Parallel-stranded DNA with mixed AT/GC composition: role of trans G.C base pairs in sequence dependent helical stability

Parallel-stranded (ps) DNAs with mixed AT/GC content comprising G.C pairs in a varying sequence context have been investigated. Oligonucleotides were devised consisting of two 10-nt strands complementary either in a parallel or in an antiparallel orientation and joined via nonnucleotide linkers so as to form 10-bp ps or aps hairpins. A predominance of intramolecular hairpins over intermolecular duplexes was achieved by choice of experimental conditions and verified by fluorescence determinations yielding estimations of rotational relaxation times and fractional base pairing. A multistate mode of ps hairpin melting was revealed by temperature gradient gel electrophoresis (TGGE). The thermal stability of the ps hairpins with mixed AT/GC content depends strongly on the specific sequence in a manner peculiar to the ps double helix. The thermodynamic effects of incorporating trans G.C base pairs into an AT sequence are context-dependent: an isolated G. C base pair destabilizes the duplex whereas a block of > or =2 consecutive G.C base pairs exerts a stabilizing effect. A multistate heterogeneous zipper model for the thermal denaturation of the hairpins was derived and used in a global minimization procedure to compute the thermodynamic parameters of the ps hairpins from experimental melting data. In 0.1 M LiCl at 3 degrees C, the formation of a trans G.C pair in a GG/CC sequence context is approximately 3 kJ mol(-)(1) more favorable than the formation of a trans A.T pair in an AT/TA sequence context. However, GC/AT contacts contribute a substantial unfavorable free energy difference of approximately 2 kJ mol(-)(1). As a consequence, the base composition and fractional distribution of isolated and clustered G.C base pairs determine the overall stability of ps-DNA with mixed AT/GC sequences. Thus, the stability of ps-DNA comprising successive > or =2 G.C base pairs is greater than that of ps-DNA with an alternating AT sequence, whereas increasing the number of AT/GC contacts by isolating G.C base pairs exerts a destabilizing effect on the ps duplex. Molecular modeling of the various helices by force field techniques provides insight into the structural basis for these distinctions.     

Thermodynamics of RNA duplexes with tandem mismatches containing a uracil-uracil pair flanked by C.G/G.C or G.C/A.U closing base pairs

The thermodynamics governing the denaturation of RNA duplexes containing 8 bp and a central tandem mismatch or 10 bp were evaluated using UV absorbance melting curves. Each of the eight tandem mismatches that were examined had one U-U pair adjacent to another noncanonical base pair. They were examined in two different RNA duplex environments, one with the tandem mismatch closed by G.C base pairs and the other with G.C and A.U closing base pairs. The free energy increments (Delta Gdegrees(loop)) of the 2 x 2 loops were positive, and showed relatively small differences between the two closing base pair environments. Assuming temperature-independent enthalpy changes for the transitions, (Delta Gdegrees(loop)) for the 2 x 2 loops varied from 0.9 to 1.9 kcal/mol in 1 M Na(+) at 37 degrees C. Most values were within 0.8 kcal/mol of previously estimated values; however, a few sequences differed by 1.2-2.0 kcal/mol. Single strands employed to form the RNA duplexes exhibited small noncooperative absorbance increases with temperature or transitions indicative of partial self-complementary duplexes. One strand formed a partial self-complementary duplex that was more stable than the tandem mismatch duplexes it formed. Transitions of the RNA duplexes were analyzed using equations that included the coupled equilibrium of self-complementary duplex and non-self-complementary duplex denaturation. The average heat capacity change (DeltaC(p)) associated with the transitions of two RNA duplexes was estimated by plotting DeltaH degrees and DeltaS degrees evaluated at different strand concentrations as a function of T(m) and ln T(m), respectively. The average DeltaC(p) was 70 +/- 5 cal K(-)(1) (mol of base pairs)(-)(1). Consideration of this heat capacity change reduced the free energy of formation at 37 degrees C of the 10 bp control RNA duplexes by 0.3-0.6 kcal/mol, which may increase Delta Gdegrees(loop) values by similar amounts.     

