NAP-2: histone chaperone function and phosphorylation state through the cell cycle

We have recently cloned the human nucleosome assembly protein 2 (NAP-2). Here, we demonstrate that casein kinase 2 (CKII) from HeLa cell nuclear extracts interacts with immobilized NAP-II, and phosphorylates both NAP-2 and nucleosome assembly protein 1 (NAP-1) in vitro. Furthermore, NAP-1 and NAP-2 phosphorylation in crude HeLa cell extracts is abolished by heparin, a specific inhibitor of CKII. Addition of core histones can stimulate phosphorylation of NAP-1 and NAP-2 by CKII. NAP-2 is also a phosphoprotein in vivo. The protein is phosphorylated at the G0/G1 boundary but it is not phosphorylated in S-phase. Here, we show that NAP-2 is a histone chaperone throughout the cell cycle and that its cell-cycle distribution might be governed by its phosphorylation status. Phosphorylated NAP-2 remains in the cytoplasm in a complex with histones during the G0/G1 transition, whereas its dephosphorylation triggers its transport into the nucleus, at the G1/S-boundary, with the histone cargo, suggesting that binding to histones does not depend on phosphorylation status. Finally, indirect immunofluorescence shows that NAP-2 is present during metaphase of HeLa and COS cells, and its localization is distinct from metaphase chromosomes.     

Cell cycle-dependent dynamic association of cyclin/Cdk complexes with human DNA replication proteins

We have previously described the isolation of a replication competent (RC) complex from calf thymus, containing DNA polymerase alpha, DNA polymerase delta and replication factor C. Here, we describe the isolation of the RC complex from nuclear extracts of synchronized HeLa cells, which contains DNA replication proteins associated with cell-cycle regulation factors like cyclin A, cyclin B1, Cdk2 and Cdk1. In addition, it contains a kinase activity and DNA polymerase activities able to switch from a distributive to a processive mode of DNA synthesis, which is dependent on proliferating cell nuclear antigen. In vivo cross-linking of proteins to DNA in synchronized HeLa cells demonstrates the association of this complex to chromatin. We show a dynamic association of cyclins/Cdks with the RC complex during the cell cycle. Indeed, cyclin A and Cdk2 associated with the complex in S phase, and cyclin B1 and Cdk1 were present exclusively in G(2)/M phase, suggesting that the activity, as well the localization, of the RC complex might be regulated by specific cyclin/Cdk complexes.     

Polyglutamylation of nucleosome assembly proteins

Polyglutamylation is an original posttranslational modification, discovered on tubulin, consisting in side chains composed of several glutamyl units and leading to a very unusual protein structure. A monoclonal antibody directed against glutamylated tubulin (GT335) was found to react with other proteins present in HeLa cells. After immunopurification on a GT335 affinity column, two prominent proteins of approximately 50 kDa were observed. They were identified by microsequencing and mass spectrometry as NAP-1 and NAP-2, two members of the nucleosome assembly protein family that are implicated in the deposition of core histone complexes onto chromatin. Strikingly, NAP-1 and NAP-2 were found to be substrates of an ATP-dependent glutamylation enzyme co-purifying on the same column. We took advantage of this property to specifically label and purify the polyglutamylated peptides. NAP-1 and NAP-2 are modified in their C-terminal domain by the addition of up to 9 and 10 glutamyl units, respectively. Two putative glutamylation sites were localized for NAP-1 at Glu-356 and Glu-357 and, for NAP-2, at Glu-347 and Glu-348. These results demonstrate for the first time that proteins other than tubulin are polyglutamylated and open new perspectives for studying NAP function.     

