Site-resolved energetics in DNA triple helices containing G*TA and T*CG triads

Recognition of specific sites in double-helical DNA by triplex-forming oligonucleotides has been limited until recently to sites containing homopurine-homopyrimidine sequences. G*TA and T*CG triads, in which TA and CG base pairs are specifically recognized by guanine or by thymine, have now extended this recognition code to DNA target sites of mixed base sequences. In the present work, we have obtained a characterization of the stabilities of G*TA and T*CG triads, and of the effects of these triads upon canonical triads, in triple-helical DNA. The three DNA triplexes investigated are formed by the folding of the 31-mers d(GAAXAGGT(5)CCTYTTCT(5)CTTZTCC) with X = G, T, or C, Y = C, A, or G, and Z = C, G, or T. We have measured the exchange rates of imino protons in each triad of the three triplexes using nuclear magnetic resonance spectroscopy. The exchange rates are used to map the local free energy of structural stabilization in each triplex. The results indicate that the stability of Watson-Crick base pairs in the G*TA and T*CG triads is comparable to that of Watson-Crick base pairs in canonical triads. The presence of G*TA and T*CG triads, however, destabilizes neighboring canonical triads, two or three positions removed from the G*TA/T*CG site. Moreover, the long-range destabilizing effects induced by the T*CG triad are larger than those induced by the G*TA triad. These findings reveal the molecular basis for the lower overall stability of G*TA- and T*CG-containing triplexes.     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

Triple helical DNA in a duplex context and base pair opening

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region.     

Proton exchange and base pair opening in a DNA triple helix

Nuclear magnetic resonance spectroscopy has been used to characterize opening reactions and stabilities of individual base pairs in two related DNA structures. The first is the triplex structure formed by the DNA 31-mer 5'-AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT-3'. The structure belongs to the YRY (or parallel) family of triple helices. The second structure is the hairpin double helix formed by the DNA 20-mer 5'-AGAGAGAACCCCTTCTCTCT-3' and corresponds to the duplex part of the YRY triplex. The rates of exchange of imino protons with solvent in the two structures have been measured by magnetization transfer from water and by real-time exchange at 10 degrees C in 100 mM NaCl and 5 mM MgCl2 at pH 5.5 and in the presence of two exchange catalysts. The results indicate that the exchange of imino protons in protonated cytosines is most likely limited by the opening of Hoogsteen C+G base pairs. The base pair opening parameters estimated from imino proton exchange rates suggest that the stability of individual Hoogsteen base pairs in the DNA triplex is comparable to that of Watson-Crick base pairs in double-helical DNA. In the triplex structure, the exchange rates of imino protons in Watson-Crick base pairs are up to 5000-fold lower than those in double-helical DNA. This result suggests that formation of the triplex structure enhances the stability of Watson-Crick base pairs by up to 5 kcal/mol. This stabilization depends on the specific location of each triad in the triplex structure.     

The influence of single base triplet changes on the stability of a pur.pur.pyr triple helix determined by affinity cleaving.

The influence of sixteen base triplet changes at a single position within a pur.pur.pyr triple helix was examined by affinity cleaving. For the 15 base pair target site studied here, G.GC, A.AT and T.AT triplets stabilize a triple helix to a greater extent than the other 13 natural triplets (pH = 7.4, 25 degrees C). Weaker interactions were detected for the C.AT, A.GC and T.CG triplets. The absence of specific, highly stabilizing interactions between third strand bases and the CG or TA base pairs demonstrates a current sequence limitation to formation of this structure. Models for the two dimensional base triplet interactions for all possible 16 natural triplets are presented.     

A directional nucleation-zipping mechanism for triple helix formation

A detailed kinetic study of triple helix formation was performed by surface plasmon resonance. Three systems were investigated involving 15mer pyrimidine oligonucleotides as third strands. Rate constants and activation energies were validated by comparison with thermodynamic values calculated from UV-melting analysis. Replacement of a T·A base pair by a C·G pair at either the 5′ or the 3′ end of the target sequence allowed us to assess mismatch effects and to delineate the mechanism of triple helix formation. Our data show that the association rate constant is governed by the sequence of base triplets on the 5′ side of the triplex (referred to as the 5′ side of the target oligopurine strand) and provides evidence that the reaction pathway for triple helix formation in the pyrimidine motif proceeds from the 5′ end to the 3′ end of the triplex according to the nucleation-zipping model. It seems that this is a general feature for all triple helices formation, probably due to the right-handedness of the DNA double helix that provides a stronger base stacking at the 5′ than at the 3′ duplex–triplex junction. Understanding the mechanism of triple helix formation is not only of fundamental interest, but may also help in designing better triple helix-forming oligonucleotides for gene targeting and control of gene expression.     