Thermodynamics of DNA duplexes with adjacent G.A mismatches.

The sequence 5'-d(ATGAGCGAAT) forms a very stable self-complementary duplex with four G.A mismatch base pairs (underlined) out of ten total base pairs [Li et al. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 26-30]. The conformation is in the general B-family and is stabilized by base-pair hydrogen bonding of an unusual type, by favorable base dipole orientations, and by extensive purine-purine stacking at the mismatched sites. We have synthesized 13 decamers with systematic variations in the sequence above to determine how the flanking sequences, the number of G.A mismatches, and the mismatch sequence order (5'-GA-3' or 5'-AG-3') affect the duplex stability. Changing A.T to G.C base pairs in sequences flanking the mismatches stabilizes the duplexes, but only to the extent observed with B-form DNA. The sequence 5'-pyrimidine-GA-purine-3', however, is considerably more stable than 5'-purine-GA-pyrimidine-3'. The most stable sequences with two pairs of adjacent G.A mismatches have thermodynamic parameters for duplex formation that are comparable to those for fully Watson-Crick base-paired duplexes. Similar sequences with single G.A pairs are much less stable than sequences with adjacent G.A mismatches. Reversing the mismatch order from 5'-GA-3' to 5'-AG-3' results in an oligomer that does not form a duplex. These results agree with predictions from the model derived from NMR and molecular mechanics and indicate that the sequence 5'-pyrimidine-GA-purine-3' forms a stable conformational unit that fits quite well into a B-form double helix.(ABSTRACT TRUNCATED AT 250 WORDS)     

N(4)C-ethyl-N(4)C cross-linked DNA: synthesis and characterization of duplexes with interstrand cross-links of different orientations.

The preparation and physical properties of short DNA duplexes that contain a N(4)C-ethyl-N(4)C interstrand cross-link are described. Duplexes that contain an interstrand cross-link between mismatched C-C residues and duplexes in which the C residues of a -CG- or -GC- step are linked to give "staggered" interstrand cross-links were prepared using a novel N(4)C-ethyl-N(4)C phosphoramidite reagent. Duplexes with the C-C mismatch cross-link have UV thermal transition temperatures that are 25 degrees C higher than the melting temperatures of control duplexes in which the cross-link is replaced with a G-C base pair. It appears that this cross-link stabilizes adjacent base pairs and does not perturb the structure of the helix, a conclusion that is supported by the CD spectrum of this duplex and by molecular models. An even higher level of stabilization, 49 degrees C, is seen with the duplex that contains a -CG- staggered cross-link. Molecular models suggest that this cross-link may induce propeller twisting in the cross-linked base pairs, and the CD spectrum of this duplex exhibits an unusual negative band at 298 nm, although the remainder of the spectrum is similar to that of B-form DNA. Mismatched C-C or -CG- staggered cross-linked duplexes that have complementary overhanging ends can undergo self-ligation catalyzed by T4 DNA ligase. Analysis of the ligated oligomers by nondenaturing polyacrylamide gel electrophoresis shows that the resulting oligomers migrate in a manner similar to that of a mixture of non-cross-linked control oligomers and suggests that these cross-links do not result in significant bending of the helix. However, the orientation of the staggered cross-link can have a significant effect on the structure and stability of the cross-linked duplex. Thus, the thermal stability of the duplex that contains a -GC- staggered cross-link is 10 degrees C lower than the melting temperature of the control, non-cross-linked duplex. Unlike the -CG- staggered cross-link, in which the cross-linked base pairs can still maintain hydrogen bond contacts, molecular models suggest that formation of the -GC- staggered cross-link disrupts hydrogen bonding and may also perturb adjacent base pairs leading to an overall reduction in helix stability. Duplexes with specifically positioned and oriented cross-links can be used as substrates to study DNA repair mechanisms.     

