The novel role of peroxiredoxin-2 in red cell membrane protein homeostasis and senescence

Peroxiredoxin-2 (Prx2), a typical two-cysteine peroxiredoxin, is the third most abundant protein in red cells. Although progress has been made in the functional characterization of Prx2, its role in red cell membrane protein homeostasis is still under investigation. Here, we studied Prx2^−/− mouse red cells. The absence of Prx2 promotes (i) activation of the oxidative-induced Syk pathway; (ii) increased band 3 Tyr phosphorylation, with clustered band 3; and (iii) increased heat shock protein (HSP27 and HSP70) membrane translocation. This was associated with enhanced in vitro erythrophagocytosis of Prx2^−/− red cells and reduced Prx2^−/− red cell survival, indicating the possible role of Prx2 membrane recruitment in red cell aging and in the clearance of oxidized hemoglobin and damaged proteins through microparticles. Indeed, we observed an increased release of microparticles from Prx2^−/− mouse red cells. The mass spectrometric analysis of erythroid microparticles found hemoglobin chains, membrane proteins, and HSPs. To test these findings, we treated Prx2^−/− mice with antioxidants in vivo. We observed that N-acetylcysteine reduced (i) Syk activation, (ii) band 3 clusterization, (iii) HSP27 membrane association, and (iv) erythroid microparticle release, resulting in increased Prx2^−/− mouse red cell survival. Thus, we propose that Prx2 may play a cytoprotective role in red cell membrane protein homeostasis and senescence.     

Mitochondria are targets for peroxisome-derived oxidative stress in cultured mammalian cells

Many cellular processes are driven by spatially and temporally regulated redox-dependent signaling events. Although mounting evidence indicates that organelles such as the endoplasmic reticulum and mitochondria can function as signaling platforms for oxidative stress-regulated pathways, little is known about the role of peroxisomes in these processes. In this study, we employ targeted variants of the genetically encoded photosensitizer KillerRed to gain a better insight into the interplay between peroxisomes and cellular oxidative stress. We show that the phototoxic effects of peroxisomal KillerRed induce mitochondria-mediated cell death and that this process can be counteracted by targeted overexpression of a select set of antioxidant enzymes, including peroxisomal glutathione S-transferase kappa 1, superoxide dismutase 1, and mitochondrial catalase. We also present evidence that peroxisomal disease cell lines deficient in plasmalogen biosynthesis or peroxisome assembly are more sensitive to KillerRed-induced oxidative stress than control cells. Collectively, these findings confirm and extend previous observations suggesting that disturbances in peroxisomal redox control and metabolism can sensitize cells to oxidative stress. In addition, they lend strong support to the ideas that peroxisomes and mitochondria share a redox-sensitive relationship and that the redox communication between these organelles is not only mediated by diffusion of reactive oxygen species from one compartment to the other. Finally, these findings indicate that mitochondria may act as dynamic receivers, integrators, and transmitters of peroxisome-derived mediators of oxidative stress, and this may have profound implications for our views on cellular aging and age-related diseases.     

Determination of urinary malondialdehyde by isotope dilution LC-MS/MS with automated solid-phase extraction: a cautionary note on derivatization optimization

A highly sensitive quantitative LC-MS/MS method was developed for measuring urinary malondialdehyde (MDA). With the use of an isotope internal standard and online solid-phase extraction, urine samples can be directly analyzed within 10 min after 2,4-dinitrophenylhydrazine (DNPH) derivatization. The detection limit was estimated as 0.08 pmol. This method was further applied to assess the optimal addition of DNPH for derivatization and to measure urinary MDA in 80 coke oven emission (COE)-exposed and 67 nonexposed workers. Derivatization optimization revealed that to achieve complete derivatization reaction, an excess of DNPH is required (DNPH/MDA molar ratio: 893-8929) for urine samples that is about 100 times higher than that of MDA standard solutions (molar ratio: 10-80). Meanwhile, the mean urinary concentrations of MDA in COE-exposed workers were significantly higher than those in nonexposed workers (0.23±0.17 vs 0.14±0.05 μmol/mmol creatinine, P<0.005). Urinary MDA concentrations were also significantly associated with the COE (P<0.005) and smoking exposure (P<0.05). Taken together, this method is capable of routine high-throughput analysis and accurate quantification of MDA and would be useful for assessing the whole-body burden of oxidative stress. Our findings, however, raise the issue that derivatization optimization should be performed before it is put into routine biological analysis.     

Analysis of age-associated changes in mitochondrial free radical generation by rat testis

Throughout spermatogenesis, mitochondria undergo a morphological and functional differentiation. Mitochondria are involved in the production of reactive oxygen species (ROS), considered one of the mediators of ageing. Particularly, lipid peroxidation is regarded as a major phenomenon by which ROS can impair cellular function. In the present study, we examined the production of superoxide anion, superoxide dismutase activity and the effect of Fe²⁺/ascorbate induced-lipid peroxidation on the respiratory chain activities of testis mitochondria throughout the process of spermatogenesis and ageing. Mitochondria from rat testes generated superoxide anion, mainly using NADH as substrate, which increased according to age. The activity of SOD is age-dependent and greatly stimulated during the first wave of spermatogenesis, but decreases in adulthood and old age. TBARS concentration was also markedly increased by ageing. The activity of mitochondrial respiratory chain complexes is differentially affected by oxidative stress induced by iron/ascorbate, succinate-dehydrogenase activity being less vulnerable than that of NADH-dehydrogenase and cytochrome c oxidase. The data suggest that ageing is accompanied by reduced activity of SOD, leading to excessive oxidative stress and enhanced lipid peroxidation that compromises the functionality of the electron transport chain. The data support the concept that mitochondrial function is an important determinant in ageing.     

Markers for oxidative stress associated with soft rots in French beans (Phaseolus vulgaris) infected by Botrytis cinerea

The role of active oxygen species has been studied in spreading soft-rot lesions caused by the necrotrophic fungal pathogen Botrytis cinerea Pers.:Fr. in leaves of four genotypes of French bean (Phaseolus vulgaris L.). Large increases were observed for the aldehydic end-products of oxidative damage, malondialdehyde and 4-hydroxy-2-nonenal, as a result of infection in each of the genotypes studied. Similar increases were found in a stable free radical and g=4.27 Fe(III) signals, but not Mn(II) signals, in electron paramagnetic resonance spectra. These changes were accompanied by large decreases in ascorbic acid levels, with changes in the antioxidant glutathione being genotype dependent. Received: 3 May 2000 / Accepted: 13 July 2000     

Reduction of DNA fragmentation and hydroxyl radical production by hyaluronic acid and chondroitin-4-sulphate in iron plus ascorbate-induced oxidative stress in fibroblast cultures

Glycosaminoglycans (GAGs), components of extracellular matrix, are thought to play important roles in cell proliferation and differentiation in the repair process of injured tissue. Oxidative stress is one of the most frequent causes of tissue and cell injury and the consequent lipid peroxidation is the main manifestation of free radical damage. It has been found to play an important role in the evolution of cell death. Since several reports have shown that hyaluronic acid (HYA) and chondroitin-4-sulphate (C4S) are able to inhibit lipid peroxidation during oxidative stress, We investigated the antioxidant capacity of these GAGs in reducing oxidative damage in fibroblast cultures.

Free radicals production was induced by the oxidizing system employing iron (Fe₂₊) plus ascorbate. We evaluated cell death, membrane lipid peroxidation, DNA damage, protein oxidation, hydroxyl radical (OH_•) generation and endogenous antioxidant depletion in human skin fibroblast cultures.

The exposition of fibroblasts to FeSO₄ and ascorbate caused inhibition of cell growth and cell death, increased OH_• production determined by the aromatic trap method; furthermore it caused DNA strand breaks and protein oxidation as shown by the DNA fragments analysis and protein carbonyl content, respectively. Moreover, it enhanced lipid peroxidation evaluated by the analysis of conjugated dienes (CD) and decreased antioxidant defenses assayed by means of measurement of superoxide dismutase (SOD) and catalase (CAT) activities.

When fibroblasts were treated with two different doses of HYA or C4S a protective effect, following oxidative stress induction, was shown. In fact these GAGs were able to limit cell death, reduced DNA fragmentation and protein oxidation, decreased OH_• generation, inhibited lipid peroxidation and improved antioxidant defenses.

