New insights into the karyotypic relationships of Chinese muntjac (Muntiacus reevesi), forest musk deer (Moschus berezovskii) and gayal (Bos frontalis)

To investigate the karyotypic relationships between Chinese muntjac (Muntiacus reevesi), forest musk deer (Moschus berezovskii) and gayal (Bos frontalis), a complete set of Chinese muntjac chromosome-specific painting probes has been assigned to G-banded chromosomes of these three species. Sixteen autosomal probes (i.e. 6-10, 12-22) of the Chinese muntjac each delineated one pair of conserved segments in the forest musk deer and gayal, respectively. The remaining six autosomal probes (1-5, and 11) each delineated two to five pairs of conserved segments. In total, the 22 autosomal painting probes of Chinese muntjac delineated 33 and 34 conserved chromosomal segments in the genomes of forest musk deer and gayal, respectively. The combined analysis of comparative chromosome painting and G-band comparison reveals that most interspecific homologous segments show a high degree of conservation in G-banding patterns. Eleven chromosome fissions and five chromosome fusions differentiate the karyotypes of Chinese muntjac and forest musk deer; twelve chromosome fissions and six fusions are required to convert the Chinese muntjac karyotype to that of gayal; one chromosome fission and one fusion separate the forest musk deer and gayal. The musk deer has retained a highly conserved karyotype that closely resembles the proposed ancestral pecoran karyotype but shares none of the rearrangements characteristic for the Cervidae and Bovidae. Our results substantiate that chromosomes 1-5 and 11 of Chinese muntjac originated through exclusive centromere-to-telomere fusions of ancestral acrocentric chromosomes.     

New evidence for tandem chromosome fusions in the karyotypic evolution of Asian muntjacs

A clone of highly repetitive DNA, designated C5, was isolated from DNA of female Chinese muntjac cells. The nucleotide sequence of this clone is 80%–85% homologous to that of the satellite IA clone and other highly repetitive DNA clones previously obtained from the Indian muntjac. Using C5 as a probe for in situ hybridizations to chromosome preparations of cells of both the Chinese and Indian muntjacs, we were able to show that these repeated sequences occur in centromeric heterochromatin of the chromosomes of both Chinese and indian muntjac species. More significantly, non-random clusters of hybridization signals were detected on the arms of chromosomes of the Indian muntjac. These latter hybridization sites are postulated to be regions of interstitial heterochromatin and could be the remnants of centromeric heterochromatin from ancestral Chinese muntjac chromosomes. Our observations provide new supportive evidence for the tandem chromosome fusion theory that has been proposed for the evolution of the Indian muntjac karyotype.by P.B. Moens     

Cervid satellite DNA and karyotypic evolution of Indian muntjac

Five satellite DNA families (designated as satellite I?CV) have been identified in the Cervidae so far. Among those, satellite I, II and IV are centromere specific. Satellite I and II are shared by large number of deer species, where satellite IV is highly conserved among several deer species examined. Satellite III was initially thought to be roe deer specific but later identified in Chinese water deer as well. SatelliteV is Y-chromosome specific for several Asian deer species examined but also found in the pericentric region of Indian muntjac chromosome 3 and in X chromosome of Chinese water deer. The observation of interstitial hybridization sites on Indian muntjac chromosomes with satellite DNA I probe generated from Chinese muntjac provides the first molecular evidence supporting the tandem fusion theory that 2n=6??/7??of Indian muntjac karyotype could derive from an ancestral Chinese muntjac-like species with 2n=46. Interspecies chromosome painting study and the maximum number of interstitial hybridization detected with satellite I and satellite II DNA probes lend support to the hypothesis that the Indian muntjac karyotype could evolve directly from an ancestral Chinese water deer-like species with 2n=70. Such hypothesis is further substantiated by the finding of satellite V signals presented in specific chromosome regions between the Chinese water deer and the Indian muntjac chromosomes.     

