Creation of genetic information by DNA polymerase of the archaeon Thermococcus litoralis: influences of temperature and ionic strength.

DNA polymerase of the archaeon Thermococcus litoralis can synthesize a long stretch of linear double-stranded DNA in the complete absence of added primer and template DNAs. This finding suggests that genetic information can potentially be created by protein. We report here the effects of temperature, ionic strength and pH on this ab initio DNA synthesis by the protein in vitro . When the temperature of the reaction was changed, the sequence of the product DNA changed markedly. For instance, the reaction products were (TAAT) n at 69 degrees C, (TATCCGGA) n at 84 degrees C and (TATCGCGATAGCGATCGC) n at 89 degrees C. The ionic strength of the reaction condition also affected the sequence: it was (TATCTAGA) n with 0 mM KCl, (TATATACG) n with 50 mM KCl and (TATAGTTATAAC) n with 100 mM KCl at 74 degrees C. When the pH of the reaction condition was changed from 6.8 to 10.8, the size of the product DNA decreased, but its sequence did not. These results demonstrate that DNA synthesized ab initio by DNA polymerase of T.litoralis is markedly influenced by the reaction conditions. The results also suggest that genetic information that might have been created by protein on the early earth is strongly influenced by environmental factors.     

DNA polymerase-catalyzed elongation of repetitive hexanucleotide sequences: application to creation of repetitive DNA libraries

We demonstrate the elongation of various hexanucleotide sequences with thermophilic DNA polymerase, under isothermal or thermal cyclic reaction conditions. We prepared 10 types of double repeat hexanucleotide duplexes with various GC compositions containing between 0 and 6 GC nucleotides per repeat and incubated these duplexes with thermophilic Taq DNA polymerase and dNTPs at various temperatures. All of the model repetitive short duplexes were elongated under the isothermal incubation conditions, although there were some differences in the elongation efficiencies derived from the GC composition in the repetitive sequences. It was also found that all of the model repetitive duplexes were extended more effectively by a 3-step thermal cyclic reaction involving denaturation, annealing, and extension. On the basis of this technique, we prepared a glutamate-encoding short repetitive duplex and created long repetitive DNAs under isothermal and thermal cyclic reaction conditions. DNA sequencing analysis of the cloned repetitive DNA revealed that well-ordered long repetitive DNAs of various chain lengths were created by this DNA polymerase-catalyzed ligation method, and these were easily cloned into vectors by the TA-cloning method. This method could be useful for obtaining DNAs encoding arbitrary long repetitive amino acid sequences more effectively than the conventional T4 ligase-catalyzed ligation method.     

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.     

Positive correlation between DNA polymerase alpha-primase pausing and mutagenesis within polypyrimidine/polypurine microsatellite sequences

Microsatellite DNA sequences are ubiquitous in the human genome, and mutation rates of these repetitive sequences vary with respect to DNA sequence as well as length. We have analyzed polymerase-DNA interactions as a function of microsatellite sequence, using polypyrimidine/polypurine di- and tetranucleotide alleles representative of those found in the human genome. Using an in vitro primer extension assay and the mammalian DNA polymerase alpha-primase complex, we have observed a polymerase termination profile for each microsatellite that is unique to that allele. Interestingly, a periodic termination profile with an interval size (9-11 nucleotides) unrelated to microsatellite unit length was observed for the [TC](20) and [TTCC](9) templates. In contrast, a unit-punctuated polymerase termination profile was found for the longer polypurine templates. We detected strong polymerase pauses within the [TC](20) allele at low reaction pH which were eliminated by the addition of deaza-dGTP, consistent with these specific pauses being a consequence of triplex DNA formation during DNA synthesis. Quantitatively, a strand bias was observed in the primer extension assay, in that polymerase synthesis termination is more intense when the polypurine sequence serves as the template, relative to its complementary polypyrimidine sequence. The HSV-tk forward mutation assay was utilized to determine the corresponding polymerase alpha-primase error frequencies and specificities at the microsatellite alleles. A higher microsatellite polymerase error frequency (50x10(-4) to 60x10(-4)) was measured when polypurine sequences serve as templates for DNA synthesis, relative to the polypyrimidine template (18x10(-4)). Thus, a positive correlation exists between polymerase alpha-primase pausing and mutagenesis within microsatellite DNA alleles.     

