A new homeobox-leucine zipper gene from Arabidopsis thaliana

We have isolated a homeobox-containing gene from Arabidopsis thaliana using a degenerate oligonucleotide probe corresponding to the most conserved region of the homeodomain. This strategy has been used previously to isolate homeobox-containing genes from Caenorhabditis, and recently from A. thaliana. The Arabidopsis genes have an unusual structure in that they have a leucine zipper motif adjacent to the carboxy terminal region of the homeo domain, a feature not found in homeobox-containing genes isolated from animals. We report the isolation and primary structure of a new member of this Arabidopsis homeobox-leucine zipper gene family. This new member has the homeodomain and leucine-zipper motif similar to the two genes previously identified, but differs from these genes in the part corresponding to the carboxy terminus of the polypeptide, as well as in size and isoelectric point of the protein.     

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Function of the wheat TaSIP gene in enhancing drought and salt tolerance in transgenic Arabidopsis and rice

Microarray analysis of a salt-tolerant wheat mutant identified a gene of unknown function that was induced by exposure to high levels of salt and subsequently denoted TaSIP (Triticum aestivum salt-induced protein). Quantitative PCR analysis revealed that TaSIP expression was induced not only by salt, but also by drought, abscisic acid (ABA), and other environmental stress factors. Transgenic rice plants that expressed an RNA interference construct specific for a rice gene homologous to TaSIP was more susceptible to salt stress than wild-type rice plants. Subcellular localization studies showed that the TaSIP localized to the cell membrane. Under conditions of salt and drought stress, transgenic Arabidopsis plants that overexpressed TaSIP showed superior physiological properties compared with control plants, including lower Na⁺ content and upregulation of several stress resistance genes. Staining of transgenic tissues with β-glucuronidase (GUS) failed to indicate tissue-specific activity of the full-length TaSIP promoter. Quantitative analysis of GUS fluorescence in transgenic plants treated with ABA or salt stress revealed that the region 1,176–1,410 bp from the start codon contained an ABA-responsive element and that the region 579–1,176 bp from the start codon upstream of the exon contained a salt-stress-responsive element. Based on these results, we conclude that the key part of the TaSIP gene is the region of its promoter involved in salt tolerance.     

Cloning and Characterization of an Arabidopsis thaliana Topoisomerase I Gene

cDNA and genomic clones encoding DNA topoisomerase I were isolated from Arabidopsis thaliana λgt11 and λFix libraries by low stringency hybridization with a Saccharomyces cerevisiae TOP1 probe. The cDNA clones include a 2748-base pair open reading frame predicting an amino acid sequence that is highly homologous to sequences encoded by TOP1 from yeast and human sources. The sequence of the upstream genomic region reveals two putative TATA-like elements and a purine-rich region, but no other obvious controlling elements. Southern blot analysis shows that the gene is present as a single copy in the Arabidopsis genome. When expressed in a S. cerevisiae top1 mutant under the control of the GAL1 promoter, the gene complements the phenotype caused by loss of topoisomerase activity and directs the expression of a protein that cross-reacts with a human anti-topoisomerase I antibody.     

Gene targeting in Arabidopsis thaliana.

Summary Gene targeting of a chromosomally integrated transgene in Arabidopsis thaliana is reported. A chimeric gene consisting of the promoter of the 35S RNA of CaMV, the polyadenylation signal of the octopine synthase gene and the coding region of the bacterial hygromycin phosphotransferase gene (hpt), which was rendered non-functional by deletion of 19 bp, was introduced into the genome of A. thaliana using Agrobacterium-mediated gene transfer. A total of 3.46 x 10⁸ protoplasts isolated from 17 independent transgenic Arabidopsis lines harbouring the defective chimeric hpt gene were transformed via direct gene transfer using various DNA forms containing only the intact coding region of the hpt gene. Out of 150 hygromycin-resistant colonies appearing in the course of these experiments, four were the result of targeted recombination of the incoming DNA with the defective chromosomal locus as revealed by PCR and Southern blot analysis. Comparison with the number of transformants obtained when an hpt gene controlled by a promoter and terminator from the nopaline synthase gene was employed results in a maximal ratio of homologous to non-homologous transformation in A. thaliana of 1 x 10^–4.     

The gene family encoding the Arabidopsis thaliana translation elongation factor EF-1 alpha: molecular cloning, characterization and expression

Summary The gene family encoding the Arabidopsis thaliana translation elongation factor (EF-1) was analysed. This family contains four genes (A1-A4) organized in a similar manner in different varieties of Arabidopsis. Based upon both their physical separation and a comparison of their sequences, it is suggested that the A4 gene and the A1, A2, and A3 genes constitute two distinct subfamilies within the genome. By introducing chimaeric gene constructs into Arabidopsis cells, we showed that the Al gene promoter mediates a transient expression about twofold higher than that obtained using the CaMV 35 S promoter. This expression depends on a 348 by DNA fragment extending from –982 to –634 by upstream of the initiation codon. This element contains a characteristic telomeric sequence (AACCCTAA) which is also found in the promoters of the A2 and A4 genes as well as in the promoters of the Drosophila EF-1 F1 gene and of several highly expressed plant genes.     

Molecular analysis of the aspartate kinase-homoserine dehydrogenase gene from Arabidopsis thaliana

The gene encoding Arabidopsis thaliana aspartate kinase (ATP:L-aspartate 4-phosphotransferase, EC 2.7.2.4) was isolated from genomic DNA libraries using the carrot ak-hsdh gene as the hybridizing probe. Two genomic libraries from different A. thaliana races were screened independently with the ak probe and the hsdh probe. Nucleotide sequences of the A. thaliana overlapping clones were determined and encompassed 2 kb upstream of the coding region and 300 bp downstream. The corresponding cDNA was isolated from a cDNA library made from poly(A)⁺-mRNA extracted from cell suspension cultures. Sequence comparison between the Arabidopsis gene product and an AK-HSDH bifunctional enzyme from carrot and from the Escherichia coli thrA and metL genes shows 80%, 37.5% and 31.4% amino acid sequence identity, respectively. The A. thaliana ak-hsdh gene is proposed to be the plant thrA homologue coding for the AK isozyme feedback inhibited by threonine. The gene is present in A. thaliana in single copy and functional as evidenced by hybridization analyses.The apoprotein-coding region is interrupted by 15 introns ranging from 78 to 134 bp. An upstream chloroplast-targeting sequence with low sequence similarity with the carrot transit peptide was identified. A signal sequence is proposed starting from a functional ATG initiation codon to the first exon of the apoprotein. Two additional introns were identified: one in the 5 non-coding leader sequence and the other in the putative chloroplast targeting sequence. 5 sequence analysis revealed the presence of several possible promoter elements as well as conserved regulatory motifs. Among these, an Opaque2 and a yeast GCN4-like recognition element might be relevant for such a gene coding for an enzyme limiting the carbon-flux entry to the biosynthesis of several essential amino acids. 3 sequence analysis showed the occurrence of two polyadenylation signals upstream of the polyadenylation site.This work is the first report of the molecular cloning of a plant ak-hsdh genomic sequence. It describes a promoter element that may bring new insights to the regulation of the biosynthesis of the aspartate family of amino acids.Abbreviations AK aspartate kinase - HSDH homoserine dehydrogenase - ID intermediate domain - Tp transit peptide