Recent research in fragile X-associated tremor/ataxia syndrome

Fragile X-associated tremor/ataxia syndrome (FXTAS) is a cytosine–guanine–guanine repeat expansion neurological disease that occurs in a subset of aging carriers of the premutation (55–200 cytosine–guanine–guanine repeats) in the FMR1 gene located on the X chromosome. The clinical core involves intention tremor and gait ataxia. Current research seeks to clarify the pathophysiology and neuropathology of FXTAS, as well as the development of useful biomarkers to track the progression of FXTAS. Efforts to implement quantitative measures of clinical features, such as kinematics and cognitive measures, are of special interest, in addition to characterize the differences in progression in males compared with females and the efficacy of new treatments.     

A cerebellar tremor/ataxia syndrome among fragile X premutation carriers

Fragile X syndrome is a neurodevelopmental disorder that is not known to have any progressive neurological sequelae in adulthood. However, a neurological condition involving intention tremor, ataxia, and cognitive decline has recently been identified among older male carriers of premutation alleles of the FMR1 gene. This condition is clinically distinct from fragile X syndrome and arises through a different molecular mechanism involving the same gene (FMR1). Characteristic findings on magnetic resonance imaging include cerebral and cerebellar volume loss and altered signal intensities of the middle cerebellar peduncles. A striking feature of this fragile X-associated tremor/ataxia syndrome is the presence of ubiquitin-positive neuronal and astroglial intranuclear inclusions. Unlike the CAG repeat expansion diseases, which lead to altered protein products, there is no known protein abnormality among FMR1 premutation carriers. Thus, inclusion formation may reflect a gain-of-function effect of the FMR1 mRNA or the CGG repeat itself. Finally, since this syndrome may represent one of the more common single-gene causes of tremor, ataxia, and dementia among older males, FMR1 DNA testing should be considered when evaluating adult patients with tremor/ataxia.     

Mutation spectra in fragile X syndrome induced by deletions of CGG*CCG repeats

The fragile X syndrome results from expansions as well as deletions of the repeating CGG.CCG DNA sequence in the 5'-untranslated region of the FMR1 gene on the X chromosome. The relative frequency of disease cases promoted by these two types of mutations cannot be ascertained at present because the routine clinical assay monitors only expansions. At least 30 articles have been reviewed that document the involvement of deletions of part or all of the CGG.CCG repeats along with varying extents of DNA flanking regions as well as very small mutations including single base pair changes. Studies of deletion mutants of CGG.CCG tracts in Escherichia coli plasmids revealed a similar spectrum of mutagenic products. The triplet repeat tract in a non-B conformation is the mutagen, not the sequence per se in the right-handed B helix. Hence, molecular investigations in a simple model organism may generate useful initial information toward therapeutic strategies for this disease.     

Pur alpha binds to rCGG repeats and modulates repeat-mediated neurodegeneration in a Drosophila model of fragile X tremor/ataxia syndrome

Fragile X-associated tremor/ataxia syndrome (FXTAS) is a recently recognized neurodegenerative disorder in fragile X premutation carriers with FMR1 alleles containing 55-200 CGG repeats. Previously, we developed a Drosophila model of FXTAS and demonstrated that transcribed premutation repeats alone are sufficient to cause neurodegeneration, suggesting that rCGG-repeat-binding proteins (RBPs) may be sequestered from their normal function by rCGG binding. Here, we identify Pur alpha and hnRNP A2/B1 as RBPs. We show that Pur alpha and rCGG repeats interact in a sequence-specific fashion that is conserved between mammals and Drosophila. Overexpression of Pur alpha in Drosophila could suppress rCGG-mediated neurodegeneration in a dose-dependent manner. Furthermore, Pur alpha is also present in the inclusions of FXTAS patient brains. These findings support the disease mechanism of FXTAS of rCGG repeat sequestration of specific RBPs, leading to neuronal cell death, and implicate that Pur alpha plays an important role in the pathogenesis of FXTAS.     

