Structural dynamics of archaeal small heat shock proteins

Small heat shock proteins (sHsps) are a widespread and diverse class of molecular chaperones. In vivo, sHsps contribute to thermotolerance. Recent evidence suggests that their function in the cellular chaperone network is to maintain protein homeostasis by complexing a variety of non-native proteins. One of the most characteristic features of sHsps is their organization into large, sphere-like structures commonly consisting of 12 or 24 subunits. Here, we investigated the functional and structural properties of Hsp20.2, an sHsp from Archaeoglobus fulgidus, in comparison to its relative, Hsp16.5 from Methanocaldococcus jannaschii. Hsp20.2 is active in suppressing the aggregation of different model substrates at physiological and heat-stress temperatures. Electron microscopy showed that Hsp20.2 forms two distinct types of octahedral oligomers of slightly different sizes, indicating certain structural flexibility of the oligomeric assembly. By three-dimensional analysis of electron microscopic images of negatively stained specimens, we were able to reconstitute 3D models of the assemblies at a resolution of 19 Å. Under conditions of heat stress, the distribution of the structurally different Hsp20.2 assemblies changed, and this change was correlated with an increased chaperone activity. In analogy to Hsp20.2, Hsp16.5 oligomers displayed structural dynamics and exhibited increased chaperone activity under conditions of heat stress. Thus, temperature-induced conformational regulation of the activity of sHsps may be a general phenomenon in thermophilic archaea.     

Differential expression of two small Hsps during diapause in the corn stalk borer Sesamia nonagrioides (Lef.)

We isolated and characterized two members of the α-crystallin/sHsp family, SnoHsp19.5 and SnoHsp20.8 from Sesamia nonagrioides (Lepidoptera: Noctuidae). The cDNAs encoded proteins of 174 and 185 amino acids, with calculated molecular weights of 19.5 and 20.8 kDa, respectively. The deduced amino acid sequences of SnoHsp19.5 and SnoHsp20.8 showed highest homology to Hsp19.7 of Mamestra brassicae and to Bombyx mori Hsp20.4, respectively. Expression patterns of SnoHsp19.5 and SnoHsp20.8 in non-diapausing individuals under different environmental conditions (heat or cold) showed different accumulation profiles for the two genes after heat and cold treatment. SnoHsp19.5 was consistently expressed, while SnoHsp20.8 gene was down-regulated in deep diapause and was up-regulated at the termination of diapause. Our results suggest that these two genes play distinctive roles in the regulation of diapause.     

Expression and interaction of small heat shock proteins (sHsps) in rice in response to heat stress

The inherent immobility of rice (Oryza sativa L.) limited their abilities to avoid heat stress and required them to contend with heat stress through innate defense abilities in which heat shock proteins played important roles. In this study, Hsp26.7, Hsp23.2, Hsp17.9A, Hsp17.4 and Hsp16.9A were up-regulated in Nipponbare during seedling and anthesis stages in response to heat stress. Subsequently, the expressing levels of these five sHsps in the heat-tolerant rice cultivar, Co39, were all significantly higher than that in the heat-susceptible rice cultivar, Azucena. This indicated that the expressive level of these five sHsps was positively related to the ability of rice plants to avoid heat stress. Thus, the expression level of these five sHsps can be regarded as bio-markers for screening rice cultivars with different abilities to avoid heat stress. Hsp18.1, Hsp17.9A, Hsp17.7 and Hsp16.9A, in the three rice cultivars under heat stress were found to be involved in one protein complex by Native-PAGE, and the interactions of Hsp18.1 and Hsp 17.7, Hsp18.1 and Hsp 17.9A, and Hsp17.7 and Hsp16.9A were further validated by yeast 2-hybridization. Pull down assay also confirmed the interaction between Hsp17.7 and Hsp16.9A in rice under heat stress. In conclusion, the up-regulation of the 5 sHsps is a key step for rice to tolerate heat stress, after that some sHsps assembled into a large hetero-oligomeric complex. In addition, through protein–protein interaction, Hsp101 regulated thiamine biosynthesis, and Hsp82 homology affected nitrogen metabolism, while Hsp81-1 were involved in the maintenance of sugar or starch synthesis in rice plants under heat stress. These results provide new insight into the regulatory mechanism of sHsps in rice.     

Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.     

Inhibitors of Eicosanoid Biosynthesis Influencing the Transcripts Level of sHSP21.4 Gene Induced by Pathogen Infections,in Antheraea pernyi

Small heat shock proteins (sHSPs) can regulate protein folding and protect cells from stress. To investigate the role of sHSPs in the silk-producing insect Antheraea pernyi response to microorganisms, a sHsp gene termed as Ap-sHSP21.4, was identified. This gene encoded a 21.4 kDa protein which shares the conserved structure of insect sHsps and belongs to sHSP21.4 family. Ap-sHSP21.4 was highly expressed in fat body and up-regulated in midgut and fat body of A. pernyi challenged with Escherichia coli, Beauveria bassiana and nuclear polyhedrosis virus (NPV), which was determined by quantitative real-time PCR. Meanwhile, knock down of Ap-sHSP21.4 with dsRNA result in the decrease at the expression levels of several immune response-related genes (defensin, Dopa decarboxylase, Toll1, lysozyme and Kazal-type serine protease inhibitor). Additionally, the impact of eicosanoid biosynthesis on the expression of Ap-sHSP21.4 response to NPV was determined using qPCR, inhibitors of eicosanoid biosynthesis significantly suppress Ap-HSP21.4 expression upon NPV challenge. All together, Ap-sHSP21.4 was involved in the immunity of A. pernyi against microorganism and possibly mediated by eicosanoids pathway. These results will shed light in the understanding of the pathogen-host interaction in A. pernyi.     

Identification of five small heat shock protein genes in Spodoptera frugiperda and expression analysis in response to different environmental stressors

Spodoptera frugiperda (J. E. Smith) is a highly adaptable polyphagous migratory pest in tropical and subtropical regions. Small heat shock proteins (sHsps) are molecular chaperones that play important roles in the adaptation to various environment stressors. The present study aimed to clarify the response mechanisms of S. frugiperda to various environmental stressors. We obtained five S. furcifera sHsp genes (SfsHsp21.3, SfsHsp20, SfsHsp20.1, SfsHsp19.3, and SfsHsp29) via cloning. The putative proteins encoded by these genes contained a typical α-crystallin domain. The expression patterns of these genes during different developmental stages, in various tissues of male and female adults, as well as in response to extreme temperatures and UV-A stress were studied via real-time quantitative polymerase chain reaction. The results showed that the expression levels of all five SfsHsp genes differed among the developmental stages as well as among the different tissues of male and female adults. The expression levels of most SfsHsp genes under extreme temperatures and UV-A-induced stress were significantly upregulated in both male and female adults. In contrast, those of SfsHsp20.1 and SfsHsp19.3 were significantly downregulated under cold stress in male adults. Therefore, the different SfsHsp genes of S. frugiperda play unique regulatory roles during development as well as in response to various environmental stressors.     

A novel small heat shock protein of <Emphasis Type="Italic">Haliotis discus hannai</Emphasis>: characterization,structure modeling,and expression profiles under environmental stresses