Reciprocal painting between humans, De Brazza's and patas monkeys reveals a major bifurcation in the Cercopithecini phylogenetic tree

We report on reciprocal painting between humans and two Cercopithecini species, Erythrocebus patas (patas monkey) and Cercopithecus neglectus (De Brazza's monkey). Both human and monkeys chromosome-specific probes were made by degenerate oligonucleotide primed PCR (DOP-PCR) from flow sorted chromosomes. Metaphases of both monkey species were first hybridized with human chromosome-specific probes and then human metaphases were hybridized with chromosome paints from each monkey species. The human paint probes detected 34 homologous segments on the C. neglectus karyotype, while the C. neglectus probes, including the Y, revealed 41 homologous segments on the human karyotype. The probes specific for human chromosomes detected 29 homologous segments in the E. patas karyotype, while the patas monkey probes painted 34 segments on the human karyotype. We tested various hypotheses of Cercopithecini phylogeny and taxonomy developed by morphologists, molecular biologists and cytogeneticists. Our hybridization data confirm that fissions (both Robertsonian and non-Robertsonian) are the main mechanism driving the evolutionary trend in Cercopithecini toward higher diploid numbers and strongly suggest an early phylogenetic bifurcation in Cercopithecini. One branch leads to Cercopithecus neglectus/Cercopithecus wolfi while the other line leads to Erythrocebus patas/Chlorocebus aethiops. Allenopithecus nigroviridis may have diverged prior to this major phylogenetic node.     

Comparative gene mapping in the species Muntiacus muntjac.

An extreme case of chromosomal evolution is presented by the two muntjac species Muntiacus muntjac (Indian muntjac, 2n = 6 [females], 7 [males]) and M. reevesi (Chinese muntjac, 2n = 46). Despite disparate karyotypes, these phenotypically similar species produce viable hybrid offspring, indicating a high degree of DNA-level conservation and genetic relatedness. As a first step toward development of a comparative gene map, several Indian muntjac homologs of known human type I anchor loci were mapped. Using flow-sorted, chromosome-specific Southern hybridization techniques, homologs of the protein kinase C beta polypeptide (PRKCB1) and the DNA repair genes ERCC2 and XRCC1 have been assigned to Indian muntjac chromosome 2. The male-specific ZFY gene was presumptively mapped to Indian muntjac chromosome Y2. Ultimate generation of a comparative physical map of both Indian and Chinese muntjac chromosomes will prove invaluable in the study of mammalian karyotype evolution.     

Defining the orientation of the tandem fusions that occurred during the evolution of Indian muntjac chromosomes by BAC mapping

The Indian muntjac (Muntiacus muntjak vaginalis) has a karyotype of 2n=6 in the female and 7 in the male, the karyotypic evolution of which through extensive tandem fusions and several centric fusions has been well-documented by recent molecular cytogenetic studies. In an attempt to define the fusion orientations of conserved chromosomal segments and the molecular mechanisms underlying the tandem fusions, we have constructed a highly redundant (more than six times of whole genome coverage) bacterial artificial chromosome (BAC) library of Indian muntjac. The BAC library contains 124,800 clones with no chromosome bias and has an average insert DNA size of 120 kb. A total of 223 clones have been mapped by fluorescent in situ hybridization onto the chromosomes of both Indian muntjac and Chinese muntjac and a high-resolution comparative map has been established. Our mapping results demonstrate that all tandem fusions that occurred during the evolution of Indian muntjac karyotype from the acrocentric 2n=70 hypothetical ancestral karyotype are centromere–telomere (head–tail) fusions.     

Characterization of ancestral chromosome fusion points in the Indian muntjac deer

Tandem fusion, a rare evolutionary chromosome rearrangement, has occurred extensively in muntjac karyotypic evolution, leading to an extreme fusion karyotype of 6/7 (female/male) chromosomes in the Indian muntjac. These fusion chromosomes contain numerous ancestral chromosomal break and fusion points. Here, we designed a composite polymerase chain reaction (PCR) strategy which recovered DNA fragments that contained telomere and muntjac satellite DNA sequence repeats. Nested PCR confirmed the specificity of the products. Two-color fluorescence in situ hybridization (FISH) with the repetitive sequences obtained and T₂AG₃ telomere probes showed co-localization of satellite and telomere sequences in Indian muntjac chromosomes. Adjacent telomere and muntjac satellite sequences were also seen by fiber FISH. These data lend support to the involvement of telomere and GC-rich satellite DNA sequences during muntjac chromosome fusions.Communicated by E.A. NiggAccession numbers: AY322158, AY322159, AY322160     