Abnormal semantic processing in females with fragile X‐associated tremor/ataxia syndrome

Fragile X‐associated tremor/ataxia syndrome (FXTAS), a neurodegenerative disorder, affects fragile X (FMR1) gene premutation carriers in late life. Studies have shown cognitive impairments in FXTAS including executive dysfunction, working memory and visuospatial deficits. However, less is known about cognition in females with FXTAS. Thus, we examined semantic processing and verbal memory in female FXTAS patients with event‐related potentials (ERPs) and neuropsychological testing. Sixty‐one females (34 FXTAS, M_age = 62.7; 27 controls, M_age = 60.4) were studied with 32‐channel ERPs during a category judgment task in which semantically congruous (50%) and incongruous items were repeated approximately 10–140 seconds later. N400 and P600 amplitude data were submitted to analysis of covariance. Neuropsychological testing demonstrated lower performance in verbal learning and executive function in females with FXTAS. Event‐related potential analyses showed a significant reduction of the N400 congruity effect (incongruous ? congruous) in the FXTAS group. The N400 congruity effect reduction in females with FXTAS was mainly due to increased N400 amplitude to congruous new words. No significant abnormalities of the N400 repetition effect or the P600 repetition effect were found, indicating preserved implicit memory and verbal memory, respectively, in females with FXTAS. The decreased N400 congruity effect suggests abnormal semantic expectancy and/or semantic network disorganization in female FXTAS patients. The enhanced N400 amplitude to congruous new words may reflect decreased cognitive flexibility among FXTAS women, making access to less typical category exemplar words more difficult .     

MicroRNA expression profiling in blood from fragile X‐associated tremor/ataxia syndrome patients

Fragile X‐associated tremor/ataxia syndrome (FXTAS) is a late‐onset neurodegenerative disorder associated with FMR1 gene premutation alleles (55–200 CGG repeats). Fragile X‐associated tremor/ataxia syndrome clinical core features include action tremor, gait ataxia, cognitive deficits progressing to dementia, and frequently parkinsonism. Although the pathogenic molecular mechanism of FXTAS is not completely understood, the restriction of the phenotype to the FMR1 premutation range has given rise to a model based on a RNA toxic gain‐of‐function. Since the identification of the first microRNAs (miRNAs) and their role in normal development, several studies have associated them with neurodegenerative diseases such as Parkinson, Alzheimer and Huntington diseases, suggesting that they play a key role in brain development, as well as in its morphogenesis. Herein, we present the characterization of miRNA expression profiles in FXTAS male patients using deep sequencing‐based technologies and microarray technology. Deep sequencing analysis evidenced 83 miRNAs that were significantly deregulated whereas microarray analysis showed 31. When comparing these results, 14 miRNAs were found deregulated in FXTAS patients. MiR‐424 and miR‐574‐3p showed significant fold change adjusted P‐values in both platforms in FXTAS patients. MiR‐424 has been founded substantially and specifically enriched in human cerebral cortical white matter of Alzheimer disease patients, which, together with cerebral atrophy, is a prominent imaging finding in individuals with FXTAS. The study provides the first systematic evidence of differential miRNA expression changes in FXTAS blood samples. Although further studies are necessary to better characterize the miRNA function in FXTAS disorder, our results suggest that they might contribute to its pathogenesis.     

Crystal structures of restrictocin-inhibitor complexes with implications for RNA recognition and base flipping.

The cytotoxin sarcin disrupts elongation factor binding and protein synthesis by specifically cleaving one phosphodiester bond in ribosomes. To elucidate the molecular basis of toxin action, we determined three cocrystal structures of the sarcin homolog restrictocin bound to different analogs that mimic the target sarcin/ricin loop (SRL) structure of the rat 28S rRNA. In these structures, restrictocin contacts the bulged-G motif and an unfolded form of the tetraloop of the SRL RNA. In one structure, toxin loops guide selection of the target site by contacting the base critical for recognition (G4319) and the surrounding S-shaped backbone. In another structure, base flipping of the tetraloop enables cleavage by placing the target nucleotide in the active site with the nucleophile nearly inline for attack on the scissile bond. These structures provide the first views of how a site-specific protein endonuclease recognizes and cleaves a folded RNA substrate.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

Cyclic mismatch binding ligands interact with disease-associated CGG trinucleotide repeats in RNA and suppress their translation