Calmodulin and calmodulin-binding proteins in liver cell nuclei

Three nuclear subfractions were prepared from isolated hepatocytes nuclei. The calmodulin content in whole nuclei was 79 ng/mg of protein. The soluble fraction obtained after digestion of the nuclei with DNase I and RNase A (S1 fraction) contained 252 ng of calmodulin/mg of protein. The pellet obtained after the digestion with nucleases was treated with 1.6 M NaCl, and the soluble fraction and the residual structures obtained after the treatment were called S2 fraction and nuclear matrix, respectively. The calmodulin contents of the S2 fraction and of the nuclear matrix were 68 and 190 ng/mg of protein, respectively. If nuclei were digested only with DNase I, the calmodulin content in the soluble fraction increased to 703 ng/mg of protein, indicating that part of the nuclear calmodulin is associated with active DNA. Five nuclear calmodulin-binding proteins were identified. Two, having apparent molecular masses of 240 and 150 kDa were only found in the nuclear matrix, whereas the other three, having molecular masses of 120, 65, and 40 kDa were found in different proportions in all nuclear subfractions. A calmodulin-dependent inhibition of protein phosphorylation in the S1 fraction was discovered. Purification attempts on the calmodulin-binding proteins of the S1 subfraction by calmodulin affinity chromatography yielded four major polypeptides with apparent molecular masses of about 41, 46, and 120 (two products) kDa. These polypeptides retained the ability to inhibit protein phosphorylation but not the sensitivity to calmodulin.     

A novel SR-related protein is required for the second step of Pre-mRNA splicing

The SR family proteins and SR-related polypeptides are important regulators of pre-mRNA splicing. A novel SR-related protein of an apparent molecular mass of 53 kDa was isolated in a gene trap screen that identifies proteins which localize to the nuclear speckles. This novel protein possesses an arginine- and serine-rich domain and was termed SRrp53 (for SR-related protein of 53 kDa). In support for a role of this novel RS-containing protein in pre-mRNA splicing, we identified the mouse ortholog of the Saccharomyces cerevisiae U1 snRNP-specific protein Luc7p and the U2AF65-related factor HCC1 as interacting proteins. In addition, SRrp53 is able to interact with some members of the SR family of proteins and with U2AF35 in a yeast two-hybrid system and in cell extracts. We show that in HeLa nuclear extracts immunodepleted of SRrp53, the second step of pre-mRNA splicing is blocked, and recombinant SRrp53 is able to restore splicing activity. SRrp53 also regulates alternative splicing in a concentration-dependent manner. Taken together, these results suggest that SRrp53 is a novel SR-related protein that has a role both in constitutive and in alternative splicing.     

Identification and characterization of glucocorticoid-regulated nuclease(s) in lymphoid cells undergoing apoptosis

Apoptosis is a physiological process by which selected cells are deleted from a population in response to specific regulatory signals. A hallmark of apoptosis is the internucleosomal degradation of DNA prior to cell death. We are studying glucocorticoid-induced lymphocytolysis as a model system for apoptosis within the immune system. In rat thymocytes, the internucleosomal DNA cleavage which occurs following glucocorticoid treatment is both time- and dose-dependent, and is blocked by the glucocorticoid antagonist RU 486, indicating that this effect is mediated by the glucocorticoid receptor. Similar experiments using glucocorticoid-responsive (wt) and glucocorticoid-resistant (nt⁻) S49.1 lymphoma cell lines confirm that internucleosomal DNA degradation and cell death are glucocorticoid receptor-mediated events and thus reflect the direct effects of glucocorticoids on lymphocytes. In an effort to identify the nuclease(s) responsible for the DNA degradation, we have developed two assays to detect nucleases whose activity is altered by glucocorticoid treatment. The first assay involves electrophoresing extracts of nuclear protein from control and glucocorticoid-treated lymphoid cells into SDS-polyacrylamide gels containing [³²P]DNA within the gel matrix. This assay is used to estimate the molecular mass of the nuclease, based on the observed in situ nuclease activity. The second assay uses HeLa nuclei as a substrate to detect internucleosomal cleavage activity present in nuclear extracts of control and glucocorticoid-treated lymphoid cells. Using these assays we have identified a novel Ca²⁺, Mg²⁺-dependent nuclease with an apparent molecular weight of 18 kDa in both S49 wt cells and rat thymocytes treated with glucocorticoids. Furthermore, nuclear extracts of glucocorticoid-treated, but not control, rat thymocytes and S49 wt cells were capable of cleaving HeLa chromatin at internucleosomal sites. In an effort to determine the identity of the nuclease capable of internucleosomal cleavage of DNA, nuclear extracts from dex-treated rat thymocytes were fractionated by gel filtration chromatography under non-denaturing conditions, and the fractions were analyzed using the [³²P]DNA SDS-PAGE and HeLa nuclei assays. When analyzed under native conditions, the 18 kDa nuclease described previously appears to exist as a 25 kDa protein which may be part of a high molecular weight complex. Interestingly, only the 25 kDa form of the protein was associated with internucleosomal DNA cleavage activity where as the high molecular weight form of the enzyme was devoid of this activity.     