Small heat shock proteins (sHsps) are a class of chaperones with low molecular weight, feathered by a C-terminal α-crystallin domain (ACD). They participate in reestablishing the stability of partially denatured proteins and therefore contribute to cellular homeostasis. In this work, we identified a sHsp homolog (designated as sHsp19) from Haliotis discus hannai, an economically important farmed mollusk in East Asia. sHsp19 possesses a sHsp hallmark domain, which exhibits the typical fold of ACD as revealed by a three-dimensional model constructed through an iterative threading assembly refinement method. The amino acid sequence sHsp19 shares low identities with any other known sHsps, with percentages below 35 %. Besides, sHsp19 shows relatively distant phylogenetic relationships with sHsps of various mollusks, including two other identified sHsps of abalone subspecies. qRT-PCR analysis indicated that the expression of sHsp19 occurred in multiple tissues. Upon exposure to thermal, oxidative, and multiple toxic metal stresses, the level of sHsp19 mRNA was rapidly elevated in a persistent fashion, with the maximum increase up to 170.58-, 405.84-, and 361.96-fold, respectively. These results indicate sHsp is a novel sHsp that possesses the distinguishing structural feature of sHsps but has remote homologies with known sHsps. It is likely to be important in stress adaptation of abalone and may be applied as a bioindicator for monitoring pollution or detrimental changes of environment in abalone culture.     

Involvement of small heat shock proteins,trehalose, and lipids in the thermal stress management in <Emphasis Type="Italic">Schizosaccharomyces pombe</Emphasis>

Changes in the levels of three structurally and functionally different important thermoprotectant molecules, namely small heat shock proteins (sHsps), trehalose, and lipids, have been investigated upon heat shock in Schizosaccharomyces pombe. Both α-crystallin-type sHsps (Hsp15.8 and Hsp16) were induced after prolonged high-temperature treatment but with different kinetic profiles. The shsp null mutants display a weak, but significant, heat sensitivity indicating their importance in the thermal stress management. The heat induction of sHsps is different in wild type and in highly heat-sensitive trehalose-deficient (tps1Δ) cells; however, trehalose level did not show significant alteration in shsp mutants. The altered timing of trehalose accumulation and induction of sHsps suggest that the disaccharide might provide protection at the early stage of the heat stress while elevated amount of sHsps are required at the later phase. The cellular lipid compositions of two different temperature-adapted wild-type S. pombe cells are also altered according to the rule of homeoviscous adaptation, indicating their crucial role in adapting to the environmental temperature changes. Both Hsp15.8 and Hsp16 are able to bind to different lipids isolated from S. pombe, whose interaction might provide a powerful protection against heat-induced damages of the membranes. Our data suggest that all the three investigated thermoprotectant macromolecules play a pivotal role during the thermal stress management in the fission yeast.     

Overexpression of heat shock protein gene PfHSP21.4 in Arabidopsis thaliana enhances heat tolerance

Nuclear-encoded chloroplast small heat shock proteins (Cp-sHSPs) play important roles in plant stress tolerance due to their abundance and diversity. Their functions in Primula under heat treatment are poorly characterized. Here, expression analysis showed that the Primula Cp-sHSP gene, PfHSP21.4, was highly induced by heat stress in all vegetative and generative tissues in addition to constitutive expression in certain development stages. PfHSP21.4 was introduced into Arabidopsis, and its function was analysed in transgenic plants. Under heat stress, the PfHSP21.4 transgenic plants showed increased heat tolerance as shown by preservation of hypocotyl elongation, membrane integrity, chlorophyll content and photosystem II activity (Fv/Fm), increased seedling survival and increase in proline content. Alleviation of oxidative damage was associated with increased activity of superoxide dismutase and peroxidase. In addition, the induced expression of HSP101, HSP70, ascorbate peroxidase and Δ1-pyrroline-5-carboxylate synthase under heat stress was more pronounced in transgenic plants than in wild-type plants. These results support the positive role of PfHSP21.4 in response to heat stress in plants.     