Comparative sequence analyses reveal sites of ancestral chromosomal fusions in the Indian muntjac genome

Background

Indian muntjac (Muntiacus muntjak vaginalis) has an extreme mammalian karyotype, with only six and seven chromosomes in the female and male, respectively. Chinese muntjac (Muntiacus reevesi) has a more typical mammalian karyotype, with 46 chromosomes in both sexes. Despite this disparity, the two muntjac species are morphologically similar and can even interbreed to produce viable (albeit sterile) offspring. Previous studies have suggested that a series of telocentric chromosome fusion events involving telomeric and/or satellite repeats led to the extant Indian muntjac karyotype.

Results

We used a comparative mapping and sequencing approach to characterize the sites of ancestral chromosomal fusions in the Indian muntjac genome. Specifically, we screened an Indian muntjac bacterial artificial-chromosome library with a telomere repeat-specific probe. Isolated clones found by fluorescence in situ hybridization to map to interstitial regions on Indian muntjac chromosomes were further characterized, with a subset then subjected to shotgun sequencing. Subsequently, we isolated and sequenced overlapping clones extending from the ends of some of these initial clones; we also generated orthologous sequence from isolated Chinese muntjac clones. The generated Indian muntjac sequence has been analyzed for the juxtaposition of telomeric and satellite repeats and for synteny relationships relative to other mammalian genomes, including the Chinese muntjac.

Conclusions

The generated sequence data and comparative analyses provide a detailed genomic context for seven ancestral chromosome fusion sites in the Indian muntjac genome, which further supports the telocentric fusion model for the events leading to the unusual karyotypic differences among muntjac species.     

A complete comparative chromosome map for the dog, red fox, and human and its integration with canine genetic maps

Cross-species reciprocal chromosome painting was used to delineate homologous chromosomal segments between domestic dog, red fox, and human. Whole sets of chromosome-specific painting probes for the red fox and dog were made by PCR amplification of flow-sorted chromosomes from established cell cultures. Based on their hybridization patterns, a complete comparative chromosome map of the three species has been built. Thirty-nine of the 44 synteny groups from the published radiation hybrid map and 33 of the 40 linkage groups in the linkage map of the dog have been assigned to specific chromosomes by fluorescence in situ hybridization and PCR-based genotyping. Each canine chromosome has at least one DNA marker assigned to it. The human-canid map shows that the canid karyotypes are among the most extensively rearranged karyotypes in mammals. Twenty-two human autosomal paints delineated 73 homologous regions on 38 canine autosomes, while paints from 38 dog autosomes detected 90 homologous segments in the human genome. Of the 22 human autosomes, only the syntenies of three chromosomes (14, 20, and 21) have been maintained intact in the canid genome. The dog-fox map and DAPI banding comparison demonstrate that the remarkable karyotype differences between fox (2n = 34 + 0-8 Bs) and dog (2n = 78) are due to 26 chromosomal fusion events and 4 fission events. It is proposed that the more easily karyotyped fox chromosomes can be used as a common reference and control system for future gene mapping in the DogMap project and CGH analysis of canine tumor DNA.     

Comparative gene mapping in cattle,Indian muntjac,and Chinese muntjac by fluorescence in situ hybridization

The Indian muntjac (Muntiacus muntjak vaginalis) has a karyotype of 2n = 6 in the female and 2n = 7 in the male. The karyotypic evolution of Indian muntjac via extensive tandem fusions and several centric fusions are well documented by molecular cytogenetic studies mainly utilizing chromosome paints. To achieve higher resolution mapping, a set of 42 different genomic clones coding for 37 genes and the nucleolar organizer region were used to examine homologies between the cattle (2n = 60), human (2n = 46), Indian muntjac (2n = 6/7) and Chinese muntjac (2n = 46) karyotypes. These genomic clones were mapped by fluorescence in situ hybridization (FISH). Localization of genes on all three pairs of M. m. vaginalis chromosomes and on the acrocentric chromosomes of M. reevesi allowed not only the analysis of the evolution of syntenic regions within the muntjac genus but also allowed a broader comparison of synteny with more distantly related species, such as cattle and human, to shed more light onto the evolving genome organization. For convenience and to avoid confusion we added for each species a three letter abbreviation prior to the chromosomal band location discussed in this paper: BTA, Cattle chromosome; HSA, Human chromosome; MMV, M. m. vaginalis chromosome; MRE, M. reevesi chromosome.     