Nuclear magnetic resonance spectroscopy and molecular modeling reveal that different hydrogen bonding patterns are possible for G.U pairs: one hydrogen bond for each G.U pair in r(GGCGUGCC)(2) and two for each G.U pair in r(GAGUGCUC)(2)

G.U pairs occur frequently and have many important biological functions. The stability of symmetric tandem G.U motifs depends both on the adjacent Watson-Crick base pairs, e.g., 5'G > 5'C, and the sequence of the G.U pairs, i.e., 5'-UG-3' > 5'-GU-3', where an underline represents a nucleotide in a G.U pair [Wu, M., McDowell, J. A., and Turner, D. H. (1995) Biochemistry 34, 3204-3211]. In particular, at 37 degrees C, the motif 5'-CGUG-3' is less stable by approximately 3 kcal/mol compared with other symmetric tandem G.U motifs with G-C as adjacent pairs: 5'-GGUC-3', 5'-GUGC-3', and 5'-CUGG-3'. The solution structures of r(GAGUGCUC)(2) and r(GGCGUGCC)(2) duplexes have been determined by NMR and restrained simulated annealing. The global geometry of both duplexes is close to A-form, with some distortions localized in the tandem G.U pair region. The striking discovery is that in r(GGCGUGCC)(2) each G.U pair apparently has only one hydrogen bond instead of the two expected for a canonical wobble pair. In the one-hydrogen-bond model, the distance between GO6 and UH3 is too far to form a hydrogen bond. In addition, the temperature dependence of the imino proton resonances is also consistent with the different number of hydrogen bonds in the G.U pair. To test the NMR models, U or G in various G.U pairs were individually replaced by N3-methyluridine or isoguanosine, respectively, thus eliminating the possibility of hydrogen bonding between GO6 and UH3. The results of thermal melting studies on duplexes with these substitutions support the NMR models.     

Influence of nearest neighbor sequence on the stability of base pair mismatches in long DNA; determination by temperature-gradient gel electrophoresis.

Temperature-gradient gel electrophoresis (TGGE) was employed to determine the thermal stabilities of 48 DNA fragments that differ by single base pair mismatches. The approach provides a rapid way for studying how specific base mismatches effect the stability of a long DNA fragment. Homologous 373 bp DNA fragments differing by single base pair substitutions in their first melting domain were employed. Heteroduplexes were formed by melting and reannealing pairs of DNAs, one of which was 32P-labeled on its 5'-end. Product DNAs were separated based on their thermal stability by parallel and perpendicular temperature-gradient gel electrophoresis. The order of stability was determined for all common base pairs and mismatched bases in four different nearest neighbor environments; d(GXT).d(AYC), d(GXG).d(CYC), d(CXA).d(TYG), and d(TXT).d(AYA) with X,Y = A, T, C, or G. DNA fragments containing a single mismatch were destabilized by 1 to 5 degrees C with respect to homologous DNAs with complete Watson-Crick base pairing. Both the bases at the mismatch site and neighboring stacking interactions influence the destabilization caused by a mismatch. G.T, G.G and G.A mismatches were always among the most stable mismatches for all nearest neighbor environments examined. Purine.purine mismatches were generally more stable than pyrimidine.pyrimidine mispairs. Our results are in very good agreement with data where available from solution studies of short DNA oligomers.     

Base pairing involving deoxyinosine: implications for probe design.

The thermal stability of oligodeoxyribonucleotide duplexes containing deoxyinosine (I) residues matched with each of the four normal DNA bases were determined by optical melting techniques. The duplexes containing at least one I were obtained by mixing equimolar amounts of an oligonucleotide of sequence dCA3XA3G with one of sequence dCT3YT3G where X and Y were A, C, G, T, or I. Comparison of optical melting curves yielded relative stabilities for the I-containing standard base pairs in an otherwise identical base-pair sequence. I:C pairs were found to be less stable than A:T pairs in these duplexes. Large neighboring-base effects upon stability were observed. For example, when (X,Y) = (I,A), the duplex is eight-fold more stable than when (X,Y) = (A,I). Independent of sequence effects the order of stabilities is: I:C greater than I:A greater than I:T congruent to I:G. This order differs from that of deoxyguanosine which pairs less strongly with dA; otherwise each deoxyinosine base pair is less stable than its deoxyguanosine counterpart in the same sequence environment. Implications of these results for design of DNA oligonucleotide probes are discussed.     

Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G.T and G.O4meT pairing in dodecanucleotide duplexes

High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G.T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O4meT-G-C-G) duplex (designated G.O4meT 12-mer) containing G.T and G.O4meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G.T 12-mer and G.O4meT 12-mer duplexes in H2O and D2O solution. The guanosine and thymidine imino protons in the G.T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G.T 12-mer duplex. These results are consistent with wobble pairing at the G.T mismatch site involving two imino proton-carbonyl hydrogen bonds as reported previously [Hare, D. R., Shapiro, L., & Patel, D. J. (1986) Biochemistry 25, 7445-7456]. In contrast, the guanosine imino proton in the G.O4meT pair resonates at 8.67 ppm. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G.T mismatch or in G.C base pairs indicates that hydrogen bonding to O4meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH3 group of O4meT across the pair and NOEs to the imino protons of flanking base pairs.(ABSTRACT TRUNCATED AT 250 WORDS)     

Influence of an exocyclic guanine adduct on the thermal stability, conformation, and melting thermodynamics of a DNA duplex.

As part of an overall program to characterize the impact of mutagenic lesions on the physiochemical properties of DNA, we report here the results of a comparative spectroscopic study on pairs of DNA duplexes both with and without an exocyclic guanine lesion. Specifically, we have studied a family of four 13-mer duplexes of the form d(CGCATGYGTACGC).d(GCGTACZCATGCG) in which Y is either the normal deoxyguanosine residue (G) or the exocyclic guanine adduct 1,N2-propanodeoxyguanosine (X), while Z is either deoxycytosine (C) or deoxyadenosine (A). Thus, the four duplexes studied, which can be designated by the identity of their central Y.Z base pair, are a Watson-Crick duplex (GC), a duplex with a central mismatch (GA), and two duplexes with exocyclic guanine lesions (X), that differ only by the base opposite the lesion (XC and XA). The data derived from our spectroscopic measurements on these four duplexes have allowed us to evaluate the influence of the exocyclic guanine lesion, as well as the base opposite the lesion, on the conformation, thermal stability, and melting energetics of the host DNA duplex. To be specific, our circular dichroism (CD) spectra show that the exocyclic guanine lesion induces alterations in the duplex structure, while our temperature-dependent optical measurements reveal that these lesion-induced structural alterations reduce the thermal stability, the transition enthalpy, and the transition free energy of the duplex.(ABSTRACT TRUNCATED AT 250 WORDS)     

Interactions of 4'', 6-diamidine-2-phenylindole with synthetic polynucleotides.

4', 6-Diamidine-2-phenylindole forms fluorescent complexes with synthetic DNA duplexes containing AT, AU and IC base pairs; no fluorescent complexes were observed with duplexes containing GC base pairs or with duplexes containing a single AT base pair sandwiched between GC pairs. The binding site size is one molecule of dye per 3 base pairs. The intrinsic binding constants are higher for alternating sequence duplexes than for the corresponding homopolymer pairs. With the exception of the four-stranded helical poly rI which exhibits considerable fluorescence enhancement upon binding of the ligand, none of the single- or multi- stranded polyribonucleotides and ribo-deoxyribonucleotide hybrid structures form fluorescent complexes with the dye. Poly rI is the only RNA which forms a DNA B-like structure (Arnott et al. (1974) Biochem. J. 141, 537). The B conformation of the helix and the absence of guanine appear to be the major determinants of the specificity of the fluorescent binding mode of the dye. Nonfluorescent interactions of the dye with polynucleotides are nonspecific; UV absorption and circular dichroic spectra demonstrate binding to synthetic single- and double-stranded DNA and RNA analogs, including those containing GC base pairs.     

Crystal structure of the highly distorted chimeric decamer r(C)d(CGGCGCCG)r(G).spermine complex--spermine binding to phosphate only and minor groove tertiary base-pairing.