Sequence dependence for bypass of thymine glycols in DNA by DNA polymerase I.

Single-stranded phage DNAs containing thymine glycols were prepared by oxidation with osmium tetroxide (OsO4) and were used as templates for DNA synthesis by E. coli DNA polymerase I. The induction of thymine glycol lesions in DNA, as measured by immunoassay, quantitatively accounted for an inhibition of in vitro DNA synthesis on modified templates. Analysis of termination sites for synthesis by DNA polymerase I (Klenow fragment) showed that DNA synthesis terminated at most template thymine sites in OsO4-treated DNA, indicating that incorporation occurred opposite putative thymine glycols in DNA. Nucleotides 5' and 3' to putative thymine glycol sites affect the reaction, however, since termination was not observed at thymines in the sequence 5'-CTPur-3'. Conversion of thymine glycols to urea residues in DNA by alkali treatment caused termination of DNA synthesis one nucleotide 3' to template thymine sites, including thymines in the 5'-CTPur-3' sequence, showing that the effect of surrounding sequence is on the elongation reaction by DNA polymerase rather than differential damage induction by OsO4.     

Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction

Interspersed DNA elements of the form (dC-dA)n.(dG-dT)n constitute one of the most abundant human repetitive DNA families. We report that specific human (dC-dA)n.(dG-dT)n blocks are polymorphic in length among individuals and therefore represent a vast new pool of potential genetic markers. Comparison of sequences from the literature for (dC-dA)n.(dG-dT)n blocks cloned two or more times revealed length polymorphisms in seven of eight cases. Variations in the lengths of 10 (dC-dA)n.(dG-dT)n blocks were directly demonstrated by amplifying the DNA within and immediately flanking the repeat blocks by using the polymerase chain reaction and then resolving the amplified DNA on polyacrylamide DNA sequencing gels. Use of the polymerase chain reaction to detect DNA polymorphisms offers improved sensitivity and speed compared with standard blotting and hybridization.     

N.BspD6I DNA nickase strongly stimulates template-independent synthesis of non-palindromic repetitive DNA by Bst DNA polymerase

Highly efficient DNA synthesis without template and primer DNAs occurs when N.BspD6I DNA nickase is added to a reaction mixture containing deoxynucleoside triphosphates and the large fragment of Bst DNA polymerase. Over a period of 2 h, virtually all the deoxynucleoside triphosphates (dNTPs) become incorporated into DNA. Inactivation of N.BspD6I nickase by heating inhibits DNA synthesis. Optimal N.BspD6I activity is required to achieve high yields of synthesized DNA. Electron microscopy data revealed that the majority of DNA molecules have a branched structure. Cloning and sequencing of the fragments synthesized demonstrated that the DNA product mainly consists of multiple hexanucleotide non-palindromic tandem repeats containing nickase recognition sites. A possible mechanism is discussed that addresses template-independent DNA synthesis stimulated by N.BspD6I nickase.     

Selective inhibition of phiX RFII compared with fd RFII DNA synthesis in vitro. II. Resolution of discrimination reaction into multiple steps.

