Genetic determinants of the synthesis of the polysaccharide capsular antigen K27(A) of Escherichia coli.

Most of the his+ hybrids from crosses between the Escherichia coli donor Hfr45(O8:K27) and different E. coli O9 recipients expressed the donor O8 antigen specificity and produced the capsular antigen K27. Therefore these hybrids must have inherited the his-linked donor rfb region determining the synthesis of O8- specific polysaccharides as well as his-linked genes involved in K27 antigen synthesis. In the living state these hybrids were inagglutinable in O8 antiserum like the donor cells. However, when E. coli K12 and O8:K42- were used as recipients most of the his+ hybrids were agglutinable in O8 and K27 antisera. The amounts of K27 antigen present in these hybrids, designated as K27i (intermediate) forms, were sufficient to evoke the production of K27 antibodies in rabbits, but insufficient to inhibit O-agglutination of the respective cells. The additional transfer of the trp region of E. coli O8:K27 into such K27i forms frequently resulted in O-inagglutinable K27+ hybrids. This is attributed to the introduction of trp-linked genes which apparently play a role in the synthesis of K27 capsular antigen. Tus it is concluded that at least two gene loci, one close to his and the other close to trp, are required for the synthesis of the complete capsular antigen K27.     

Transfer and expression of the genetic determinants for O and K antigen synthesis in Escherichia coli O9:K(A)30 and Klebsiella sp. O1:K20, in Escherichia coli K12

Escherichia coli serotype O9:K(A)30 and Klebsiella O1:K20 produce thermostable capsular polysaccharides or K antigens, which are chemically and serologically indistinguishable. Plasmid pULB113 (RP4::mini-Mu) has been used to mediate chromosomal transfer from E. coli O9:K30 and Klebsiella O1:K20 to a multiply marked, unencapsulated, E. coli K12 recipient. Analysis of the cell surface antigens of the transconjugants confirmed previous reports that the genetic determinants for the E. coli K(A) antigens are located near the his and rfb (O antigen) loci on the E. coli linkage map. The Klebsiella K20 capsule genes were also found to be in close proximity to the his and rfb loci. Electron microscopy revealed significant differences in the structural organization of capsular polysaccharides in these two microorganisms and the morphological differences were also readily apparent in transconjugants expressing the respective K antigens. These results are consistent with the interpretation that at least some of the organizational properties of capsular polysaccharides may be genetically determined, rather than being a function of the outer membrane to which the capsular polysaccharides are ultimately attached.     

Chemical and structural analysis of the capsular polysaccharide from Escherichia coli O9:K28(A):H- (K28 antigen)

The structure of the capsular polysaccharide from Escherichia coli O9:K28(A):H- (K28 antigen) has been determined by using the techniques of methylation, periodate oxidation, and partial hydrolysis. N.m.r. spectroscopy (1H and 13C) was used to establish the nature of the anomeric linkages. O-Acetyl groups were determined spectrophotometrically and were located using methyl vinyl ether as a protective reagent. The polysaccharide is comprised of repeating units of the tetrasaccharide shown (three-plus-one type) with 70% of the fucosyl residues carrying an O-acetyl substituent. (formula; see text) This structure resembles that of E. coli K27 and has the structural pattern of Klebsiella K54 polysaccharide.     

Monoclonal antibodies against the capsular K antigen of Escherichia coli (O9:K30(A):H12): characterisation and use in analysis of K antigen organisation on the cell surface

Monoclonal antibodies were produced against the capsular antigen of Escherichia coli serotype K(A)30, using a mouse hybridoma system. The antibodies also recognised the chemically identical capsular polysaccharide produced by Klebsiella K20. Chemical modification of the K30 polysaccharide indicated that the glucuronic acid residues found in the E. coli K30 capsular antigen were important in the epitope recognised by these antibodies. Use of the antibodies as molecular probes revealed the presence of two discrete forms of the K30 antigen. One form was comprised of high molecular weight polysaccharide, present as a surface capsular layer. The second form of the antigen was of low molecular weight and was associated with lipopolysaccharide fractions from cell surface polysaccharide extracts. Separation of lipopolysaccharide fractions using gel chromatography in the presence of detergent showed that the low molecular weight K-antigenic fraction comigrated with a lipopolysaccharide lipid A core fraction present in encapsulated E. coli K30 bacteria but absent in acapsular mutants.     

The Klebsiella aerogenes glutamate dehydrogenase (gdhA) gene: cloning, high-level expression and hybrid enzyme formation in Escherichia coli

Summary The NADP-dependent glutamate dehydrogenase gene of Klebsiella aerogenes was cloned in E. coli in the expression plasmid pRK9. The cloned gene shows a high level of expression in E. coli in the hybrid plasmid pKG3 and such expression is independent of the vector promoter, as shown by experiments in which the promoter was deleted. Active hybrid GDH hexamers were shown in cell-free extracts of an E. coli strain carrying cloned gdhA genes of both E. coli and K. aerogenes. The nucleotide sequence of the N-terminal coding region of the K. aerogenes gdhA gene was determined and found to be strongly homologous with that of E. coli.Abbreviations GDH glutamate dehydrogenase - PMS phenazine methosulphate - MTT 3-(4,5-Dimethylthiazolyl-2)-2,5-diphenyltetrazolium-bromide - PMSF phenylmethylsulphonylfluoride - SSC standard saline citrate - DTT dithiothreitol - bp base pairs - kbp kilo base pairs - dNTP deoxynucleoside triphosphate     

Regulation of nitrogen metabolism in Escherichia coli and Klebsiella aerogenes: studies with the continuous-culture technique.

