Characterization, chromosomal localization, and genetic variation of the porcine heart fatty acid-binding protein gene

The purpose of this study was to detect genetic variation in the porcine H-FABP gene, a candidate gene for meat quality traits in pigs. Lambda phages containing the porcine H-FABP gene were isolated by plaque hybridization with human H-FABP cDNA. The coding and flanking intronic sequences of the porcine H-FABP gene were determined as well as 1.6 kb of the 5′ upstream region. The various potential regulatory sequences in this region are in accordance with the function and expression of the protein in muscle and mammary tissue. Furthermore, comparison with the homolog region of the mouse identified a highly conserved 13-bp element (CTTCCT [A/C] TTTCGG) that may be involved in regulation of expression. The porcine H-FABP gene was localized on Chromosome (Chr) 6 by porcine sequence-specific PCR on DNA from a pig/rodent cell hybrid panel. In addition, part of the H-FABP gene was screened for genetic variation by PCR-RFLP analysis. Three PCR-RFLPs were detected, one in the upstream region (HinfI) and two in the second intron (HaeIII and MspI). In most pig breeds the corresponding alleles have a variable distribution, possibly a consequence of selective breeding. This genetic variation will enable us to investigate the role of the H-FABP locus in porcine production and meat quality traits. Received: 22 August 1996 / Accepted: 3 January 1997     

Isolation and sequence determination of cDNA clones for porcine and human lipoamide dehydrogenase. Homology to other disulfide oxidoreductases

A 2.3-kilobase cDNA clone encoding lipoamide dehydrogenase was isolated from a porcine adrenal medulla library in the vector pCD by screening with four synthetic oligonucleotide probes corresponding to amino acid sequence from tryptic peptides of porcine lipoamide dehydrogenase. A 450-bp fragment of the porcine cDNA was used to screen a human small cell lambda gt10 library at reduced stringency. Overlapping human cDNA clones of various lengths were isolated, the largest of which was again 2.3 kilobases in length. Sequencing of both porcine and human cDNAs revealed a short 5'-untranslated region followed by 1530-bp of coding region and 700 bp of 3'-untranslated region preceding a poly(A) tail. The porcine cDNA displayed coding regions corresponding to the known tryptic peptides and a 35-amino acid leader sequence involved in targeting of the protein to the mitochondria. The human lipoamide dehydrogenase cDNA is 96% identical to the porcine at the amino acid level. Alignment of the deduced amino acid sequence of human lipoamide dehydrogenase with human erythrocyte glutathione reductase and mercuric reductase from Tn501 revealed extensive homologies throughout the primary sequence, suggesting that secondary and tertiary structure is also similar among these three enzymes.     

Single-nucleotide polymorphisms in porcine mannan-binding lectin A

The MBL1 and MBL2 genes encode mannan-binding lectins (MBL) A and C, respectively, that are collagenous lectins (collectins) produced mainly by the liver. Several single-nucleotide polymorphisms (SNPs) in the human MBL2 gene are responsible for various innate immune dysfunctions due to abnormal structure or expression of human MBL-C. The MBL1 gene encodes MBL-A, which has bacteria-binding properties in pigs and rodents but is mutated to a pseudogene in humans and chimpanzees. In these studies, we surveyed both porcine MBL genes for SNPs that might impair disease resistance. Single-strand conformational polymorphism (SSCP) analysis of MBL cDNAs from porcine liver revealed three SNPs within the coding region of MBL1 in various breeds of pigs. One nonsynonymous SNP that substituted cysteine for glycine in the collagen-like domain of pig MBL-A was found by a multiplex PCR test in all European pig breeds examined, with allele frequencies ranging from 1.4 to 46.4%. No SNPs were identified in the coding region of porcine MBL2 but the expression of MBL-C in the liver was widely variable in comparison to the expression of MBL-A, GAPDH, PigMAP, and haptoglobin. These results indicate that some pigs have a miscoding defect in MBL-A and a possible expression defect in MBL-C, which are analogous to coding and promoter polymorphisms that affect human MBL-C.     

The baboon gene for apolipoprotein A-I: characterization of a cDNA clone and identification of DNA polymorphisms for genetic studies of cholesterol metabolism

We have isolated and sequenced a baboon apolipoprotein A-I (ApoA-I) clone from a liver cDNA library using a human cDNA hybridization probe. This baboon cDNA contains the entire ApoA-I coding region (801 bp, 267 aa), a 3' untranslated region, and a poly(A)tail. Among comparisons with apoAI sequences from other species, the baboon cDNA is most similar to that of the cynomolgus macaque (99.2% homologous) and least similar to the rat sequence (72.6% homologous). A high frequency of nonsynonymous substitutions are observed by alignment of baboon and human apoAI cDNAs, but comparisons of hydrophilicity profiles show that protein structure is conserved by substitutions of aa with similar properties. A polymorphic PstI cleavage site was identified by Southern blot analysis and subsequently mapped to the 5' end of the baboon apoAI gene. To identify effects of apoAI allelic variation on cholesterol metabolism, we used immunoblotting to compare the distributions of ApoA-I among lipoprotein size classes in baboons from each genotype under basal and atherogenic diets. We observed an increase of ApoA-I in high density lipoprotein (size class 1) particles after atherogenic diets in homozygotes for one allele, as compared to slight decreases in the other genotypes.     

The cDNA and protein sequences of mouse lactate dehydrogenase B. Molecular evolution of vertebrate lactate dehydrogenase genes A (muscle), B (heart) and C (testis)

Mouse lactate dehydrogenase-B cDNAs were isolated from cDNA libraries of macrophage (ICR strain) and thymus (F1 hybrid of C57BL/6 and CBA strains), and their nucleotide sequences determined. The lactate dehydrogenase-B cDNA insert of thymus clone mB188 consists of the protein-coding sequence (1002 nucleotides), the 5' (46 nucleotides) and 3' (190 nucleotides) non-coding regions, and poly(A) tail (19 nucleotides), while macrophage clone mB168 contains a partial lactate dehydrogenase cDNA insert from codon no. 55 to the poly(A) tail. Seven silent nucleotide substitutions at codon no. 142, 143, 186, 187, 241, 285 and 292, as well as a single nucleotide change in the 3' non-coding region, were found between these different strains of mice. The predicted sequence of 333 amino acids, excluding initiation methionine, was confirmed by sequencing and/or compositional analyses of a total of 103 (31%) amino acids from tryptic peptides of mouse lactate dehydrogenase-B protein. The nucleotide sequence of the mouse coding region for lactate dehydrogenase B shows 86% identity with that of the human isoenzyme, and only eight of the 139 nucleotide differences resulted in amino acid substitutions at residues 10, 13, 14, 17, 52, 132, 236 and 317. The rates of nucleotide substitutions at synonymous and nonsynonymous sites in the mammalian lactate dehydrogenase genes are calculated. The rates of synonymous substitutions for lactate dehydrogenase genes A (muscle) and B (heart) are considerably higher than the average rate computed from human and rodent genes. The rates of nonsynonymous substitutions for lactate dehydrogenase genes A (muscle) and B (heart), particularly the latter, are highly conservative. The rates of synonymous and nonsynonymous substitutions for the lactate dehydrogenase-C gene are about the same as the average rates for mammalian genes. A phylogenetic tree of vertebrate lactate dehydrogenase protein sequences is constructed. In agreement with the previous results, this analysis further indicates that lactate dehydrogenase-C gene branched off earlier than did lactate dehydrogenase-A and lactate dehydrogenase-B genes.     

Characterization of porcine autism susceptibility candidate 2 as a candidate gene for the number of corpora lutea in pigs

In a previous study, we mapped two quantitative trait loci (QTL) approximately 50cM apart, both influencing the number of corpora lutea in pigs on chromosome 3. One locus included functional candidate genes for proteins related to specific aspects of fertility, such as the follicle-stimulating hormone receptor and the luteinizing hormone/choriogonadotropin receptor. However, specific genes related to the second locus have not yet been identified. This study aims to identify another candidate gene influencing the number of corpora lutea in pigs. Using 12 polymorphic markers, we fine-mapped a narrow region of pig chromosome 3 that had been shown to contain a QTL for corpora lutea. In the critical region, only 1 gene, autism susceptibility candidate 2 (AUTS2), was identified as a positional candidate. Our results demonstrate that the porcine AUTS2 gene consists of 19 exons with a complete open reading frame of 3768bp encoding an AUTS2 protein of 1256 amino acids. We screened the whole coding sequence and parts of the untranslated region for polymorphisms in an F(2) population of Duroc×Meishan crosses. We found 1 ins/del and 7 single nucleotide polymorphisms (SNP), including 2 nonsynonymous variants, c.943C>T in exon 7 and c.2828C>T in exon 19, resulting in P315S and A943V, respectively. The SNP c.943C>T within a proline-rich domain was genotyped in several breeds; the C allele occurred in all breeds, whereas the T allele occurred only in Meishan pigs. Using in situ hybridization, the mRNA expression of the AUTS2 gene was observed on granulosa cells in the porcine ovary and thus may be associated with hormone sensitivity.     

Genomic organization and polymorphisms detected by denaturing high-performance liquid chromatography of porcine SLC11A1 gene.

SLC11A1 (also known as Natural Resistance Associated Macrophage Protein1, NRAMP1) plays a crucial role in resistance of inbred mice to infection with several intracellular pathogens such as Mycobacterium, Leishmania and Salmonella. In this study, PCR amplification and sequencing were performed to obtain the genomic organization and sequence of porcine SLC11A1 gene by comparative genomic analysis. Results showed that porcine SLC11A1 gene consists of 15 exons and 14 introns, which is consistent with that of mice and human. All introns were sequenced and their nucleotide sequences were submitted to GenBank. The exon/intron boundaries were determined by comparing cDNA sequence with amplified genomic DNA sequences. Mutational analysis was performed on exonic and neighboring intronic region by denaturing high-performance liquid chromatography (DHPLC) and sequencing confirmation. Forty polymorphisms were identified; six are located in exons and thirty-four in introns. Two exonic polymorphisms are nonsynonymous changes (D6H and V175I), three are synonymous changes (S23, G33 and I155), and one is in 3' UTR. The availability of the fine genomic organization and identification of the polymorphisms will facilitate the evaluation of porcine SLC11A1 functional role in diseases resistance or susceptibility.     

Identification by sequence analysis of a second rat brain cDNA encoding the dopamine (D2) receptor

A rat brain cDNA library constructed in lambda ZAP II was screened with three oligonucleotide probes based on the reported coding region of the D2 receptor gene, RGB-2. A complete cDNA clone, D2(8)-1, showing positive signals with the three probes was subsequently identified by restriction analysis and dideoxy sequence analysis to be a variant of the RGB-2 gene. Comparison of the two genes revealed almost complete homology except that D2(8)-1 contains an 87 bp insert within the protein coding region and 265 additional nucleotides 5' upstream from the 5' end reported for RGB-2. It is suggested that at least two mRNA species encoding for D2 receptors exist in rat brain, possibly resulting from alternative splicing of RNA.     

Direct immunological identification of full-length cDNA clones for plant protein without gene fusion to E. coli protein

By immunological screening of a cDNA library constructed from potato tuber poly(A)+ RNA and Escherichia coli expression vector pUC8 by the vector-primer and linker procedure of Okayama and Berg [(1982) Mol. Cell Biol. 2, 161-170], nearly full-length cDNA clones for patatin, a major protein of potato tuber, were identified. The cDNA carrying part of the 5'-noncoding region of the patatin mRNA, in addition to entire coding and 3'-noncoding regions, expressed prepatatin in E. coli cells by translational initiation inside cDNA. These results suggest that nearly full-length cDNA clones with entire coding region can be identified directly by immunological screening without gene fusion to E. coli proteins at least for some plant mRNAs.     