NMR structural studies of intramolecular (Y+)n.(R+)n(Y-)nDNA triplexes in solution: imino and amino proton and nitrogen markers of G.TA base triple formation.

We reported previously on NMR studies of (Y+)n.(R+)n(Y-)n DNA triple helices containing one oligopurine strand (R)n and two oligopyrimidine strands (Y)n stabilized by T.AT and C+.GC base triples [de los Santos, C., Rosen, M., & Patel, D. J. (1989) Biochemistry 28, 7282-7289]. Recently, it has been established that guanosine can recognize a thymidine.adenosine base pair to form a G.TA triple in an otherwise (Y+)n.(R+)n(Y-)n triple-helix motif. [Griffin, L. C., & Dervan, P. B. (1989) Science 245, 967-971]. The present study extends the NMR research to the characterization of structural features of a 31-mer deoxyoligonucleotide that folds intramolecularly into a 7-mer (Y+)n.(R+)n(Y-)n triplex with the strands linked through two T5 loops and that contains a central G.TA triple flanked by T.AT triples. The G.TA triplex exhibits an unusually well resolved and narrow imino and amino exchangeable proton and nonexchangeable proton spectrum in H2O solution, pH 4.85, at 5 degrees C. We have assigned the imino protons of thymidine and amino protons of adenosine involved in Watson-Crick and Hoogsteen pairing in T.AT triples, as well as the guanosine imino and cytidine amino protons involved in Watson-Crick pairing and the protonated cytidine imino and amino protons involved in Hoogsteen pairing in C+.GC triples in the NOESY spectrum of the G.TA triplex. The NMR data are consistent with the proposed pairing alignment for the G.TA triple where the guanosine in an anti orientation pairs through a single hydrogen bond from one of its 2-amino protons to the 4-carbonyl group of thymidine in the Watson-Crick TA pair.(ABSTRACT TRUNCATED AT 250 WORDS)     

Integrity of duplex structures without hydrogen bonding: DNA with pyrene paired at abasic sites

DNA polymerases specifically insert the hydrophobic pyrene deoxynucleotide (P) opposite tetrahydrofuran (F), an stable abasic site analog, and DNA duplexes containing this non-hydrogen-bonded pair possess a high degree of thermodynamic stability. These observations support the hypothesis that steric complementarity and stacking interactions may be sufficient for maintaining stability of DNA structure and specificity of DNA replication, even in the absence of hydrogen bonds across the base pair. Here we report the NMR characterization and structure determination of two DNA molecules containing pyrene residues. The first is a 13mer duplex with a pyrene·tetrahydrofuran pair (P·F pair) at the ninth position and the second mimics a replication intermediate right after incorporation of a pyrene nucleoside opposite an abasic site. Our data indicate that both molecules adopt right-handed helical conformations with Watson– Crick alignments for all canonical base pairs. The pyrene ring stays inside the helix close to its baseless partner in both molecules. The single-stranded region of the replication intermediate folds back over the opposing strand, sheltering the hydrophobic pyrene moiety from water exposure. The results support the idea that the stability and replication of a P·F pair is due to its ability to mimic Watson–Crick structure.     

Solution structure of the DNA decamer duplex containing a 3'-T x T basepair of the cis-syn cyclobutane pyrimidine dimer: implication for the mutagenic property of the cis-syn dimer

The cis–syn dimer is the major DNA photoproduct produced by UV irradiation. In order to determine the origin of the mutagenic property of the cis–syn dimer, we used NMR restraints and molecular dynamics to determine the solution structure of a DNA decamer duplex containing a wobble pair between the 3′-T of the cis–syn dimer and the opposite T residue (CS/TA duplex). The solution structure of the CS/TA duplex revealed that the 3′-T·T base pair of the cis–syn dimer had base pair geometry that was significantly different from the canonical Watson–Crick base pair and caused destabilization and conformational distortion of its 3′-region. However, a 3′-T·A base pair at the cis–syn dimer within this related DNA decamer maintains the normal Watson–Crick base pair geometry and causes little distortion in the conformation of its 3′-side. Our results show that in spite of its stable hydrogen bonding, the insertion of a T residue opposite the 3′-T of the cis–syn dimer is inhibited by structural distortion caused by the 3′-T·T base pair. This may explain why the frequency of the 3′-T→A transversion, which is the major mutation produced by the cis–syn dimer, is only 4%.     