Our results confirm the antioxidant activity of HYA and C4S and this could represent a useful step in the understanding of the exact role played by GAGs in living organisms.     

Frataxin deficiency in neonatal rat ventricular myocytes targets mitochondria and lipid metabolism

Friedreich ataxia (FRDA) is a hereditary disease caused by deficient frataxin expression. This mitochondrial protein has been related to iron homeostasis, energy metabolism, and oxidative stress. Patients with FRDA experience neurologic alterations and cardiomyopathy, which is the leading cause of death. The specific effects of frataxin depletion on cardiomyocytes are poorly understood because no appropriate cardiac cellular model is available to researchers. To address this research need, we present a model based on primary cultures of neonatal rat ventricular myocytes (NRVMs) and short-hairpin RNA interference. Using this approach, frataxin was reduced down to 5 to 30% of control protein levels after 7 days of transduction. At this stage the activity and amount of the iron–sulfur protein aconitase, in vitro activities of several OXPHOS components, levels of iron-regulated mRNAs, and the ATP/ADP ratio were comparable to controls. However, NRVMs exhibited markers of oxidative stress and a disorganized mitochondrial network with enlarged mitochondria. Lipids, the main energy source of heart cells, also underwent a clear metabolic change, indicated by the increased presence of lipid droplets and induction of medium-chain acyl-CoA dehydrogenase. These results indicate that mitochondria and lipid metabolism are primary targets of frataxin deficiency in NRVMs. Therefore, they contribute to the understanding of cardiac-specific mechanisms occurring in FRDA and give clues for the design of cardiac-specific treatment strategies for FRDA.     

Plasma copper and lipid peroxidation in cigarette smokers

Plasma levels of copper and lipid peroxidation were evaluated in 14 smokers as compared to 14 nonsmokers. Plasma copper concentrations were higher in smokers than in nonsmokers (122.5 ± 19.15 vs. 101.5 ± 16.2 μg/dl, P < .01). Plasma lipoperoxidation, evaluated as fluorescent damage products of lipid peroxidation (FDPL), also was higher in smokers than in nonsmokers (20.35 ± 2.6 vs. 17.1 ± 2.95 units of relative fluorescence/ml, P < .01). A significant and positive correlation between the number of cigarettes smoked, expressed as pack years, and the levels of either FDPL (r = .61, P < .025) or copper (r = .55, P < .05) was found. Moreover, a significant and positive relationship between copper and FDPL values was observed in smokers (r = .64; P < .025), but not in nonsmokers. These data indicate that cigarette smoke-related plasma oxidant load may be partly due to enhanced levels of the prooxidant metal copper, potentially suggesting the supplementation of specific antioxidants (e.g., zinc) to counteract cigarette smoke-induced oxidative stress in smokers.     

β-Amyloid Neurotoxicity In Vitro: Evidence of Oxidative Stress but Not Protection by Antioxidants

Abstract: Recent data from several groups suggest that the primary mechanism of β-amyloid neurotoxicity may be mediated by reactive oxygen species. To evaluate this hypothesis, we first compared the efficacy of antioxidant agents in preventing toxicity caused by oxidative insults (iron, hydrogen peroxide, and tert -butyl hydroperoxide) and β-amyloid peptides in cultured rat hippocampal neurons. Tested antioxidants (propyl gallate, Trolox, probucol, and promethazine) generally provided significant protection against oxidative insults but not β-amyloid peptides. Next, we examined whether β-amyloid causes oxidative stress, by comparing levels of lipid peroxidation after exposure to either iron or β-amyloid. In a cell-free system, iron but not β-amyloid generated lipid peroxidation. In culture, both insults caused rapid increases in lipid peroxidation, with iron inducing higher levels at later time points. Pretreatment with the antioxidant probucol significantly reduced lipid peroxidation caused by both insults but only attenuated iron toxicity, suggesting that lipid peroxidation does not contribute directly to cell death induced by β-amyloid. Finally, we observed that increasing basal levels of oxidative stress by pretreating cultures with subtoxic doses of iron significantly increased neuronal vulnerability to β-amyloid. The ability of β-amyloid to induce oxidative stress and the demonstration that oxidative stress potentiates β-amyloid toxicity support the clinical use of antioxidants for AD. However, these data do not support the theory that the primary mechanism of β-amyloid toxicity involves oxidative pathways, indicating a continued need to identify additional cellular responses to β-amyloid that underlie its neurodegenerative actions.     