Longitudinal differentiation of metaphase chromosomes of Indian muntjac as studied by restriction enzyme digestion,in situ hybridization with cloned DNA probes and distamycin A plus DAPI fluorescence staining

The longitudinal differentiation of metaphase chromosomes of the Indian muntjac was studied by digestion with restriction enzymes, in situ hybridization with cloned DNA probes and distamycin A plus DAPI (4-6-diamidino-2-phenylindole) fluorescence staining. The centromeric regions of chromosomes 3 and 3 + X of a male Indian muntjac cell line were distinct from each other and different from those of other chromosomes. Digestion with a combination of EcoRI^* and Sau3A revealed a pattern corresponding to that of C-banding. Digestion with AluI, EcoRII or RsaI yielded a band specific to the centromeric region only in chromosomes 3 and 3 + X. Furthermore, HinfI digestion yielded only a band at the centromeric region of chromosome 3, whereas DA-DAPI staining revealed a single band limited to the extreme end of the C-band heterochromatin of the short arm of 3 + X. These results suggest that centromeres of Indian muntjac chromosomes contain at least four different types of repetitive DNA. Such diversity in heterochromatin was also confirmed by in situ hybridization using specific DNA probes isolated and cloned from highly repetitive DNA families. Heterozygosity between chromosome homologs was revealed by restriction enzyme banding. Evidence is presented for the presence of nucleolus organizer regions (NORs) on the long arm of chromosome 1 as well as on the secondary constrictions of 3 and 3 + X.Abbreviations DA distamycin A - DAPI 4-6-diamidino-2-phenylindole - NOR(s) nucleolus organizer region(s) - PBS phosphate-buffered saline - PI propidium iodide     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

Karyotype of maize (Zea mays L.) mitotic metaphase chromosomes as revealed by fluorescencein situ hybridization (FISH) with cytogenetic DNA markers

Here we demonstrate fluorescencein situ hybridization (FISH) of chromosome-specific cytogenetic DNA markers for chromosome identification in maize using repetitive and single copy probes. The fluorescently labeled probes, CentC and pZm4–21, were shown to be reliable cytogenetic markers in the maize inbred line KYS for identification of mitotic metaphase chromosomes. The fluorescent strength of CentC signal, relative position, knob presence, size and location were used for the karyotyping. Based on direct visual analysis of chromosome length and position of FISH signals, a metaphase karyotype was constructed for maize inbred line KYS. All chromosomes could be identified unambiguously. The knob positions in the karyotype agreed well with those derived from traditional cytological analyses except chromosomes 3, 4 and 8. One chromosome with a telomeric knob on the short arm was assigned to 3. A chromosome with a knob in the middle of the long arm was assigned number 4 by simultaneous hybridization with a knob-specific probe pZm4–21 and a chromosome 4-specific probe Cent 4. On chromosome 8, we found an additional small telomeric knob on the short arm. In addition, chromosome-specific probes were employed to identify chromosome 6 (45S rDNA) and chromosome 9 (single-copy probeumc105a cosmid).     

Localization of the repetitive telomeric sequence (TTAGGG)n in two muntjac species and implications for their karyotypic evolution

It has been suggested that the chromosome set of the Indian muntjac, Muntiacus muntjak vaginalis (female, 2n = 6; male, 2n = 7), evolved from small acrocentric chromosomes, such as those found in the complement of the Chinese muntjac, M. reevesi (2n = 46), by a series of tandem fusions and other rearrangements. The location of the highly conserved human telomeric sequence (TTAGGG)n in the metaphase chromosomes of M.m. vaginalis and its close relative, M. reevesi, was investigated by non-radioactive in situ hybridization. The (TTAGGG)n repeat was found adjacent to the centromeres in the short arm and at the telomeres in the long arm of M. reevesi acrocentric metaphase chromosomes. Tandem fusions present in the karyotype of M.m. vaginalis chromosomes were not reflected by interstitial signals of the telomere repeat, as these chromosomes displayed hybridization signals only at the ends of the chromatids. Mechanisms that might have played a role in the evolution of the reduced karyotype of the Indian muntjac are discussed.     