In the presence of RNA polymerase, RNase H, discriminatory factors alpha and beta, Escherichia coli binding protein, DNA elongation factor I, DNA elongation factor II preparation, DNA polymerase III, and ATP, UTP, GTP, CTP, dATP, dTTP, dGTP, and dCTP, fd viral DNA can be quantitatively converted to RFII containing a unique gap in the linear minus strand. This gap, mapped with the aid of restriction endonucleases HinII and HpaII, is located within Fragment Hpa-H of the fd genome. The discrimination reaction has been resolved into two steps: Step A, fd viral DNA, E. coli binding protein, and discriminatory factors alpha and beta form a protein DNA complex; Step B, the complex isolated by agarose gel filtration selectively forms fd RFII when supplemented with RNase H, RNA polymerase, and the DNA elongation proteins. The omission of any of the proteins described above during the first reaction resulted in either no discrimination or a decrease in discrimination when the missing protein was added during the second step. Results are presented which indicate that E. coli binding protein, discriminatory factors alpha and beta, and RNase H must be present during the time RNA synthesis occurs in order to selectively form RFII from fd DNA and not phiX RFII. The amount of fd and phiX174 RNA-DNA hybrid formed in vitro is directly related to the DNA synthesis observed. Thus, under discriminatory conditions, only fd viral DNA leads to fd RNA-DNA complexes and no phiX RNA-DNA hybrid is formed. Under nondiscriminatory conditions, both DNAs yield RNA-DNA hybrids and DNA synthesis. In the absence of discriminatory factor alpha, no RNA-DNA hybrid is formed with either DNA, and in turn, no DNA synthesis is detected with either DNA template.     

Mutational analysis of primosome assembly sites. I. Distinct classes of mutants in the pBR322 Escherichia coli factor Y DNA effector sequences

The assembly of the primosome, a multienzyme complex responsible for priming of lagging-strand DNA synthesis in Escherichia coli, occurs on defined regions of DNA. These primosome assembly sites are on the order of 70 nucleotides in length, yet they share little DNA sequence homology. In order to understand the interaction of the primosomal proteins with these sites, the isolation of single-base substitution mutants of the wild-type sequences has been undertaken. The response of 32 of these mutated primosome assembly sites to increasing concentrations of monovalent and divalent cations when they were used as DNA effectors for E. coli replication factor Y-catalyzed ATP hydrolysis and their efficiency as primosome-dependent DNA replication templates have revealed the existence of four distinct classes of mutations in primosome assembly sites. Class I mutations have essentially no effect on the activities elicited by the DNA site; thus, it is likely that they define nonessential or spacer nucleotide residues. Class II mutated DNAs require higher Mg2+ concentrations than the wild-type DNA to be fully activated as factor Y ATPase effectors and cannot be stimulated in the ATPase reaction by monovalent salt at suboptimal levels of Mg2+. The implication of this mutant phenotype on the role of secondary and tertiary DNA structure in determining an active site is examined in the accompanying article (Soeller, W., Abarzúa, P., and Marians, K. J. (1984) J. Biol. Chem. 259, 14293-14300). Class III mutations coinactivate both the ATPase effector and DNA replication template activity of the site, indicating that they probably represent essential contact points between factor Y and the DNA. Class IV mutated DNAs behave in a manner similar to class II mutated DNAs in the ATPase reaction, but have a replication template activity intermediate between that of the class III and class II mutant DNAs. It is possible that these mutant DNAs are deficient in their ability to catalyze, during primosome assembly, a step subsequent to that of factor Y binding.(ABSTRACT TRUNCATED AT 400 WORDS)     

Intermediate filaments reconstituted from vimentin, desmin, and glial fibrillary acidic protein selectively bind repetitive and mobile DNA sequences from a mixture of mouse genomic DNA fragments

Employing the whole-genome PCR technique, intermediate filaments (IFs) reconstituted from vimentin, desmin, and glial fibrillary acidic protein were shown to select repetitive and mobile DNA sequence elements from a mixture of mouse genomic DNA fragments. The bound fragments included major and minor satellite DNA, telomere DNA, minisatellites, microsatellites, short and long interspersed nucleotide elements (SINEs and LINEs), A-type particle elements, members of the mammalian retrotransposon-like (MaLR) family, and a series of repeats not assignable to major repetitive DNA families. The latter sequences were either similar to flanking regions of genes; possessed recombinogenic elements such as polypurine/polypyrimidine stretches, GT-rich arrays, or GGNNGG signals; or were characterized by the distribution of oligopurine and pyrimidine motifs whose sequential and vertical alignment resulted in patterns indicative of high recombination potentials of the respective sequences. The different IF species exhibited distinct quantitative differences in DNA selectivities. Complexes consisting of vimentin IFs and DNA fragments containing LINE, (GT)(n) microsatellite, and major satellite DNA sequences were saturable and dynamic and were formed with high efficiency only when the DNAs were partially denatured. The major-groove binder methyl green exerted a stronger inhibitory effect on the binding reaction than did the minor-groove binder distamycin A; the effects of the two compounds were additive. In addition, DNA footprinting studies revealed significant configurational changes in the DNA fragments on interaction with vimentin IFs. In the case of major satellite DNA, vimentin IFs provided protection of the T-rich strand from cleavage by DNase I, whereas the A-rich strand was totally degraded. Taken together, these observations suggest that IF protein(s) bind to double-stranded DNAs at existing single-stranded sites and, taking advantage of their helix-destabilizing potential, further unwind them via a cooperative effort of their N-terminal DNA-binding regions. A comparison of the present results with literature data, as well as a search in the NCBI database, showed that IF proteins are related to nuclear matrix attachment region (MAR)-binding proteins, and the DNA sequences they interact with are very similar or even identical to those involved in a plethora of DNA recombination and related repair events. On the basis of these comparisons, IF proteins are proposed to contribute in a global fashion, not only to genetic diversity, but also to genomic integrity, in addition to their role in gene expression.     

Elongation of palindromic repetitive DNA by DNA polymerase from hyperthermophilic archaea: a mechanism of DNA elongation and diversification

DNA polymerase from hyperthermophilic bacteria can elongate tandem repetitive oligoDNA with a complete or incomplete palindromic sequence under isothermal conditions by "hairpin elongation". However, the product of the reaction has not yet been sufficiently characterized. Here, I demonstrate that when palindromic repetitive oligoDNA, e.g., (5'AGATATCT3')(6), was added as a "seed" to the DNA synthesis reaction catalyzed by DNA polymerase from the archaea Thermococcus litoralis (Vent polymerase) at 74 degrees C, the product was (5'AGATATCT3')(n). The product itself was palindromic and repetitive, and its motif (unit) sequence was exactly the same as that of the seed oligoDNA. On the other hand, when a pseudopalindrome, which contains a palindrome-breaking nucleotide (underlined), was present in seed oligoDNA, e.g., (5'GATTC3')(6), the product was (5'GATATC3')(n), which had a different motif sequence from that of the seed oligoDNA. When a pseudopalindrome (5'AGATATCA3')(6) was added to the reaction, the products were 5'TATCA . (AGATATCA)(3) . AGATATCT . (TGATATCT)(5) . TGATA3', etc. When 5'AGATATCA . (AGATATCT3')(5) was added, products were 5'TATCT . (AGATATCT)(2).TGATATCT . AGATATCT . AGATATCA . AGATATCT . AGA3', etc., demonstrating the generation of many "mutations" in the product DNA. I conclude that a tandem repetitive sequence is faithfully elongated (amplified) by hyperthermophilic DNA polymerase if it is completely palindromic, but is elongated with many errors if it is incompletely palindromic (pseudopalindromic) or mixed with a pseudopalindrome. The results suggest a protein-catalyzed elongation/diversification mechanism of short repetitive DNAs on the early earth.     

A Method for Mapping Germ Line Sequences in Tetrahymena Thermophila Using the Polymerase Chain Reaction

A method for mapping DNA sequences to specific germinal chromosomes in the ciliated protozoan Tetrahymena thermophila has been developed. This mapping technique (PCR mapping) utilizes the polymerase chain reaction and template DNA derived from nullisomic strains to directly assign micronuclear DNA sequences to specific micronuclear chromosomes. Using this technique, a number of unique sequences and short repetitive sequences flanked by unique sequences have been mapped to four of the five germinal chromosomes.     

DNA synthesis dependent on genetic recombination: characterization of a reaction catalyzed by purified bacteriophage T4 proteins

To simulate a reaction that occurs in T4-infected cells, we have developed an in vitro DNA synthesis system that requires seven highly purified proteins encoded by this bacteriophage: the DNA polymerase "holoenzyme" (four proteins), gene 32 protein, dda DNA helicase, and uvsX protein - an enzyme that catalyzes homologous DNA pairing and is functionally homologous to the recA protein. In the reaction observed, the 3'OH end of one single-stranded DNA molecule primes DNA synthesis using a double-stranded DNA molecule of homologous sequence as the template. The uvsX protein continuously removes the new DNA chain from its template, so that DNA is synthesized by a conservative mechanism. This type of reaction, which requires the cooperation of recombination and replication enzymes, seems likely to be a general feature of DNA metabolism.     

Misalignment-mediated DNA polymerase beta mutations: comparison of microsatellite and frame-shift error rates using a forward mutation assay

Mutations arising in microsatellite DNA are associated with neurological diseases and cancer. To elucidate the molecular basis of microsatellite mutation, we have determined the in vitro polymerase error frequencies at microsatellite sequences representative of those found in the human genome: [GT/CA](10), [TC/AG](11), and [TTCC/AAGG](9). DNA templates contained the microsatellites inserted in-frame into the 5' region of the herpes simplex virus thymidine kinase (HSV-tk) gene. Polymerase beta (polbeta) error frequencies were quantitated in microsatellite sequences, relative to frame-shift error frequencies in coding sequences, from the same DNA synthesis reaction. The polbeta error frequencies within the dinucleotide sequences were (2-9) x 10(-3), 14-72-fold higher than the ssDNA template frequencies. The polbeta error frequencies within the tetranucleotide sequences were (4-6) x 10(-3), a 4-13-fold increase over background. Strand biases were observed for the [TC/AG](11) and [TTCC/AAGG](9) alleles, in which more errors were produced when the purine strand served as a template. Mutations within each microsatellite included noncanonical base substitution events and single nucleotide deletions as well as the expected unit length changes. An exponential relationship was observed between the polymerase error frequency per site and both the number of repetitive units and total length of the allele. Our observations are consistent with the strand slippage model of microsatellite mutagenesis and demonstrate that DNA sequence and/or structural differences result in mutational strand biases. To our knowledge, this is the first direct quantitation of DNA polymerase errors in vitro using template microsatellite sequences.     

A high frequency of length polymorphisms in repeated sequences adjacent to Alu sequences

We describe a new class of DNA length polymorphism that is due to a variation in the number of tandem repeats associated with Alu sequences (Alu sequence-related polymorphisms). The polymerase chain reaction was used to selectively amplify a (TTA)n repeat identified in the 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase gene from genomic DNA of 41 human subjects, and the size of the amplified products was determined by gel electrophoresis. Seven alleles were found that differed in size by integrals of three nucleotides. The allele frequencies ranged from 1.5% to 52%, and the overall heterozygosity index was 62%. The polymorphic TTA repeat was located adjacent to a repetitive sequence of the Alu family. A homology search of human genomic DNA sequences for the trinucleotide TTA (at least five members in length) revealed tandem repeats in six other genes. Three of the six (TTA)n repeats were located adjacent to Alu sequences, and two of the three (in the genes for beta-tubulin and interleukin-1 alpha) were found to be polymorphic in length. Tandemly repetitive sequences found in association with Alu sequences may be frequent sites of length polymorphism that can be used as genetic markers for gene mapping or linkage analysis.