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.     

Characterization of SAF-A, a novel nuclear DNA binding protein from HeLa cells with high affinity for nuclear matrix/scaffold attachment DNA elements.

We identified four proteins in nuclear extracts from HeLa cells which specifically bind to a scaffold attachment region (SAR) element from the human genome. Of these four proteins, SAF-A (scaffold attachment factor A), shows the highest affinity for several homologous and heterologous SAR elements from vertebrate cells. SAF-A is an abundant nuclear protein and a constituent of the nuclear matrix and scaffold. The homogeneously purified protein is a novel double stranded DNA binding protein with an apparent molecular weight of 120 kDa. SAF-A binds at multiple sites to the human SAR element; competition studies with synthetic polynucleotides indicate that these sites most probably reside in the multitude of A/T-stretches which are distributed throughout this element. In addition we show by electron microscopy that the protein forms large aggregates and mediates the formation of looped DNA structures.     

A Novel and Neurotoxic Tetrahydroisoquinoline Derivative In Vivo: Formation of 1,3-Dimethyl-1,2,3,4-Tetrahydroisoquinoline, a Condensation Product of Amphetamines, in Brains of Rats Under Chronic Ethanol Treatment

Serotonin binding protein (SBP) is a vesicular protein found in neurectoderm-derived cells that store 5-hydroxytryptamine (5-HT, serotonin), such as central and peripheral serotonergic neurons and paraneurons (parafollicular cells of the thyroid). 5-HT is stored as a complex with SBP in vivo. Two forms of the protein are found. These differ in molecular mass: one is 45 kDa and the other 56 kDa. It has been suggested that the 56-kDa form of SBP may be the precursor of the 45-kDa form. To study the relationship between these two proteins, we have used a covalently bound radiolabeled probe to analyze their binding domains. A photoaffinity reagent, N-(4-azido-2-nitrophenyl)-5-hydroxytryptamine (NAP-5-HT), was synthesized and characterized by nuclear magnetic resonance spectroscopy, mass spectra, and UV-visible absorption spectra. A 1 M excess of NAP-5-HT inhibited the binding of [3H]5-HT to SBP by 50%. NAP[3H]5-HT was also synthesized and attached to both high- and low-affinity binding sites on both forms of SBP. The high-affinity constants for 45-kDa and 56-kDa proteins were 0.8 nM and 0.02 nM, respectively, whereas the low-affinity constants were 0.3 microM and 0.15 microM. When the high-affinity site of partially purified SBP was photoaffinity-labeled with the reagent, two covalently labeled proteins (45 kDa and 56 kDa) were found by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Inhibition of the labeling of both proteins by 50% was observed in the presence of a 15-fold molar excess of 5-HT.(ABSTRACT TRUNCATED AT 250 WORDS)     

Purification of a novel UV-damaged-DNA binding protein highly specific for (6-4) photoproduct.

UV damage-specific binding proteins are considered to play important roles in early responses of cells irradiated with UV, including damage recognition in the DNA repair process. We have surveyed nuclear and cytoplasmic proteins which bind selectively to UV-irradiated DNA using an electrophoretic mobility shift assay. We detected four distinct binding activities with different mobilities in fractions separated from HeLa cells by heparin chromatography. Three of them were found in nuclear extracts and one in cytoplasmic extracts. We purified one of the binding factors from nuclear extracts to homogeneity, which was designated NF-10 (the 10th fraction of nuclear extract on heparin chromatography). It migrated as a 40 kDa polypeptide in SDS-PAGE, and bound to UV-irradiated double- stranded DNA but not to unirradiated DNA. The binding pattern of the NF-10 protein to DNA irradiated with UV corresponded to the induction kinetics of (6-4) photoproduct. Removal of (6-4) photoproducts from UV- irradiated DNA by (6-4) photoproduct-specific photolyase diminished the binding of NF-10 protein. These results suggest that the NF-10 protein binds to UV-damaged DNA through (6-4) photoproduct. Immunoblot analysis using a monoclonal antibody revealed that the NF-10 protein was expressed in cell lines from all complementation groups of xeroderma pigmentosum, indicating that the NF-10 protein is a novel UV-damaged-DNA binding protein.     

In vivo reconstitution of Saccharomyces cerevisiae DNA polymerase epsilon in insect cells. Purification and characterization.