Fragile X-associated tremor/ataxia syndrome (FXTAS) is a late-onset neurodegenerative disorder caused by a limited expansion of CGG repeats in the FMR1 gene. Degeneration of neurons in FXTAS cell models can be triggered by accumulation of polyglycine protein (FMRpolyG), a by-product of translation initiated upstream to the repeats. Specific aims of our work included testing if naphthyridine-based molecules could (i) block FMRpolyG synthesis by binding to CGG repeats in RNA, (ii) reverse pathological alterations in affected cells and (iii) preserve the content of FMRP, translated from the same FMR1 mRNA. We demonstrate that cyclic mismatch binding ligand CMBL4c binds to RNA structure formed by CGG repeats and attenuates translation of FMRpolyG and formation of nuclear inclusions in cells transfected with vectors expressing RNA with expanded CGG repeats. Moreover, our results indicate that CMBL4c delivery can reduce FMRpolyG-mediated cytotoxicity and apoptosis. Importantly, its therapeutic potential is also observed once the inclusions are already formed. We also show that CMBL4c-driven FMRpolyG loss is accompanied by partial FMRP reduction. As complete loss of FMRP induces FXS in children, future experiments should aim at evaluation of CMBL4c therapeutic intervention in differentiated tissues, in which FMRpolyG translation inhibition might outweigh adverse effects related to FMRP depletion.     

Distinctive structural motifs of RNA G-quadruplexes composed of AGG,CGG and UGG trinucleotide repeats

Trinucleotide repeats are microsatellite sequences that are polymorphic in length. Their expansion in specific genes underlies a number of neurodegenerative disorders. Using ultraviolet-visible, circular dichroism, nuclear magnetic resonance (NMR) spectroscopies and electrospray ionization mass spectrometry, the structural preferences of RNA molecules composed of two and four repeats of AGG, CGG and UGG in the presence of K⁺, Na⁺ and NH₄⁺ were analysed. (AGG)₂A, (AGG)₄A, p(UGG)₂U and p(UGG)₄U strongly prefer folding into G-quadruplexes, whereas CGG-containing sequences can adopt different types of structure depending on the cation and on the number of repeats. In particular, the two-repeat CGG sequence folds into a G-quadruplex in potassium buffer. We also found that each G-quadruplex fold is different: A:(G:G:G:G)A hexads were found for (AGG)₂A, whereas mixed G:C:G:C tetrads and U-tetrads were observed in the NMR spectra of G(CGG)₂C and p(UGG)₂U, respectively. Finally, our NMR study highlights the influence of the strand sequence on the structure formed, and the influence of the intracellular environment on the folding. Importantly, we highlight that although potassium ions are prevalent in cells, the structures observed in the HeLa cell extract are not always the same as those prevailing in biophysical studies in the presence of K⁺ ions.     

Recurrent and unexpected segregation of the FMR1 CGG repeat in a family with fragile X syndrome

Fragile X syndrome, the most common cause of hereditary mental retardation, results from amplification of a CGG trinucleotide repeat in the FMR1 gene. The transmission of the CGG repeat from premutated individuals to their premutated descendants is usually unstable, showing an increase in the size of the repeat. We report here a family which exhibits recurrent and unexpected transmission of the maternal premutation to three daughters. The first daughter exhibited mosaicism with two premutated alleles, one contracted and the other expanded. The second daughter showed a reversion from the maternal premutation to the normal range, and the third carried an expanded premutated allele associated with an expanded paternal allele within the normal range. These variations in the size of the CGG repeat may result from many different mechanisms such as DNA polymerase slippage on the leading or lagging strand during replication, large contractions of repeats on the parental strand during replication, or recombination through unequal crossover between sister chromatids. Our results suggest that the variation of the CGG premutated alleles in this family may be the result of intrinsic instability associated with a trans-acting factor such as a mismatch repair gene product. Received: 21 August 1995 / Revised: 21 September 1995     

CGG repeats associated with DNA instability and chromosome fragility form structures that block DNA synthesis in vitro.

A large increase in the length of a CGG tandem array is associated with a number of triplet expansion diseases, including fragile X syndrome, the most common cause of heritable mental retardation in humans. Expansion results in the appearance of a fragile site on the X chromosome in the region of the CGG array. We show here that CGG repeats readily form a series of barriers to DNA synthesis in vitro. There barriers form only when the (CGG)n strand is used as the template, are K(+)-dependent, template concentration-independent, and involve hydrogen bonding between guanines. Chemical modification experiments suggest these blocks to DNA synthesis result from the formation of a series of intrastrand tetraplexes. A number of lines of evidence suggest that both triplet expansion and chromosome fragility are the result of replication defects. Our data are discussed in the light of such evidence.     

Role of replication and CpG methylation in fragile X syndrome CGG deletions in primate cells

Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation.