Formation of the double helix: a mutational study

To investigate the mechanisms by which oligonucleotides hybridize to target molecules, the binding of two oligodeoxynucleotide probes to RNA targets was measured over a broad range of temperatures. Mutations were then scanned across each DNA/RNA hybrid to map, at single base resolution, sequences important for hybridization. Despite being unrelated in sequence, each hybrid formed by a similar mechanism. In the absence of secondary structure, two stretches of bases, termed nucleation regions, cooperated with one another by a looping mechanism to nucleate hybridization. Mutations inside each nucleation region strongly decreased hybridization rates, even at temperatures well below the melting temperature (T_m) of the hybridized duplex. Surprisingly, nucleation regions were detected in a RNA target but not a corresponding DNA target. When either nucleation region was sequestered in secondary structure, the hybridization rate fell and the mechanism of hybridization changed. Single-stranded bases within the nucleation region of the probe and target first collided to form a double helix. If sufficiently G + C rich, the double helix then propagated throughout the oligonucleotide by a strand invasion process. On the basis of these results, general mechanisms for the hybridization of oligonucleotides to complementary and mutant targets are proposed.     

Unusual chromatographic behavior of oligonucleotide sequence isomers on two different anion exchange HPLC columns

The retention behavior of the unmodified phosphodiester oligonucleotide sequence isomers was investigated on two different anion exchange columns: Biospher GMB 1000Q (based on DEAE-modified glycidyl methacrylate) and PolyWAX LP (based on silica with a crosslinked coating of linear polyethyleneimine). There was a notable difference in retention of oligonucleotides of the same composition but differing in the position of a single base. The most pronounced difference was observed between the oligonucleotides with the variable base in the end and in the center of the sequence. The use of either acetonitrile or 2-propanol as a mobile phase organic modifier did not markedly affect the retention time patterns. Prediction of the retention times of oligonucleotides must take into account the base position as well as identity. This is the first report of such a "same composition different sequence" effect, described for the short peptides, for synthetic oligonucleotides.     

Effects of non-nearest neighbors on the thermodynamic stability of RNA GNRA hairpin tetraloops

Currently, several models for predicting the secondary structure of RNA exist, one of which is free energy minimization using the Nearest Neighbor Model. This model predicts the lowest-free energy secondary structure from a primary sequence by summing the free energy contributions of the Watson-Crick nearest neighbor base pair combinations and any noncanonical secondary structure motif. The Nearest Neighbor Model also assumes that the free energy of the secondary structure motif is dependent solely on the identities of the nucleotides within the motif and the motif's nearest neighbors. To test the current assumption of the Nearest Neighbor Model that the non-nearest neighbors do not affect the stability of the motif, we optically melted different stem-loop oligonucleotides to experimentally determine their thermodynamic parameters. In each of these oligonucleotides, the hairpin loop sequence and the adjacent base pairs were held constant, while the first or second non-nearest neighbors were varied. The experimental results show that the thermodynamic contributions of the hairpin loop were dependent upon the identity of the first non-nearest neighbor, while the second non-nearest neighbor had a less obvious effect. These results were then used to create an updated model for predicting the thermodynamic contributions of a hairpin loop to the overall stability of the stem-loop structure.     

B-Z Transition of Synthetic Oligonucleotides Containing Non-Z Forming Elements

Abstract

Ten oligonucleotides of the length 8–12 base pairs have been synthesized, which contain, in addition to the obligatory sequences CG/CG, sequences not favorable for the transition to the Z conformation (AT pairs, GG/CC or AA/TT sequences). Conformational transitions of these oligonucleotides in high concentrations of NaClO₄ in the absence and in the presence of Ni²⁺ were investigated using CD spectroscopy.

The B-Z transition is affected by the length and sequence of the oligonucleotide. Increasing the NaC1O₄ concentration alone the transition of only one of the oligonucleotides studied, (CGCGCGTGC ACGCGCG)₂, can be induced. Other oligonucleotides remain in the B conformation or only partial transition to the Z conformation can be observed.

Most other oligonucleotides can be converted into the Z conformation at intermediate concentrations of NaC1O₄ (2.0?3.2 M) by an addition of Ni²⁺ ions. In some cases, however, Ni²⁺ can destabilize the double stranded structure of the sample. We have studied the effect of the presence of A.T pairs in the G.C containing oligonucleotides and the effect of the presence of pu-pu/pyr-pyr sequences. The presence of the latter sequences in the Z form implicates the formation of a Z-Z′ junction which makes the transition quite difficult. Despite the fact that some oligonucleotides contained several structural elements not favorable for the transition, we did not find any sequence which would completely block the ability of the oligonucleotide to adopt the Z conformation.     

Improvement of RNA secondary structure prediction using RNase H cleavage and randomized oligonucleotides

RNA secondary structure prediction using free energy minimization is one method to gain an approximation of structure. Constraints generated by enzymatic mapping or chemical modification can improve the accuracy of secondary structure prediction. We report a facile method that identifies single-stranded regions in RNA using short, randomized DNA oligonucleotides and RNase H cleavage. These regions are then used as constraints in secondary structure prediction. This method was used to improve the secondary structure prediction of Escherichia coli 5S rRNA. The lowest free energy structure without constraints has only 27% of the base pairs present in the phylogenetic structure. The addition of constraints from RNase H cleavage improves the prediction to 100% of base pairs. The same method was used to generate secondary structure constraints for yeast tRNA^Phe, which is accurately predicted in the absence of constraints (95%). Although RNase H mapping does not improve secondary structure prediction, it does eliminate all other suboptimal structures predicted within 10% of the lowest free energy structure. The method is advantageous over other single-stranded nucleases since RNase H is functional in physiological conditions. Moreover, it can be used for any RNA to identify accessible binding sites for oligonucleotides or small molecules.     

Separation of modified 2'-deoxyoligonucleotides using ion-pairing reversed-phase HPLC

A group of 18-mers of the same base sequence, but with differing alkyl modifications is used to investigate effects of these modifications on retention of oligonucleotides using ion-pairing reversed-phase liquid chromatography (IP-RPLC). It is shown that IP-RPLC is able to distinguish between oligonucleotides differing only by a single alkyl group. The identity of the nucleobase and position and length of the alkyl adduct affect retention of the oligonucleotide. These separation phenomena result from changes in charge and hydrophobicity upon alkylation. As demonstrated in this paper; chromatographic selectivity, unique to IP-RPLC, greatly facilitates the purification process of modified oligonucleotides.     

Sequence-dependent oligonucleotide-target duplex stabilities: rules from empirical studies with a set of twenty-mers

We were interested in developing a better method to predict the thermal stability of specific oligonucleotide-target duplexes. Recognizing that the base sequence can have important effects, we investigated the use of a simple parameter based on nearest-neighbor stacking interactions, the mean stacking temperature. We took values for doublet stabilities from the literature and used a computer program to calculate mean stacking temperatures for all oligonucleotides of specified length and G + C content in the M13 phage genome. As expected, the program predicted a fairly broad range of stabilities for different sequences of equal G + C content. We selected 20-mer sequences representing the highest and lowest mean stacking temperatures at 25%, 50% and 75% G + C and synthesized them for use as probes against M13 DNA immobilized on filters. By hybridizing and washing at different temperatures, we demonstrated that mean stacking temperatures correlate well with observed stabilities. Relative stabilities of the six oligos were predicted correctly in every case. We used conditions appropriate to oligonucleotide probing and polymerase chain reaction and we were able to derive simple linear equations relating the empirical data and mean stacking temperature for both. These observations should be useful in planning experiments with oligonucleotides.     

Control of oligonucleotide retention on a pH-stabilized strong anion exchange column

Strong anion exchange columns are preferred for oligonucleotide analyses due to their ability to effectively control secondary structure and poly(G) interactions. Methacrylate-based anion exchange phases minimize hydrophobic interactions with oligonucleotides, but they also tend to hydrolyze under alkaline conditions. In this article, we report the use of an anion exchange column prepared from a new class of methacrylate monomers designed to improve hydrolytic stability. This column is used to show predictable adjustment of oligonucleotide retention by eluent pH and composition. Features of the new column include (i) large, predictable, pH-dependent retention shifts (varying with specific changes in 5' or 3' terminal bases with NaCl-based eluents); (ii) reduced retention when solvent is added to NaCl-based eluents; and (iii) suppression of much of the column's hydrophobic interactions when CH3CN is used with NaClO4-based eluents at a neutral pH (i.e., this eluent system separates oligonucleotides primarily in order of their length). These observations will aid the development of elution conditions for both size-dependent and base sequence-dependent (or base composition-dependent) separations.     

Stimulation of ribosomal frameshifting by antisense LNA

Programmed ribosomal frameshifting is a translational recoding mechanism commonly used by RNA viruses to express two or more proteins from a single mRNA at a fixed ratio. An essential element in this process is the presence of an RNA secondary structure, such as a pseudoknot or a hairpin, located downstream of the slippery sequence. Here, we have tested the efficiency of RNA oligonucleotides annealing downstream of the slippery sequence to induce frameshifting in vitro. Maximal frameshifting was observed with oligonucleotides of 12–18 nt. Antisense oligonucleotides bearing locked nucleid acid (LNA) modifications also proved to be efficient frameshift-stimulators in contrast to DNA oligonucleotides. The number, sequence and location of LNA bases in an otherwise DNA oligonucleotide have to be carefully manipulated to obtain optimal levels of frameshifting. Our data favor a model in which RNA stability at the entrance of the ribosomal tunnel is the major determinant of stimulating slippage rather than a specific three-dimensional structure of the stimulating RNA element.     

Hybridization kinetics of out-of-equilibrium mixtures of short RNA oligonucleotides

Hybridization and strand displacement kinetics determine the evolution of the base paired configurations of mixtures of oligonucleotides over time. Although much attention has been focused on the thermodynamics of DNA and RNA base pairing in the scientific literature, much less work has been done on the time dependence of interactions involving multiple strands, especially in RNA. Here we provide a study of oligoribonucleotide interaction kinetics and show that it is possible to calculate the association, dissociation and strand displacement rates displayed by short oligonucleotides (5nt–12nt) that exhibit no expected secondary structure as simple functions of oligonucleotide length, CG content, ΔG of hybridization and ΔG of toehold binding. We then show that the resultant calculated kinetic parameters are consistent with the experimentally observed time dependent changes in concentrations of the different species present in mixtures of multiple competing RNA strands. We show that by changing the mixture composition, it is possible to create and tune kinetic traps that extend by orders of magnitude the typical sub-second hybridization timescale of two complementary oligonucleotides. We suggest that the slow equilibration of complex oligonucleotide mixtures may have facilitated the nonenzymatic replication of RNA during the origin of life.     

Analysis of an RNA Pseudoknot Structure by CD Spectroscopy

Abstract

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A · C opposition at higher temperatures (J. Mol. Biol. 214, 455–470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A · U, G · C, and G · U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373–384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A · C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A · C oppositions.     

The 5′ Stem-Loop From Human U4 snRNA Adopts a Novel Conformation Stabilized by G-C and G-U Base Pairs

Abstract

¹H NMR and molecular modeling studies of the 5′ stem-loop from human U4 snRNA were undertaken to determine the conformation of this stem-loop that is essential for spliceosome formation and pre-mRNA splicing. Sixteen of the 35 nucleotides of this stem-loop are in the loop region and inspection of the loop sequence revealed no decomposition into elements of secondary structure commonly found in other RNA stem-loops. An analysis of possible base pairing interactions for this stem-loop using the methods of Zuker revealed the lowest energy secondary structure for the 16 nucleotide loop consisted of four base pairs at the base of a non-canonical tetraloop (UUUA). This shorter stem-loop was joined to the nine base pair stem by two A residues on the 5′ side and a single bulged A on the 3′ side. Both stems also had bulged A residues. ¹H NMR experiments performed on solutions of the 35mer stem-loop, the stem region, and the loop region confirmed the 35mer adopted this secondary structure in solution. A 3D molecular model of this structure consistent with the NMR data was generated to assist in visualization of this novel structure.     

Effects of RNA secondary structure on cellular antisense activity

The secondary and tertiary structures of a mRNA are known to effect hybridization efficiency and potency of antisense oligonucleotides in vitro. Additional factors including oligonucleotide stability and cellular uptake are also thought to contribute to antisense potency in vivo. Each of these factors can be affected by the sequence of the oligonucleotide. Although mRNA structure is presumed to be a critical determinant of antisense activity in cells, to date little direct experimental evidence has addressed the significance of structure. In order to determine the importance of mRNA structure on antisense activity, oligonucleotide target sites were cloned into a luciferase reporter gene along with adjoining sequence to form known structures. This allowed us to study the effect of target secondary structure on oligonucleotide binding in the cellular environment without changing the sequence of the oligonucleotide. Our results show that structure does play a significant role in determining oligonucleotide efficacy in vivo. We also show that potency of oligonucleotides can be improved by altering chemistry to increase affinity for the mRNA target even in a region that is highly structured.     

Free energy of imperfect nucleic acid helices. II. Small hairpin loops

Physical studies of enzymically synthesized oligonucleotides of defined sequence are used to evaluate quantitatively the stability of small RNA hairpin loops and helices. The series (Ap)₄G(pC) _N(pU)₄, N = 4, 5 or 6, exists as monomolecular hairpin helices when N ≥ 5, and as imperfect dimer helices when N ≤ 4. In this size range, hairpin loops become more favorable (less destabilizing thermodynamically) as they increase in size from 3 to 4 to 5 unbonded nucleotides. Very small hairpin loops are particularly destabilizing; molecules whose base sequence would imply a hairpin loop of three nucleotides will generally exist with a loop of five, including a broken terminal base pair.Thermodynamic parameters for base pair and loop formation are calculated by a method which makes unnecessary the use of measured enthalpies of polynucleotide melting. Literature data on oligonucleotide double helices yield estimates of the free energy contribution from each of the six types of stacking interactions between three possible neighboring base pairs. The advantage of this approach is that the properties of oligonucleotides are used in predicting the stability of small RNA helices, avoiding the long extrapolation from the properties of high polymers.We provide Tables of temperature-dependent free energies that allow one to predict the stability and thermal transition temperature of many simple RNA secondary structures (applicable to ~1 m-Na⁺ concentration). As an example, we apply the rules to an isolated fragment of tRNA^Ser (yeast) (Coutts, 1971), whose properties were not used in calculating the free-energy parameters. The experimental melting temperature of 88 °C is predicted with an error margin of 5 deg. C.     

Formation of an intramolecular triple-stranded DNA structure monitored by fluorescence of 2-aminopurine or 6-methylisoxanthopterin

The parallel (recombination) ‘R-triplex’ can accommodate any nucleotide sequence with the two identical DNA strands in parallel orientation. We have studied oligonucleotides able to fold back into such a recombination-like structure. We show that the fluorescent base analogs 2-aminopurine (2AP) and 6-methylisoxanthopterin (6MI) can be used as structural probes for monitoring the integrity of the triple-stranded conformation and for deriving the thermodynamic characteristics of these structures. A single adenine or guanine base in the third strand of the triplex-forming and the control oligonucleotides, as well as in the double-stranded (ds) and single-stranded (ss) reference molecules, was substituted with 2AP or 6MI. The 2AP*(T·A) and 6MI*(C·G) triplets were monitored by their fluorescence emission and the thermal denaturation curves were analyzed with a quasi-two-state model. The fluorescence of 2AP introduced into an oligonucleotide sequence unable to form a triplex served as a negative control. We observed a remarkable similarity between the thermodynamic parameters derived from melting of the secondary structures monitored through absorption of all bases at 260 nm or from fluorescence of the single base analog. The similarity suggests that fluorescence of the 2AP and 6MI base analogs may be used to monitor the structural disposition of the third strand. We consider the data in the light of alternative ‘branch migration’ and ‘strand exchange’ structures and discuss why these are less likely than the R-type triplex.     

Empirical comparison of cross-platform normalization methods for gene expression data

Background

The prediction of secondary structure, i.e. the set of canonical base pairs between nucleotides, is a first step in developing an understanding of the function of an RNA sequence. The most accurate computational methods predict conserved structures for a set of homologous RNA sequences. These methods usually suffer from high computational complexity. In this paper, TurboFold, a novel and efficient method for secondary structure prediction for multiple RNA sequences, is presented.