Ammonia-nitrogen-limited continuous cultures of Escherichia coli and Klebsiella aerogenes contain induced levels of glutamine synthetase that is deadenylyated (i.e., fully active). In the presence of excess ammonia or glutamate in glucose-limited cultures of E. coli, glutamine synthetase is repressed and adenylylated (inactive). The average state of adenylylation (n) is a linear function of the specific growth rate. At low specific growth rates, glutamine synthetase is adenylylated; as the specific growth rate increases, n decreases, approaching 0 to 2 at rapid growth rates. The average state of adenylylation correlates well with the intracellular concentrations and ratios of alpha-ketoglutarate and glutamine, which are key effectors in the adenylylation-deadenylylation systems. E. coli and K. aerogenes differ markedly in their growth yields, growth rates, and enzymatic composition during nitrogen limitation. The data suggest that, unlike K. aerogenes, E. coli W uses glutamate dehydrogenase to incorporate ammonia during nitrogen limitation. In E. coli, glutamate dehydrogenase is progressively induced during nitrogen limitation when mu (growth rate) approaches mumax. In contrast, in K. aerogenes glutamate dehydrogenase is repressed during nitrogen limitation, whereas glutamate synthase, an alternative supplier of glutamate to the cell, is induced. Data are presented that support the regulatory schemes proposed for the control of glutamine synthetase activity by induction-repression phenomena and adenylylation-deadenylylation reaction. We propose that the intracellular ratio of alpha-ketoglutarate to glutamine may be the most important physiological parameter in determining the activity of glutamine synthetase.     

Influence of growth environment on the phosphoenolpyruvate: Glucose phosphotransferase activities of Escherichia coli and Klebsiella aerogenes: A comparative study

A consistent difference was found between glucose-limited cultures of Escherichia coli and Klebsiella aerogenes strains in the manner which their apparent cellular content of glucose: phosphoenolpyruvate phosphotransferase (glucose-PTS) varied with growth rate. With the former strains, activity increased as a function of growth rate; in the latter it decreased. However, under glucose-sufficient conditions (potassium-or ammonia-limitation) both species behaved similarly; the glucose-PTS activity was lower and bore no obvious relationship to the rate of glucose consumption expressed by the growing culture. These results are discussed in relation to the role of glucose as a regulator of glucose-PTS synthesis, and to the likely contribution which the glucose-PTS makes to the overall rate of glucose uptake, particularly by cells growing in glucose-sufficient environments.Abbreviation Glucose-PTS phosphoenolpyruvate phosphotransferase From May to November 1978 on study leave in the University of Amsterdam     

The beta-glucoside genes of Klebsiella aerogenes: conservation and divergence in relation to the cryptic bgl genes of Escherichia coli

The ability to metabolize aromatic beta-glucosides such as salicin and arbutin varies among members of the Enterobacteriaceae. The ability of Escherichia coli to degrade salicin and arbutin appears to be cryptic, subject to activation of the bgl genes, whereas many members of the Klebsiella genus can metabolize these sugars. We have examined the genetic basis for beta-glucoside utilization in Klebsiella aerogenes. The Klebsiella equivalents of bglG, bglB and bglR have been cloned using the genome sequence database of Klebsiella pneumoniae. Nucleotide sequencing shows that the K. aerogenes bgl genes show substantial similarities to the E. coli counterparts. The K. aerogenes bgl genes in multiple copies can also complement E. coli mutants deficient in bglG encoding the antiterminator and bglB encoding the phospho-beta-glucosidase, suggesting that they are functional homologues. The regulatory region bglR of K. aerogenes shows a high degree of similarity of the sequences involved in BglG-mediated regulation. Interestingly, the regions corresponding to the negative elements present in the E. coli regulatory region show substantial divergence in K. aerogenes. The possible evolutionary implications of the results are discussed.     

Identification of the GDP-N-acetyl-d-perosamine producing enzymes from Escherichia coli O157:H7

GDP-N-acetyl-d-perosamine is a precursor of the LPS-O-antigen biosynthesis in Escherichia coli O157:H7. Like other GDP-6-deoxyhexoses, GDP-N-acetyl-d-perosamine is supposed to be synthesized via GDP-4-keto-6-deoxy-d-mannose, followed by a transamination- and an acetylation-reaction catalyzed by PerA and PerB. In this study, we have overproduced and purified PerA and PerB from E. coli O157:H7 in E. coli BL21. The recombinant proteins were partly characterized and the final product of the reaction catalyzed by PerB was shown to be GDP-N-acetyl-d-perosamine by chromatography, mass spectrometry, and 1H-NMR. The functional expression of PerB provides another enzymatically defined pathway for the synthesis of GDP-deoxyhexoses, which is needed to further study the corresponding glycosyltransferases in vitro.     

Frequency of Escherichia coli O157:H7 isolation from stool specimens

During a 6-month period, 7252 faeces specimens were examined for Escherichia coli serotype O157:H7. Forty-nine specimens (0.7%) from 19 patients yielded this organism. Escherichia coli O157:H7 was the third most frequently isolated bacterial pathogen, following Campylobacter jejuni and (or) Salmonella sp. Although regional variation between laboratories determined whether Campylobacter jejuni or Salmonella was the primary bacterial pathogen isolated, E. coli O157:H7 was consistently isolated more frequently than either Shigella or Yersinia enterocolitica.     

Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.