Chromosomal evolution of the Chinese muntjac (Muntiacus reevesi)

The aim of this study was to test the validity of the hypothesis that the 2n=46 karyotype of the Chinese muntjac (Muntiacus reevesi) could have evolved through 12 tandem fusions from a 2n=70 hypothetical ancestral karyotype, which is still retained in Chinese water deer (Hydropotes inermis) and brown-brocket deer (Mazama gouazoubira). Combining fluorescence-activated chromosomal sorting and degenerate oligonucleotide-primed polymerase chain reaction, we generated chromosome-specific DNA paint probes for 13 M. gouazoubira chromosomes and most of the M. reevesi chromosomes with the exception of 18, 19 and X. These paint probes were used for fluorescence in situ hybridisation to chromosomal preparations of M. reevesi, H. inermis and M. gouazoubira. Chromosome-specific paint probes from M. reevesi chromosomes 1–5 and 11 each delineated more than one homologous pair (18 pairs in total) on the metaphases of H. inermis and M. gouazoubira. All the other probes from M. reevesi and probes from M. gouazoubira each hybridised to one pair of homologous chromosomes or regions. The C5 probe, derived from centromeric satellite sequences of M. reevesi, hybridised to the centromeric regions of all chromosomes of these three species. Most interestingly, several non-random interstitial signals, which are apparently localised to the putative fusion points, were found on chromosomes 1–5 and 11 of M. reevesi. Both the reciprocal painting patterns and localisation of the C5 probe demonstrate that M. reevesi chromosomes 1–5 and 11 could have evolved from 18 different ancestral chromosomes through 12 tandem fusions, thus providing direct molecular cytogenetic support for the tandem fusion hypothesis of karyotype evolution in M. reevesi. Received: 10 October 1996; in revised form: 18 December 1996 / Accepted: 27 December 1996     

An efficient Oligo-FISH painting system for revealing chromosome rearrangements and polyploidization in Triticeae

A chromosome-specific painting technique has been developed which combines the most recent approaches of the companion disciplines of molecular cytogenetics and genome research. We developed seven oligonucleotide (oligo) pools derivd from single-copy sequences on chromosomes 1 to 7 of barley (Hordeum vulgare L.) and corresponding collinear regions of wheat (Triticum aestivum L.). The seven groups of pooled oligos comprised between 10 986 and 12 496 45-bp monomers, and these then produced stable fluorescence in situ hybridization (FISH) signals on chromosomes of each linkage group of wheat and barley. The pooled oligo probes were applied to high-throughput karyotyping of the chromosomes of other Triticeae species in the genera Secale, Aegilops, Thinopyrum, and Dasypyrum, and the study also extended to some wheat-alien amphiploids and derived lines. We demonstrated that a complete set of whole-chromosome oligo painting probes facilitated the study of inter-species chromosome homologous relationships and visualized non-homologous chromosomal rearrangements in Triticeae species and some wheat-alien species derivatives. When combined with other non-denaturing FISH procedures using tandem-repeat oligos, the newly developed oligo painting techniques provide an efficient tool for the study of chromosome structure, organization, and evolution among any wild Triticeae species with non-sequenced genomes.     

Complete homology maps of the rabbit (Oryctolagus cuniculus) and human by reciprocal chromosome painting

Fluorescence in situ hybridization (FISH) was used to construct a homology map to analyse the extent of evolutionary conservation of chromosome segments between human and rabbit (Oryctolagus cuniculus, 2n = 44). Chromosome-specific probes were established by bivariate fluorescence activated flow sorting followed by degenerate oligonucleotide-primed PCR (DOP-PCR). Painting of rabbit probes to human chromosomes and vice versa allowed a detailed analysis of the homology between these species. All rabbit chromosome paints, except for the Y paint, hybridized to human chromosomes. All human chromosome paints, except for the Y paint, hybridized to rabbit chromosomes. The results obtained revealed extensive genome conservation between the two species. Rabbit chromosomes 12, 19 and X were found to be completely homologous to human chromosomes 6, 17 and X, respectively. All other human chromosomes were homologous to two or sometimes three rabbit chromosomes. Many conserved chromosome segments found previously in other mammals (e.g. cat, pig, cattle, Indian muntjac) were also found to be conserved in rabbit chromosomes.     

