), but the index had returned to normal values at two weeks. The amplitude of finger pulse volume recordings increased (5.6 +/- 0.7 mm to 23.8 +/- 3.4 mm) and was raised two and six weeks after infusion (13.5 +/- 2.1 mm). Hand temperature measured by infrared radiometry also increased (27.4 +/- 0.7 degrees C to 31.2 +/- 1.2 degrees C). Intensity of digital vasospasm induced by cold water challenge was not objectively affected by prostaglandin E1 despite an increased finger temperature after infusion. Nevertheless, patients reported less frequent and severe attacks. Prostaglandin E1 given by central venous infusion is a safe new vasoactive agent that can produce appreciable symptomatic improvement by increasing digital perfusion, which may last for several weeks after treatment. Further study will define its mode of action and its place in the management of peripheral vascular disease.     

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.     

Rebound of vasospastic angina after cessation of long-term treatment with nifedipine.

The beneficial effect of calcium antagonists in the treatment of vasospastic angina is now well recognized. Although withdrawal symptoms have been reported following abrupt cessation of therapy with some cardiovascular drugs, there is no detailed report on similar complications of the cessation of therapy with calcium antagonists. In a 4-month period eight patients with well documented and well controlled vasospastic angina experienced a marked increase in the frequency and duration of anginal episodes at rest following the involuntary cessation of treatment with nifedipine, 10 to 20 mg four times a day. The increase began within 2 to 5 days after the cessation of treatment. Substitute therapy with isosorbide dinitrate, 30 mg, and verapamil, 80 to 120 mg, each four times a day, was effective in all cases. Although the mechanism responsible for this rebound phenomenon is not known, awareness of its existence is essential considering the widespread use of calcium antagonists.     

Biomechanical and phenotypic changes in the vasospastic canine basilar artery after subarachnoid hemorrhage.

Because it has been argued that active myogenic tone prolongs cerebral vasospasm for >2 wk after subarachnoid hemorrhage (SAH), we attempted to identify the mechanism that plays the main role in sustaining the prolonged cerebral vasospasm. We especially focused on the roles of biomechanical and phenotypic changes in the cerebral arteries in the mechanisms of prolonged vasospasm after SAH. We used the basilar arteries from a "two-hemorrhage" canine model to make serial measurements of maximal contraction capacity and arterial stiffness (papaverine-insensitive tone) until day 28. We also examined hematoxylin-eosin-stained vasospastic canine basilar arteries for histological changes and immunohistochemically examined them for expression of myosin heavy chain isoforms (SMemb, SM1, and SM2), which are markers of smooth muscle phenotypic changes. Changes in collagen concentration in canine basilar arteries were also measured. Angiographic cerebral vasospasm persisted until day 14 and then gradually diminished; artery diameter returned to the control diameters on day 28. Maximal contraction capacity decreased until day 21 and showed some recovery by day 28. Arterial stiffness, on the other hand, progressed until day 28. Histological examination revealed medial thickening and increased connective tissue until day 21 and a return to control findings by day 28. The increased connective tissue was not accompanied by changes in collagen concentration, suggesting a role of some other protein in the increase in connective tissue. Immunohistochemical studies with anti-SMemb, anti-SM1, and anti-SM2 antibodies showed enhanced expression of SMemb from day 7 to day 21 and disappearance of SM1 and SM2 on days 14 and 21. The changes in myosin heavy chain isoform expression returned to normal on day 28. The above results indicate that biomechanical and phenotypic changes may play a pivotal role in sustaining cerebral vasospasm for >2 wk after SAH, with minimal changes in active myogenic arterial tone.     

Adherence of peripheral blood neutrophils in X-ray operators.

The studies were conducted among 39 people (29 women and 10 men) operating X-ray equipment in radiology institutes and comparisons were made in the following schemes: A/ Group of persons operating the X-ray equipment (39 persons) and control group (18 persons). B/ A subgroup of persons that had been operating radiology equipment for > 5 years (29 workers was separated) and the results were compared with those for the subgroup of persons working < 5 years (10 workers). C/ Among the workers a subgroup of women (29) was separated and the results were compared with those for the subgroup of men (10 men). The following investigations were carried out: 1./ The absolute number of neutrophils in peripheral blood. 2./ Neutrophil adherence to fibres. 3./ Evaluation of CD 11b/CD 18 adhesion molecules expression on the surface of neutrophils. 4./ Evaluation of fibronectin concentration in serum. In the group A of the employees examined who operated X-ray units compared with the control group, the statistically significant decrease in the percentage of peripheral blood neutrophils showing adherence was observed and statistically significant decrease in median value and decrease of "Peak" value from the curve of the CD 18 adhesion molecule expression was detected and amounted to respectively: 91.0 +/- 4.26% adhering neutrophils in workers operating X-ray units and 94.8 +/- 2.98% in control group; values of median 120 +/- 4 in workers and 123 +/- 3 in control group in logarithmic scale; values of "Peak" 120 +/- 4 in workers and 123 +/- 3 in control group in logarithmic scale. Our own testing results show that the adherence properties of the peripheral blood neutrophils taken from X-ray operators are independent of the length of employment period and of the sex of the persons tested.     

High-temperature GC-MS-based serum cholesterol signatures may reveal sex differences in vasospastic angina

Alterations of cholesterol metabolism are responsible for vasospastic angina and atherosclerosis. To comprehensively evaluate cholesterol metabolism, 18 sterols, including cholesterol, 6 cholesteryl esters (CEs), 3 cholesterol precursors, and 8 hydroxycholesterols (OHCs), were simultaneously analyzed using hybrid solid-phase extraction (SPE) purification coupled to high-temperature gas chromatography-mass spectrometry (HTGC-MS). Methanol-based hybrid SPE increased the selective extraction, and HTGC resulted in a good chromatographic resolution for the separation of lipophilic compounds. The limits of quantification of cholesterol and CEs ranged from 0.2 to 10.0 μg/ml, while OHCs and cholesterol precursors ranged from 0.01 to 0.10 μg/ml. Linearity as the correlation coefficient was higher than 0.99 with the exception of cholesteryl laurate, myristate, oleate, and linoleate (r² > 0.98). The precision (% coefficient of variation) and accuracy (% bias) ranged from 1.1 to 9.8% and from 75.9 to 125.1%, respectively. The overall recoveries of CEs ranged from 26.1 to 64.0%, and the recoveries of other sterols ranged from 83.8 to 129.3%. The cholesterol signatures showed sex differences in patients with vasospastic angina and may associate with 24-reductases. This technique can be useful for making clinical diagnoses and for an increased understanding of the pathophysiology of vasospastic angina.     

Cloning of chemically synthesized lactose operators.

Recombinant DNA molecules, constructed from the ColE1-Mk5 hybrid plasmid PMB9 and a chemically synthesized wild-type lactose operator segment, have been used to transform Escherichia coli. Up to 10% of the transformants (selected for the tetracycline-resistance property of PMB9) are partially constitutive for the lactose operon enzyme beta-galactosidase. In vitro studies demonstrate that these partially constitutive transformants contain plasmid DNA molecules which carry one or more lactose operators, and which will bind purified lactose repressor. Preliminary results with some modified operator sequences are also presented.