Evidence that free radical generation occurs during scorpion envenomation

Although it is well established that symptomatology, morbidity and death following scorpion envenomation are due to increases in neurotransmitter release secondary to toxins binding to voltage-sensitive sodium channels, the mechanism by which venom action is involved in damaging heart, liver, lungs and kidneys remains unclear. We hypothesized that scorpion toxins could induce the generation of high levels of free radicals responsible for membrane damage in organs targeted by venom action. We have investigated lipid peroxidation in different organs, through the evaluation of thiobarbituric acid reactive substances (TBARS), after experimental envenomation of rats by toxic fractions of Androctonus australis Hector venom. We have shown that scorpion toxins cause considerable lipid peroxidation in most vital organs. We also evaluated the protective effects of antioxidants in mice injected with lethal doses of toxins. Among the drugs tested, N-acetylcysteine (NAC) was effective in protecting the mice when injected prior to toxin application. However, the free radical scavenging properties of NAC seem less implicated in these protective effects than its ability to increase the fluidity of bronchial secretions. We therefore conclude that free radical generation only plays a minor role in the toxicity of scorpion venom.     

Oxidative stress-related mechanisms affecting response to aspirin in diabetes mellitus

Type 2 diabetes mellitus (T2DM) is a major cardiovascular risk factor. Persistent platelet activation plays a key role in atherothrombosis in T2DM. However, current antiplatelet treatments appear less effective in T2DM patients vs nondiabetics at similar risk. A large body of evidence supports the contention that oxidative stress, which characterizes DM, may be responsible, at least in part, for less-than-expected response to aspirin, with multiple mechanisms acting at several levels. This review discusses the pathophysiological mechanisms related to oxidative stress and contributing to suboptimal aspirin action or responsiveness. These include: (1) mechanisms counteracting the antiplatelet effect of aspirin, such as reduced platelet sensitivity to the antiaggregating effects of NO, due to high-glucose-mediated oxidative stress; (2) mechanisms interfering with COX acetylation especially at the platelet level, e.g., lipid hydroperoxide-dependent impaired acetylating effects of aspirin; (3) mechanisms favoring platelet priming (lipid hydroperoxides) or activation (F₂-isoprostanes, acting as partial agonists of thromboxane receptor), or aldose-reductase pathway-mediated oxidative stress, leading to enhanced platelet thromboxane A₂ generation or thromboxane receptor activation; (4) mechanisms favoring platelet recruitment, such as aspirin-induced platelet isoprostane formation; (5) modulation of megakaryocyte generation and thrombopoiesis by oxidative HO-1 inhibition; and (6) aspirin–iron interactions, eventually resulting in impaired pharmacological activity of aspirin, lipoperoxide burden, and enhanced generation of hydroxyl radicals capable of promoting protein kinase C activation and platelet aggregation. Acknowledgment of oxidative stress as a major contributor, not only of vascular complications, but also of suboptimal response to antiplatelet agents in T2DM, may open the way to designing and testing novel antithrombotic strategies, specifically targeting oxidative stress-mediated mechanisms of less-than-expected response to aspirin.     

Lipid peroxidation products in human subretinal fluid

The concentrations of thiobarbituric acid reacting substances (TBARS) and proteins in the subretinal fluid (SF) of patients undergoing retinal detachment surgery have been determined. We have tried to establish the correlations between these biochemical and other clinical features of these patients: evolution time of the retinal detachment, age, degree of myopia, and macular affection. Caucasian patients, 19 men and 19 women (57.42 ±12.85 average age, interval 20–80) were randomly selected for this study. SF samples were obtained by puncture after scleral indentation. TBARS and protein concentrations were determined by the corresponding colorimetric assays. A linear correlation exists between TBARS and protein contents in these samples. No correlation could be established between evolution time of the retinal detachment and TBARS content in SF. TBARS in SF increases with increasing age in nonmyopic patients. In the samples of myopic patients the correlation was established between TBARS content and degree of myopia. The group of patients with more than 10 dioptres show a significant higher TBARS concentration in SF than any of the other groups studied. It can be concluded that lipid peroxidation products in SF originate, at least partially, from rod outer segments, and that lipid peroxidation is a process that might play a role in the pathogenesis of retinal detachment, specially in myopic patients.     