A mitotically stable marker chromosome negative for whole chromosome libraries, centromere probes and chromosome specific telomere regions: a novel class of supernumerary marker chromosome?

A two year-old child presented with mild developmental delay. On karyotype analysis, a supernumerary small marker chromosome (SMC) was found in all cells examined. This SMC was approximately the size of an isochromosome 18p, being symmetrical with a central constriction. C-banding and silver staining were negative and FISH with all chromosome-specific paints, centromere probes and telomere probes showed no hybridization to the SMC; telomere repeat sequences were however present on both arms. Comparative genomic hybridization showed no amplification of any chromosome region. Flow sorting of the SMC and reverse painting onto normal metaphase spreads showed no hybridization to any chromosome, whereas reverse painting onto the patient's own metaphases showed hybridization to the SMC only. This SMC may thus represent either a complex amplicon of different genomic regions, or a multifold amplification of a very small region, with a neocentromere comprising an active kinetochore but no alphoid DNA. Prognostic implications for the proband were difficult to assess due to the absence of reports of similar marker chromosomes in the literature.     

Single‐copy gene‐based chromosome painting in cucumber and its application for chromosome rearrangement analysis in Cucumis

Chromosome painting based on fluorescence in situ hybridization (FISH) has played an important role in chromosome identification and research into chromosome rearrangements, diagnosis of chromosome abnormalities and evolution in human and animal species. However, it has not been applied widely in plants due to the large amounts of dispersed repetitive sequences in chromosomes. In the present work, a chromosome painting method for single‐copy gene pools in Cucumis sativus was successfully developed. Gene probes with sizes above 2 kb were detected consistently. A cucumber karyotype was constructed based on FISH using a cocktail containing chromosome‐specific gene probes. This single‐copy gene‐based chromosome painting (ScgCP) technique was performed by PCR amplification, purification, pooling, labeling and hybridization onto chromosome spreads. Gene pools containing sequential genes with an interval less than 300 kb yielded painting patterns on pachytene chromosomes. Seven gene pools corresponding to individual chromosomes unambiguously painted each chromosome pair of C. sativus. Three mis‐aligned regions on chromosome 4 were identified by the painting patterns. A probe pool comprising 133 genes covering the 8 Mb distal end of chromosome 4 was used to evaluate the potential utility of the ScgCP technique for chromosome rearrangement research through cross‐species FISH in the Cucumis genus. Distinct painting patterns of this region were observed in C. sativus, C. melo and C. metuliferus species. A comparative chromosome map of this region was constructed between cucumber and melon. With increasing sequence resources, this ScgCP technique may be applied on any other sequenced species for chromosome painting research.     

Chromosome painting in Arabidopsis thaliana

Chromosome painting, that is visualisation of chromosome segments or whole chromosomes based on fluorescence in situ hybridization (FISH) with chromosome-specific DNA probes is widely used for chromosome studies in mammals, birds, reptiles and insects. Attempts to establish chromosome painting in euploid plants have failed so far. Here, we report on chromosome painting in Arabidopsis thaliana (n = 5, 125 Mb C(-1)). Pools of contiguous 113-139 BAC clones spanning 2.6 and 13.3 Mb of the short and the long arm of chromosome 4 (17.5 Mb) were used to paint this entire chromosome during mitotic and meiotic divisions as well as in interphase nuclei. The possibility of identifying any particular chromosome region on pachytene chromosomes and within interphase nuclei using selected BACs is demonstrated by differential labelling. This approach allows us, for the first time, to paint an entire autosome of an euploid plant to study chromosome rearrangements, homologue association, interphase chromosome territories, as well as to identify homeologous chromosomes of related species.