A chymotrypsin-like serine protease cDNA involved in food protein digestion in the common cutworm, Spodoptera litura: Cloning, characterization, developmental and induced expression patterns, and localization

A full-length cDNA (Slctlp2) encoding a chymotrypsin-like serine protease was cloned from Spodoptera litura. This cDNA encoded a putative serine protease with a predicted molecular mass of 30.6 kDa, which contained a serine protease catalytic motif GDSGGPL. Temporal and spatial expression of Slctlp2 mRNA and protein detected by Northern blotting, RT-PCR, qPCR and Western blotting analyses revealed that both Slctlp2 mRNA and protein were mainly present in the foregut and midgut of the 5th and 6th instar larvae during the feeding stages. In situ hybridization and immunohistochemistry confirmed that both Slctlp2 mRNA and protein were predominately present in the midgut. Expression of the gene was not induced by bacterial infection. Juvenile hormone III induced the gene expression, while 20-hydroxyecdysone had no impact on the expression. The expression of Slctlp2 mRNA and protein was down-regulated by starvation but up-regulated by re-feeding. The SlCTLP2 protein was detected in the lumen residues of the anterior, middle and posterior midgut and feces of the feeding 6th instar larvae, suggesting that it was secreted from the epithelium into the lumen of the gut. The results suggest that this Slctlp2 gene may be involved in digestive process of food proteins during the feeding stages of the larval development.     

Toxic Effect of Destruxin A on Abnormal Wing Disc-Like (SLAWD) in Spodoptera litura Fabricius (Lepidoptera: Noctuidae)

Background

Destruxin A (DA) is a microbial insecticide with potent bioactivity against Spodoptera litura larvae. A previous proteomic analysis of S. litura (SL-1) cells exposed to DA showed the abnormal expression of wing disc-like protein of S. litura (SLAWD). To further understand the effect of DA on SLAWD expression, a functional study was carried out.

Principal Findings

The SLAWD gene (SLAWD) was cloned and an open reading frame of 537 bp encoding a polypeptide of 178 amino acids was detected. Real-time fluorescence quantitative PCR (qRT-PCR) suggested that SLAWD is expressed in all developmental stages of S. litura, but expression was highest during the pupal and adult stages. RNAi knockdown of SLAWD expression in 6th-stage larvae was achieved by the microinjection of a specific double-stranded RNA (dsRNA). The results showed a significant decrease in SLAWD mRNA expression levels between the prepupal and adult stages. Interestingly, SLAWD expression was similarly down-regulated by treating 6th-stage larvae with DA. Growth- and development-related statistics confirmed the observed abnormalities in S. litura development after either RNAi or DA treatment.

Conclusions

SLAWD appears to have a biosynthetic function in the pupal and adult stages of S. litura. The toxic effect of DA on S. litura development is due the negative effect of DA on SLAWD gene expression.     

Proteome analysis on differentially expressed proteins of the fat body of two silkworm breeds, Bombyx mori, exposed to heat shock exposure

Proteomes of heat tolerant (multivoltine) and heat susceptible (bivoltine) silkworms (Bombyx mori) in response to heat shock were studied. Detected proteins from fat body were identified by using MALDI-TOF/TOF spectrometer, MS/MS, and MS analysis. Eight proteins, including small heat shock proteins (sHSPs) and HSP70, were expressed similarly in both breeds, while 4 protein spots were expressed specifically in the bivoltine breed and 12 protein spots were expressed specifically in the multivoltine breed. In the present proteomics approach, 5 separate spots of sHSP proteins (HSP19.9, HSP20.1, HSP20.4, HSP20.8, and HSP21.4) were identified. Protein spot intensity of sHSPs was lower in the multivoltine breed than in the bivoltine breed after the 45°C heat shock treatment, while the difference between two breeds was not significant after the 41°C heat shock treatment. These results indicated that some other mechanisms might be engaged in thermal tolerance of multivotine breed except for the expression of sHSP and HSP70. There were visible differences in the intensity of heat shock protein expression between male and female, however, differences were not statistically significant.     