Hyaluronic acid and chondroitin-4-sulphate treatment reduces damage in carbon tetrachloride-induced acute rat liver injury

Oxidative stress is involved in the pathogenesis of chemically mediated liver injury. Since glycosaminoglycans possess antioxidant activity, the aim of this work was to assess the protective effects of hyaluronic acid and chondroitin-4-sulphate treatment in a model of carbon tetrachloride-induced liver injury. Liver damage was induced in male rats by an intraperitoneal injection of carbon tetrachloride (1 ml/kg in vegetal oil). Serum alanine aminotransferase and aspartate aminotransferase, hepatic malondialdehyde, plasma TNF-alpha, hepatic reduced glutathione and catalase, and myeloperoxidase, an index of polymorphonuclear infiltration in the jeopardised hepatic tissue, were evaluated 24 h after carbon tetrachloride administration. Carbon tetrachloride produced a marked increase in serum alanine aminotransferase and aspartate aminotransferase activities, primed lipid peroxidation, enhanced plasma TNF-alpha levels, induced a severe depletion of reduced glutathione and catalase, and promoted neutrophil accumulation. Intraperitoneal treatment of rats with hyaluronic acid (25 mg/kg) or chondroitin-4-sulphate (25 mg/kg) failed to exert any effect in the considered parameter, while the combination treatment with both glycosaminoglycans (12,5 + 12,5 mg/kg) decreased the serum levels of alanine aminotransferase and aspartate aminotransferase, inhibited lipid peroxidation by reducing hepatic malondialdehyde, reduced plasma TNF-alpha, restored the endogenous antioxidants, and finally decreased myeloperoxidase activity. These results suggest that hyaluronic acid and chondroitin-4-sulphate possess a different antioxidant mechanism and consequently the combined administration of both glycosaminoglycans exerts a synergistic effect with respect to the single treatment.     

Role of reactive aldehyde in cardiovascular diseases

There is increasing evidence that aldehydes generated endogenously during the degradation process of biological molecules are involved in many of the pathophysiologies associated with cardiovasular diseases such as atherosclerosis and the long-term complications of diabetes. Major sources of reactive aldehydes in vivo are lipid peroxidation, glycation, and amino acid oxidation. Although the types of aldehydes are varied, the important aldehydes that can exert biological effects relevant to the pathobiology of oxidant injury are represented by 2-alkenals, 4-hydroxy-2-alkenals, and ketoaldehydes. These aldehydes exhibit facile reactivity with proteins, generating stable products at the end of a series of reactions. The protein-bound aldehydes can be detected as constituents not only in in vitro oxidized low-density lipoproteins but also in animal models of atherosclerosis and in human patients with increased risk factors or clinical manifestations of atherosclerosis, indicating that they could indeed be involved in the caldiovascular pathology. On the other hand, a number of reactive aldehydes have been implicated as inducers in generating intracellular oxidative stress and activation of stress signaling pathways, that integrate with other signaling pathways to control cellular responses to the extracellular stimuli.     

Glutaredoxin 2 knockout increases sensitivity to oxidative stress in mouse lens epithelial cells

Glutaredoxin belongs to the oxidoreductase family, with cytosolic glutaredoxin 1 (Grx1) and mitochondrial glutaredoxin 2 (Grx2) isoforms. Of the two isozymes, the function of Grx2 is not well understood. This paper describes the effects of Grx2 deletion on cellular function using primary lens epithelial cell cultures isolated from Grx2 gene knockout (KO) and wild-type (WT) mice. We found that both cell types showed similar growth patterns and morphology and comparable mitochondrial glutathione pool and complex I activity. Cells with deleted Grx2 did not show affected Grx1 or thioredoxin expression but exhibited high sensitivity to oxidative stress. Under treatment with H(2)O(2), the KO cells showed less viability, higher membrane leakage, enhanced ATP loss and complex I inactivation, and weakened ability to detoxify H(2)O(2) in comparison with the WT cells. The KO cells had higher glutathionylation in the mitochondrial proteins, particularly the 75-kDa subunit of complex I. Recombinant Grx2 deglutathionylated complex I and restored most of its activity. We conclude that Grx2 has a function that protects cells against H(2)O(2)-induced injury via its peroxidase and dethiolase activities; particularly, Grx2 prevents complex I inactivation and preserves mitochondrial function.     