Results

TurboFold takes, as input, a set of homologous RNA sequences and outputs estimates of the base pairing probabilities for each sequence. The base pairing probabilities for a sequence are estimated by combining intrinsic information, derived from the sequence itself via the nearest neighbor thermodynamic model, with extrinsic information, derived from the other sequences in the input set. For a given sequence, the extrinsic information is computed by using pairwise-sequence-alignment-based probabilities for co-incidence with each of the other sequences, along with estimated base pairing probabilities, from the previous iteration, for the other sequences. The extrinsic information is introduced as free energy modifications for base pairing in a partition function computation based on the nearest neighbor thermodynamic model. This process yields updated estimates of base pairing probability. The updated base pairing probabilities in turn are used to recompute extrinsic information, resulting in the overall iterative estimation procedure that defines TurboFold. TurboFold is benchmarked on a number of ncRNA datasets and compared against alternative secondary structure prediction methods. The iterative procedure in TurboFold is shown to improve estimates of base pairing probability with each iteration, though only small gains are obtained beyond three iterations. Secondary structures composed of base pairs with estimated probabilities higher than a significance threshold are shown to be more accurate for TurboFold than for alternative methods that estimate base pairing probabilities. TurboFold-MEA, which uses base pairing probabilities from TurboFold in a maximum expected accuracy algorithm for secondary structure prediction, has accuracy comparable to the best performing secondary structure prediction methods. The computational and memory requirements for TurboFold are modest and, in terms of sequence length and number of sequences, scale much more favorably than joint alignment and folding algorithms.

Conclusions

TurboFold is an iterative probabilistic method for predicting secondary structures for multiple RNA sequences that efficiently and accurately combines the information from the comparative analysis between sequences with the thermodynamic folding model. Unlike most other multi-sequence structure prediction methods, TurboFold does not enforce strict commonality of structures and is therefore useful for predicting structures for homologous sequences that have diverged significantly. TurboFold can be downloaded as part of the RNAstructure package at http://rna.urmc.rochester.edu.     

Characterization of the Structure and Melting Behavior of the Loop I fragment of ColE1 RNA I

Abstract

We have synthesized two RNA fragments: a 42-mer corresponding to the full loop I sequence of the loop I region of ColE1 antisense RNA (RNA I), plus three additional Gs at the 5′-end, and a 31-mer which has 11 5′-end nucleotides (G(-2)-U9) deleted. The secondary structure of the 42-mer, deduced from one- and two-dimensional NMR spectra, consists of a stem of 11 base-pairs which contains a U-U base-pair and a bulged C base, a 7 nucleotide loop, and a single-stranded 5′ end of 12 nucleotides. The UV-melting study of the 42-mer further revealed a multi-step melting behavior with transition temperatures 32°C and 71°C clearly discernible. In conjunction with NMR melting study the major transition at 71°C is assigned to the overall melting of the stem region and the 32°C transition is assigned to the opening of the loop region. The deduced secondary structure agrees with that proposed for the intact RNA I and provides structural bases for understanding the specificity of RNase E.     

Arrays of complementary oligonucleotides for analysing the hybridisation behaviour of nucleic acids.

Arrays of oligonucleotides corresponding to a full set of complements of a known sequence can be made in a single series of base couplings in which each base in the complement is added in turn. Coupling is carried out on the surface of a solid support such as a glass plate, using a device which applies reagents in a defined area. The device is displaced by a fixed movement after each coupling reaction so that consecutive couplings overlap only a portion of previous ones. The shape and size of the device and the amount by which it is displaced at each step determines the length of the oligonucleotides. Certain shapes create arrays of oligonucleotides from mononucleotides up to a given length in a single series of couplings. The array is used in a hybridisation reaction to a labelled target sequence, and shows the hybridisation behaviour of every oligonucleotide in the target sequence with its complement in the array. Applications include sequence comparison to test for mutation, analysis of secondary structure, and optimisation of PCR primer and antisense oligonucleotide design.     

Prediction of 3-D Structure of the Cro Protein from Phage 434

Abstract

A comparative model building process has been utilized to predict (he three-dimensional structure of the bacteriophage 434 Cro protein, Amino acid sequence similarities between the 434 Cro protein and other bacteriophage repressor and Cro proteins have been used, in conjunction with secondary structure prediction and the known structures of other base sequence specific DNA binding proteins, to derive the model. From this model the interactions between the 434 Cro protein and its operator DNA have been deduced. These proposed interactions are consistent with the known properties of the bacteriophage 434 Cro protein.