Molecular characterization and expression pattern of Spodoptera litura (Lepidoptera: Noctuidae) vitellogenin, and its response to lead stress

Vitellogenin (Vg) cDNA from Spodoptera litura Fabricius was cloned and sequenced. The open reading frame (ORF) of Vg cDNA was 5247 nucleotides in length (GenBank Accession no. EU095334), which encoded for a protein of 1748 amino acids. S. litura Vg comprised three conserved regions (Vitellogenin-N domain, DUF1943 and von Willebrand factor type D domain (VWD)), a 17 amino-acid signal peptide and a RXXR cleavage signal (RTIR). The highly conserved GL/ICG motif, the DGXR motif and cysteine residues were found in the C-terminus of the Vg. Vg mRNA was found specifically in the female fat body. Vg expression was first transcribed in 6th day female pupae and levels increased with insect development. The maximum level of Vg mRNA appeared in 24-h-old adults. When S. litura larvae were exposed to lead (Pb) (25-200 mg Pb/kg), there was a significant inhibition in Vg of female adults. The start of Vg expression was advanced ahead by Pb, from 6th day pupae to 3rd day or 4th day pupae. Low levels of Vg in male adults were also induced by low concentrations of Pb (12.5 and 25 mg Pb/kg). These data show that Pb stress elicits an important Vg response in S. litura.     

Structure and expression of glutathione S-transferase genes from the midgut of the Common cutworm, Spodoptera litura (Noctuidae) and their response to xenobiotic compounds and bacteria

Glutathione S-transferases (GSTs) play a pivotal role in detoxifying endogenous and xenobiotic compounds and oxidative stress resistance in cells. In this study, five GST genes, including three Sigma GSTs (SlGSTs1, SlGSTs2, and SlGSTs3), one Omega GST (SlGSTo1) and one un-classified GST (SlGSTu1) were identified from the midgut of the Common cutworm, Spodoptera litura. Structure analyses of the eight (including the previously identified Epsilon GST genes, SlGSTe1, SlGSTe2 and SlGSTe3 from the same insect) SlGSTs genes showed that the Epsilon SlGSTe genes do not contain any intron, while the Sigma SlGSTs contain three introns and the Omega SlGSTo1 and the un-classified SlGSTu1 contain five introns. Analysis of the spatial and temporal expression of these eight SlGSTs indicated that SlGSTe1, SlGSTs2 and SlGSTo1 expressed in all stages of development from the egg to the adult stages. SlGSTe2, SlGSTe3, SlGSTs1, SlGSTs3 and SlGSTu1 had higher expression levels in the larval stages than in other stages and their expression levels in the midgut were higher than in other tissues. SlGSTs1 was expressed in the larval midgut but not in the fat body and could be induced by bacterial infections. The expression of SlGSTe1, SlGSTe3, SlGSTs1 and SlGSTs3 was increased by chlorpyrifos to various degrees, while the expression of SlGSTe1, SlGSTe3, SlGSTs1, SlGSTs3 and SlGSTo1 was increased by xanthotoxin. Levels of malonaldehyde, an indicator of oxidative stress, were higher in the larval midgut than in the pupal midgut. Chlorpyrifos induced the malonaldehyde content in the larvae, whereas xanthotoxin did not. It is hypothesized that high expression levels of the midgut SlGSTs might be due to the increased levels of oxidative stress caused by feeding, bacterial infection and xenobiotic compounds.     

Biocontrol Potential of Steinernema thermophilum and Its Symbiont Xenorhabdus indica Against Lepidopteran Pests: Virulence to Egg and Larval Stages