DNA polymerase epsilon (pol epsilon) is a multiple subunit complex consisting of at least four proteins, including catalytic Pol2p, Dpb2p, Dpb3p, and Dpb4p. Pol epsilon has been shown to play essential roles in chromosomal DNA replication. Here, we report reconstitution of the yeast pol epsilon complex, which was expressed and purified from baculovirus-infected insect cells. During the purification, we were able to resolve the pol epsilon complex and truncated Pol2p (140 kDa), as was observed initially with the pol epsilon purified from yeast. Biochemical characterization of subunit stoichiometry, salt sensitivity, processivity, and stimulation by proliferating cell nuclear antigen indicates that the reconstituted pol epsilon is functionally identical to native pol epsilon purified from yeast and is therefore useful for biochemical characterization of the interactions of pol epsilon with other replication, recombination, and repair proteins. Identification and characterization of a proliferating cell nuclear antigen consensus interaction domain on Pol2p indicates that the motif is dispensable for DNA replication but is important for methyl methanesulfonate damage-induced DNA repair. Analysis of the putative zinc finger domain of Pol2p for zinc binding capacity demonstrates that it binds zinc. Mutations of the conserved cysteines in the putative zinc finger domain reduced zinc binding, indicating that cysteine ligands are directly involved in binding zinc.     

Subunit composition of the untransformed glucocorticoid receptor in the cytosol and in the cell.

We have used bifunctional reagents to examine the subunit composition of the non-DNA-binding form of the rat and human glucocorticoid receptor. Treatment of intact cells and cell extracts with a reversible cross-linker, followed by electrophoretic analysis of immunoadsorbed receptor revealed that three proteins of apparent approximate molecular masses, 90, 53 and 14 kDa are associated with the receptor. The first of these was identified immunochemically as a 90-kDa heat-shock protein (hsp90). The complex isolated from HeLa cells contained 2.2 mol hsp90/mol steroid-binding subunit. Cross-linking of the receptor complex in the cytosol completely prevented salt-induced dissociation of the subunits. The cross-linked receptor was electrophoretically resolved into two oligomeric complexes of apparent molecular mass 288 kDa and 347 kDa, reflecting the association of the 53-kDa protein with a fraction of the receptor. Since no higher oligomeric complexes could be generated by cross-linking cell extracts under different conditions, we conclude that most of the untransformed cytosolic receptor is devoid of additional components.     

Proteolysis of nuclear proteins by mu-calpain and m-calpain.

Purified calpains are capable of proteolyzing several high Mr nuclear proteins and solubilizing a histone H1 kinase activity from rat liver nuclei upon exposure to 10(-6) - 10(-5) M Ca2+. Major nuclear substrates displayed apparent molecular masses of 200, 130, 120, and 60 kDa on Coomassie Blue-stained SDS-PAGE gels. The nuclear proteins and the H1 kinase were released from Triton-treated nuclei following incubation with buffer containing 0.5 M NaCl. They therefore appeared to be internal nuclear matrix proteins. The nuclear H1 kinase activity solubilized by incubation with m-calpain was eluted in the void volume of a Bio-Gel A-1.5m column, indicating an apparent mass greater than 1,500 kDa. Treatment of the calpain-solubilized kinase with 0.5 M NaCl dissociated it to a form having an apparent mass of 300 kDa (Stokes radius = 5.6 nm), suggesting that the 300-kDa (Stokes radius = 5.6 nm), nuclei by calpain treatment as a large complex containing other internal matrix proteins. Purified human erythrocyte mu-calpain was capable of proteolyzing the nuclear matrix proteins at 10(-6) M Ca2+. In contrast, human erythrocyte multicatalytic protease complex produced little cleavage of the nuclear proteins. Proteolysis of nuclear proteins by either mu-calpain or m-calpain was inhibited by calpastatin. These experiments suggest a physiologic role for the calpains in the turnover of nuclear proteins.     