The Effect of a G:T Mispair on the Dynamics of DNA

Distortions in the DNA sequence such as damages or mispairs are specifically recognized and processed by DNA repair enzymes. A particular challenge for the enzymatic specificity is the recognition of a wrongly-placed native nucleotide such as thymine in T:G mispairs. An important step of substrate binding which is observed in many repair proteins is the flipping of the target base out of the DNA helix into the enzyme’s active site. In this work we investigate how much the intrinsic dynamics of mispaired DNA is changed compared to canonical DNA. Our molecular dynamics simulations of DNA with and without T:G mispairs show significant differences in the conformation of paired and mispaired DNA. The wobble pair T:G shows local distortions such as twist, shear and stretch which deviate from canonical B form values. Moreover, the T:G mispair is found to be kinetically less stable, exhibiting two states with respect to base opening: a closed state comparable to the canonical base pairs, and a more open state, indicating a proneness for base flip. In addition, we observe that the thymine base in a T:G mispair is significantly more probable to be flipped than thymine in a T:A pair or cytosine in a C:G pair. Such local deformations and in particular the existence of a second, more-open state can be speculated to help the target-site recognition by repair enzymes.     

Parallel-stranded DNA with mixed AT/GC composition: role of trans G.C base pairs in sequence dependent helical stability

Parallel-stranded (ps) DNAs with mixed AT/GC content comprising G.C pairs in a varying sequence context have been investigated. Oligonucleotides were devised consisting of two 10-nt strands complementary either in a parallel or in an antiparallel orientation and joined via nonnucleotide linkers so as to form 10-bp ps or aps hairpins. A predominance of intramolecular hairpins over intermolecular duplexes was achieved by choice of experimental conditions and verified by fluorescence determinations yielding estimations of rotational relaxation times and fractional base pairing. A multistate mode of ps hairpin melting was revealed by temperature gradient gel electrophoresis (TGGE). The thermal stability of the ps hairpins with mixed AT/GC content depends strongly on the specific sequence in a manner peculiar to the ps double helix. The thermodynamic effects of incorporating trans G.C base pairs into an AT sequence are context-dependent: an isolated G. C base pair destabilizes the duplex whereas a block of > or =2 consecutive G.C base pairs exerts a stabilizing effect. A multistate heterogeneous zipper model for the thermal denaturation of the hairpins was derived and used in a global minimization procedure to compute the thermodynamic parameters of the ps hairpins from experimental melting data. In 0.1 M LiCl at 3 degrees C, the formation of a trans G.C pair in a GG/CC sequence context is approximately 3 kJ mol(-)(1) more favorable than the formation of a trans A.T pair in an AT/TA sequence context. However, GC/AT contacts contribute a substantial unfavorable free energy difference of approximately 2 kJ mol(-)(1). As a consequence, the base composition and fractional distribution of isolated and clustered G.C base pairs determine the overall stability of ps-DNA with mixed AT/GC sequences. Thus, the stability of ps-DNA comprising successive > or =2 G.C base pairs is greater than that of ps-DNA with an alternating AT sequence, whereas increasing the number of AT/GC contacts by isolating G.C base pairs exerts a destabilizing effect on the ps duplex. Molecular modeling of the various helices by force field techniques provides insight into the structural basis for these distinctions.     

Base pair opening in three DNA-unwinding elements

DNA-unwinding elements are specific base sequences that are located in the origin of DNA replication where they provide the start point for strand separation and unwinding of the DNA double helix. In the present work we have obtained the first characterization of the opening of individual base pairs in DNA-unwinding elements. The three DNA molecules investigated reproduce the 13-mer DNA-unwinding elements present in the Escherichia coli chromosome. The base sequences of the three 13-mers are conserved in the origins of replication of enteric bacterial chromosomes. The exchange of imino protons with solvent protons was measured for each DNA as a function of the concentration of exchange catalyst using nuclear magnetic resonance spectroscopy. The exchange rates provided the rates and the equilibrium constants for opening of individual base pairs in each DNA at 20 degrees C. The results reveal that the kinetics and energetics of the opening reactions for AT/TA base pairs are different in the three DNA-unwinding elements due to long range effects of the base sequence. These differences encompass the AT/TA base pairs that are conserved in various bacterial genomes. Furthermore, a qualitative correlation is observed between the kinetics and energetics of opening of AT/TA base pairs and the location of the corresponding DNA-unwinding element in the origin of DNA replication.     

Synthesis and triplex binding properties of oligonucleotides containing a novel nucleobase

The thiazolo-indole compound 1 bearing the complementary donor-acceptor-donor sites (dad) was designed for specific recognition of an AT inverted base pair in pyrimidine triple helix motif. It was successfully incorporated into 14-mer oligonucleotide using a serinol unit as sugar derivative. The triple helix hybridization studies were examined by means of thermal denaturation experiments with a 26-mer DNA duplex containing the AT inverted base pair.     