Under laboratory conditions, the biocontrol potential of Steinernema thermophilum was tested against eggs and larval stages of two important lepidopteran insect pests, Helicoverpa armigera and Spodoptera litura (polyphagous pests), as well as Galleria mellonella (used as a model host). In terms of host susceptibility of lepidopteran larvae to S. thermophilum, based on the LC₅₀ 36 hr after treatment, G. mellonella (LC₅₀ = 16.28 IJ/larva) was found to be more susceptible than S. litura (LC₅₀ = 85 IJ/larva), whereas neither host was found to be significantly different from H. armigera (LC₅₀ = 54.68 IJ/larva). In addition to virulence to the larval stages, ovicidal activity up to 84% was observed at 200 IJ/50 and 100 eggs of H. armigera and S. litura, respectively. To our knowledge this is the first report of entomopathogenic nematode pathogenicity to lepidopteran eggs. Production of infective juvenile (IJ) nematodes/insect larva was also measured and found to be positively correlated with rate of IJ for H. armigera (r = 0.990), S. litura (r = 0.892), as well as G. mellonella (r = 0.834). Both Phase I and Phase II of symbiotic bacteria Xenorhabdus indica were tested separately against neonates of H. armigera and S. litura by feeding assays and found to be virulent to the target pests; phase variation did not affect the level of virulence. Thus S. thermophilum as well as the nematode’s symbiotic bacteria applied separately have the potential to be developed as biocontrol agents for key lepidopteran pests.     

Wrapping the alpha-crystallin domain fold in a chaperone assembly

Small heat shock proteins (sHsps) are oligomers that perform a protective function by binding denatured proteins. Although ubiquitous, they are of variable sequence except for a C-terminal approximately 90-residue "alpha-crystallin domain". Unlike larger stress response chaperones, sHsps are ATP-independent and generally form polydisperse assemblies. One proposed mechanism of action involves these assemblies breaking into smaller subunits in response to stress, before binding unfolding substrate and reforming into larger complexes. Two previously solved non-metazoan sHsp multimers are built from dimers formed by domain swapping between the alpha-crystallin domains, adding to evidence that the smaller subunits are dimers. Here, the 2.5A resolution structure of an sHsp from the parasitic flatworm Taenia saginata Tsp36, the first metazoan crystal structure, shows a new mode of dimerization involving N-terminal regions, which differs from that seen for non-metazoan sHsps. Sequence differences in the alpha-crystallin domains between metazoans and non-metazoans are critical to the different mechanism of dimerization, suggesting that some structural features seen for Tsp36 may be generalized to other metazoan sHsps. The structure also indicates scope for flexible assembly of subunits, supporting the proposed process of oligomer breakdown, substrate binding and reassembly as the chaperone mechanism. It further shows how sHsps can bind coil and secondary structural elements by wrapping them around the alpha-crystallin domain. The structure also illustrates possible roles for conserved residues associated with disease, and suggests a mechanism for the sHsp-related pathogenicity of some flatworm infections. Tsp36, like other flatworm sHsps, possesses two divergent sHsp repeats per monomer. Together with the two previously solved structures, a total of four alpha-crystallin domain structures are now available, giving a better definition of domain boundaries for sHsps.     

Identification of MicroRNAs in Helicoverpa armigera and Spodoptera litura Based on Deep Sequencing and Homology Analysis

The current identification of microRNAs (miRNAs) in insects is largely dependent on genome sequences. However, the lack of available genome sequences inhibits the identification of miRNAs in various insect species. In this study, we used a miRNA database of the silkworm Bombyx mori as a reference to identify miRNAs in Helicoverpa armigera and Spodoptera litura using deep sequencing and homology analysis. Because all three species belong to the Lepidoptera, the experiment produced reliable results. Our study identified 97 and 91 conserved miRNAs in H. armigera and S. litura, respectively. Using the genome of B. mori and BAC sequences of H. armigera as references, 1 novel miRNA and 8 novel miRNA candidates were identified in H. armigera, and 4 novel miRNA candidates were identified in S. litura. An evolutionary analysis revealed that most of the identified miRNAs were insect-specific, and more than 20 miRNAs were Lepidoptera-specific. The investigation of the expression patterns of miR-2a, miR-34, miR-2796-3p and miR-11 revealed their potential roles in insect development. miRNA target prediction revealed that conserved miRNA target sites exist in various genes in the 3 species. Conserved miRNA target sites for the Hsp90 gene among the 3 species were validated in the mammalian 293T cell line using a dual-luciferase reporter assay. Our study provides a new approach with which to identify miRNAs in insects lacking genome information and contributes to the functional analysis of insect miRNAs.