Calcium-dependent calmodulin-binding proteins associated with mammalian DNA polymerase alpha

Complex, multiprotein forms of bovine (calf thymus), hamster (Chinese hamster ovary cell), and human (HeLa) cell DNA polymerase alpha (Pol alpha) were analyzed for their content of calmodulin-binding proteins. The approach used an established autoradiographic technique employing 125I-labeled calmodulin to probe proteins in denaturing SDS-polyacrylamide gel electropherograms. All three Pol alpha enzymes were associated with discrete, Ca2+-dependent calmodulin-binding proteins. Conventionally purified calf thymus Pol alpha holoenzyme contained three prominent, trifluoperazine-sensitive species with apparent molecular masses of approx. 120, 80 and 48 kDa. The 120 and 48 kDa species remained associated with the polymerase.primase core of the calf enzyme during immunopurification with monoclonal antibodies directed specifically against the polymerase subunit. The patterns of the calmodulin-binding proteins displayed by conventionally purified preparations of hamster and human Pol alpha enzymes were similar to each other and distinctly different from the pattern of comparable preparations of calf thymus Pol alpha. Immunopurified preparations of the human and hamster Pol alphas retained significant calmodulin-binding activity of apparent molecular masses of approx. 55, 80 and 150-200 kDa.     

High expression of functional adenovirus DNA polymerase and precursor terminal protein using recombinant vaccinia virus.

Initiation of Adenovirus (Ad) DNA replication occurs by a protein-priming mechanism in which the viral precursor terminal protein (pTP) and DNA polymerase (pol) as well as two nuclear DNA-binding proteins from uninfected HeLa cells are required. Biochemical studies on the pTP and DNA polymerase proteins separately have been hampered due to their low abundance and their presence as a pTP-pol complex in Ad infected cells. We have constructed a genomic sequence containing the large open reading frame from the Ad5 pol gene to which 9 basepairs from a putative exon were ligated. When inserted behind a modified late promoter of vaccinia virus the resulting recombinant virus produced enzymatically active 140 kDa Ad DNA polymerase. The same strategy was applied to express the 80 kDa pTP gene in a functional form. Both proteins were overexpressed at least 30-fold compared to extracts from Adenovirus infected cells and, when combined, were fully active for initiation in an in vitro Adenovirus DNA replication system.     

DNA replication in protein extracts from human cells requires ORC and Mcm proteins

We used protein extracts from proliferating human HeLa cells to support plasmid DNA replication in vitro. An extract with soluble nuclear proteins contains the major replicative chain elongation functions, whereas a high salt extract from isolated nuclei contains the proteins for initiation. Among the initiator proteins active in vitro are the origin recognition complex (ORC) and Mcm proteins. Recombinant Orc1 protein stimulates in vitro replication presumably in place of endogenous Orc1 that is known to be present in suboptimal amounts in HeLa cell nuclei. Partially purified endogenous ORC, but not recombinant ORC, is able to rescue immunodepleted nuclear extracts. Plasmid replication in the in vitro replication system is slow and of limited efficiency but robust enough to serve as a basis to investigate the formation of functional pre-replication complexes under biochemically defined conditions.     

Cell specific nuclear antigens of boar spermatozoa

Demembranated boar sperm heads were differentially extracted at conditions involving high salt-urea, proteolysis and DNase I cleavage that mimic the conditions promoting the in vivo decondensation of the fertilizing sperm nucleus in the egg ooplasm. The sperm-unique subset of proteins was studied which remained bound in the residual salt-resistant nuclear structure operationally defined as sperm nuclear matrix. By means of polyvalent antisera the immune specificity of the sperm nucleoprotein complex was estimated using ELISA and microcomplement fixation test as compared to somatic type dehistonized chromatin of boar liver. To define immunologically specific sperm DNA-associated proteins, hybridomas were generated by fusing lymphocytes immunized with boar sperm protein/DNA complex. Monoclonal antibodies were selected (Mab 1A8, 1B3, 2B5, 2H5 and 3A4) which identified protein moieties in the sperm DNA-tight binding proteins complex resistant to cleavage with DNase I and sensitive upon digestion with high concentration of proteases. No appreciable reactivity was recorded of the antibodies to somatic chromatin and no significant binding to ssDNA. A polypeptide in the residual sperm nuclear structure of apparent Mr 27 kDa was recognized by Mab 3A4 as detected by Western blotting. The enhanced reactivity to the DNase I digested sperm nuclear fraction (except for Mab 2H5) suggests that DNA protected from nuclease digestion by a protein might be essential for immune reactivity and full antigenic integrity as well as the dependence of the cognate proteins on the binding to DNA for antigenicity and immune specificity. The functioning of the identified putative sperm specific proteins is anticipated in the structural rearrangement of chromatin in the zygote.