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.     

Antioxidant functions of carotenoids

Carotenoid pigments, including hydrocarbons such as β-carotene or xanthophylls such as lutein and zeaxanthin, are very widely distributed in nature, where they play an important role in protecting cells and organisms against the harmful effects of light, air, and sensitizer pigments. This process has been demonstrated in bacteria, algae, plants, animals, and even in humans in the light-sensitive disease, erythropoietic protoporphyria. The primary mechanism of action of this phenomenon appears to be the ability of carotenoids to quench excited sensitizer molecules as well as quench ¹O₂.

In addition to this protection, and potentially of even greater biological importance, is the fact that carotenoids can also serve as antioxidants under conditions other than photosensitization. This review presents the data available indicating the extent of this important function. Antioxidant action can be documented in both enzymic and nonenzymic systems, and has been reported in subcellular, cellular, and animal studies. In fact, the many reports indicating that carotenoids may possess some anticarcinogenic properties may well be related to their ability to interact with and quench various radical species that can be generated within cells.     

(+)-Catechin inhibits platelet hyperactivity induced by an acute iron load in vivo

Reactive oxygen species and platelets are thought to be involved in the pathogenesis of cardiovascular disease. Epidemiological data have indicated that high consumption of fruits and vegetables is associated with a lower incidence of vascular events. Polyphenols were proposed to provide such a protection. In the present study performed in rats, we investigated the influence of (+)-catechin (Cat), a polyphenol identified in tea, cocoa, and red wine, on an acute iron load-induced model of platelet hyperactivity. We found that platelet function was significantly enhanced in iron-loaded rats. These changes were associated with impairment of the antioxidative defense including ex vivo free radical-induced hemolysis. Pretreatment with Cat (10 mg/kg, ip, 4 d) normalized biomarkers of antioxidative status and platelet hyperactivity. The benefits of Cat treatment were only observed in iron-loaded animals and not in control animals. In light of the known antioxidant properties of Cat (or its metabolites), we suggest that oxidative injury-induced modification of platelet calcium homeostasis may have explained the iron load-induced platelet hyperactivity. The protective effect of Cat appears to work probably through normalization of the antioxidative status.     

Antioxidant effects of water- and lipid-soluble nitroxide radicals in liposomes

Liposomes are today useful tools in different fields of science and technology. A lack of stability due to lipid peroxidation is the main problem in the extension of the use of these formulations. Recent investigative works have reported the protective effects of stable nitroxide radicals against oxidative processes in different media and under different stress conditions. Our group has focused its attention on the natural aging of liposomes and the protection provided by the water- and lipid-soluble nitroxide radicals 2,2,6,6-tetramethylpiperdine-1-oxyl (TEMPO) and doxylstearic acids (5-DSA, 12-DSA, and 16-DSA), respectively. Unilamellar liposomes were incubated under air atmosphere at 37°C, both in the absence and in the presence of these radicals. Conjugated dienes, lipid hydroperoxides, TBARS, membrane fluidity, and nitroxide ESR signal intensity were followed as a function of time. Our results demonstrated that doxylstearic acids were more efficient than TEMPO in retarding lipid peroxidation at all the concentrations tested. The inhibition percentages, depending on the total nitroxide concentration, were not proportional to the lipid–water partition coefficient. Furthermore, time-course ESR signals showed a slower decrease for doxylstearic acids than for TEMPO. No significant differences were found among 5-DSA, 12-DSA, and 16-DSA. We concluded that the nitroxide radical efficiency as antioxidant directly depends on both nitroxide concentration and lipophilicity.