Synthesis and Triplex Binding Properties of Oligonucleotides Containing a Novel Nucleobase

Abstract

The thiazolo-indole compound 1 bearing the complementary donor-acceptor-donor sites (dad) was designed for specific recognition of an AT inverted base pair in pyrimidine triple helix motif. It was successfully incorporated into 14-mer oligonucleotide using a serinol unit as sugar derivative. The triple helix hybridization studies were examined by means of thermal denaturation experiments with a 26-mer DNA duplex containing the AT inverted base pair.     

Genetic and structural analysis of base substitutions in the central pseudoknot of Thermus thermophilus 16S ribosomal RNA

Characterization of base substitutions in rRNAs has provided important insights into the mechanism of protein synthesis. Knowledge of the structural effects of such alterations is limited, and could be greatly expanded with the development of a genetic system based on an organism amenable to both genetics and structural biology. Here, we describe the genetic analysis of base substitutions in 16S ribosomal RNA of the extreme thermophile Thermus thermophilus, and an analysis of the conformational effects of these substitutions by structure probing with base-specific modifying agents. Gene replacement methods were used to construct a derivative of strain HB8 carrying a single 16S rRNA gene, allowing the isolation of spontaneous streptomycin-resistant mutants and subsequent genetic mapping of mutations by recombination. The residues altered to give streptomycin resistance reside within the central pseudoknot structure of 16S rRNA comprised of helices 1 and 27, and participate in the U13–U20–A915 base triple, the G21–A914 type II sheared G–A base pair, or the G885–C912 Watson–Crick base pair closing helix 27. Substitutions at any of the three residues engaged in the base triple were found to confer resistance. Results from structure probing of the pseudoknot are consistent with perturbation of RNA conformation by these substitutions, potentially explaining their streptomycin-resistance phenotypes.     

Intramolecular triple helix as a model for regular polyribonucleotide (CAA)n

The regular (CAA)_n polyribonucleotide, as well as the omega leader sequence containing (CAA)-rich core, have recently been shown to form cooperatively melted and compact structures. In this report, we propose a structural model for the (CAA)_n sequence in which the polyribonucleotide chain is folded upon itself, so that it forms an intramolecular triple helix. The triple helix is stabilized by hydrogen bonding between bases thus forming coplanar triads, and by stacking interactions between the base triads. A distinctive feature of the proposed triple helix is that it does not contain the canonical double-helix elements. The difference from the known triple helices is that Watson-Crick hydrogen bond pairings do not take place in the interactions between the bases within the base triads.     

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔT_M experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings.     

High base pair opening rates in tracts of GC base pairs

Sequence-dependent structural features of the DNA double helix have a strong influence on the base pair opening dynamics. Here we report a detailed study of the kinetics of base pair breathing in tracts of GC base pairs in DNA duplexes derived from 1H NMR measurements of the imino proton exchange rates upon titration with the exchange catalyst ammonia. In the limit of infinite exchange catalyst concentration, the exchange times of the guanine imino protons of the GC tracts extrapolate to much shorter base pair lifetimes than commonly observed for isolated GC base pairs. The base pair lifetimes in the GC tracts are below 5 ms for almost all of the base pairs. The unusually rapid base pair opening dynamics of GC tracts are in striking contrast to the behavior of AT tracts, where very long base pair lifetimes are observed. The implication of these findings for the structural principles governing spontaneous helix opening as well as the DNA-binding specificity of the cytosine-5-methyltransferases, where flipping of the cytosine base has been observed, are discussed.     

Four base recognition by triplex-forming oligonucleotides at physiological pH

We have achieved recognition of all 4 bp by triple helix formation at physiological pH, using triplex-forming oligonucleotides that contain four different synthetic nucleotides. BAU [2′-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine] recognizes AT base pairs with high affinity, ^MeP (3-methyl-2 aminopyridine) binds to GC at higher pHs than cytosine, while ^APP (6-(3-aminopropyl)-7-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one) and S [N-(4-(3-acetamidophenyl)thiazol-2-yl-acetamide)] bind to CG and TA base pairs, respectively. Fluorescence melting and DNase I footprinting demonstrate successful triplex formation at a 19mer oligopurine sequence that contains two CG and two TA interruptions. The complexes are pH dependent, but are still stable at pH 7.0. BAU, ^MeP and ^APP retain considerable selectivity, and single base pair changes opposite these residues cause a large reduction in affinity. In contrast, S is less selective and tolerates CG pairs as well as TA.