Cloning, mapping and association study with carcass traits of the porcine SDHD gene

A 1320-bp cDNA containing the full coding region of the porcine succinate dehydrogenase complex, subunit D (SDHD) gene was obtained by random sequencing of clones from a Chinese Tongcheng pig 55-day fetal longissimus dorsi muscle cDNA library. Analysis of the SDHD gene across the INRA-University of Minnesota porcine radiation hybrid panel indicated close linkage with microsatellite marker SW2401, located on SSC9p21. The open reading frame of this cDNA covers 480 bp and encodes 159 amino acids. The deduced porcine amino acid sequence showed greater similarity with human and bovine protein sequences than with those from mouse and rat. The BLAST analysis of the porcine SDHD to NCBI identified Unigene Cluster Ssc.2586. Possible single nucleotide polymorphisms (SNP) were identified by alignment of expressed sequence tags in the cluster. The polymerase chain reaction (PCR) single strand conformation polymorphism, sequencing, and PCR restriction fragment length polymorphism were used to confirm and detect a synonymous polymorphic MboI site within the open-reading frame. Allele frequencies of this SNP were investigated in two commercial and five Chinese local pig breeds. These five Chinese breeds had very high frequencies for one allele, whereas frequencies of both alleles were intermediate in Large White and Duroc. An association analysis suggested that different SDHD genotypes have significant differences in loin-muscle area (P < 0.01).     

Characterization of a mouse interferon gene locus I. Isolation of a cluster of four alpha interferon genes.

A BALB/c mouse genomic library was screened with a murine interferon alpha 2 (MuIFN-alpha 2) cDNA coding region fragment. Eight clones were isolated which contain different mouse chromosomal segments related to the MuIFN-alpha 2 probe and a 28 kilobase (kb) region of mouse genomic DNA containing four different MuIFN-alpha genes (alpha 1, alpha 4, alpha 5 and alpha 6) was identified and characterized; an intergenic 1000 nucleotide long conserved sequence was found to be associated with three of these four alpha genes, indicating that this alpha-IFN gene cluster evolved through tandem duplications. Sequence analysis revealed the absence of a polyadenylation site in the 3' untranslated region of MuIFN-alpha 1, and showed that one of the genes (alpha 4) contains an internal deletion of 5 amino acids in the coding region.     

Characterization of the cDNA coding for mouse plasminogen and localization of the gene to mouse chromosome 17

A full-length cDNA coding for mouse plasminogen has been isolated and characterized. The cDNA is 2720 bp in length (excluding the poly(A) tail) and contains a 24-bp 5' noncoding region, an open reading frame of 2436 bp, and a 3' noncoding region of 257 bp. The open reading frame codes for 812 amino acids and includes a signal peptide that is likely 19 amino acids in length and the mature protein of 793 amino acids. The calculated Mr of mouse plasminogen is 88,706 excluding carbohydrate. There are two potential N-linked carbohydrate addition sites; one of which is glycosylated in human, bovine, and porcine plasminogens. Mouse plasminogen was found to contain two additional amino acids compared to the human protein. In addition, mouse and human plasminogens were found to be 79 and 76% identical at the protein and DNA levels, respectively. Analysis of the segregation of two allelic forms, Plgb and Plgd, of plasminogen DNA in three sets of recombinant inbred strains has allowed the localization of the mouse plasminogen gene to the proximal end of mouse chromosome 17 within the t complex and close to the locus D17Rp17. The Plg gene is deleted in the semidominant deletion mutant, hair-pintail (Thp).     

Cloning and characterization of porcine insulin gene

The complete porcine preproinsulin cDNA and 1022 bp of its 5'-flanking region have been cloned by PCR-based technology and characterized. The porcine insulin gene has the same structure of three exons and two introns as that found in all insulin genes sequenced to date. Northern blot analysis of isolated adult porcine islets demonstrated an increase in steady-state insulin mRNA levels in response to high concentrations of glucose. Highly conserved cis-acting elements were found in the 5'-flanking region of the porcine insulin gene including multiple E and A elements as well as a cAMP responsive element (CRE). Tissue-specific activity of the proximal promoter was confirmed by transient transfection of the promoter/reporter gene constructs. This information now makes it possible for regulation and expression of the porcine insulin gene to be analyzed.     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.