The crystal structure of the self-complementary chimeric decamer duplex r(C)d(CGGCGCCG)r(G), with RNA base pairs at both termini, has been solved at 1.9 A resolution by the molecular replacement method and refined to an R value of 0.145 for 2,314 reflections. The C3'-endo sugar puckers of the terminal riboses apparently drive the entire chimeric duplex into an A-DNA conformation, in contrast to the B-DNA conformation adopted by the all-deoxy decamer of the same sequence. Five symmetry related duplexes encapsulate a spermine molecule which interacts with ten phosphate groups, both directly and through water molecules to form multiple ionic and hydrogen bonding interactions. The spermine interaction severely bends the duplexes by 31 degrees into the major groove at the fourth base pair G(4).C(17), jolts it and slides the 'base plate' into the minor groove. This base pair, together with the adjacent base pair in the top half and the corresponding pseudo two-fold related base pairs in the bottom half, form four minor groove base-paired multiples with the terminal base pairs of two neighboring duplexes.     

Proton exchange and local stability in a DNA triple helix containing a G.TA triad

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C⁺.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.     

Studies on nucleic acid interactions. I. Stabilities of mini-duplexes (dG2A4XA4G2-dC2T4YT4C2) and self-complementary d(GGGAAXYTTCCC) containing deoxyinosine and other mismatched bases.

The thermal stability of DNA duplexes containing deoxyinosine in a pairing position in turn with each of the four major deoxynucleotides has been investigated by measuring ultraviolet-absorbance at different temperatures. d(G2A4 X A4G2) and d(C2T4YT4C2) were prepared by the solid-phase phosphotriester method. When X is deoxyinosine, the Tm values of the duplexes are in the order Y = dC greater than dA greater than dG greater than dT greater than dU. The Tm of other duplexes containing dG, dA and dT at X were also measured. Self-complementary duplexes d(GGGAAINTTCCC) showed the same order of stability with N being dC, dA, dG and dT. Thermal stabilities of duplexes containing dG instead of dI were compared with other matched and mismatched duplexes. The Tm values of sequence isomers containing purine-pyrimidine combinations were compared. Self-complementary duplexes containing G-C and A-T in the central positions showed Tm values ca. 10 degrees higher than those containing C-G and T-A in the same positions. Thermodynamic parameters and circular dichroism spectra of these oligonucleotides were compared.     

Structural studies of DNA fragments: the G.T wobble base pair in A, B and Z DNA; the G.A base pair in B-DNA

The crystal structures of five double helical DNA fragments containing non-Watson-Crick complementary base pairs are reviewed. They comprise four fragments containing G.T base pairs: two deoxyoctamers d(GGGGCTCC) and d(GGGGTCCC) which crystallise as A type helices; a deoxydodecamer d(CGCGAATTTGCG) which crystallises in the B-DNA conformation; and the deoxyhexamer d(TGCGCG), which crystallises as a Z-DNA helix. In all four duplexes the G and T bases form wobble base pairs, with bases in the major tautomer forms and hydrogen bonds linking N1 of G with O2 of T and O6 of G with N3 of T. The X-ray analyses establish that the G.T wobble base pair can be accommodated in the A, B or Z double helix with minimal distortion of the global conformation. There are, however, changes in base stacking in the neighbourhood of the mismatched bases. The fifth structure, d(CGCGAATTAGCG), contains the purine purine mismatch G.A where G is in the anti and A in the syn conformation. The results represent the first direct structure determinations of base pair mismatches in DNA fragments and are discussed in relation to the fidelity of replication and mismatch recognition.     

Hybridization of synthetic oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base pair mismatch.

Oligodeoxyribonucleotides complementary to the DNA of the wild type (wt) bacteriophage phi chi 174 have been synthesized by the phosphotriester method. The oligomers, 11, 14, and 17 bases long, are complementary to the region of the DNA which accounts for the am-3 point mutation. When hybridized to am-3 DNA, the oligonucleotides form duplexes with a single base pair mismatch. The thermal stability of the duplexes formed between wt and am-3 DNAs has been measured. The am-3 DNA:oligomer duplexes dissociate at a temperature about 10 degrees C lower than the corresponding wt DNA:oligomer duplexes. This dramatic decrease in thermal stability due to a single mismatch makes it possible to eliminate the formation of the mismatched duplexes by the appropriate choice of hybridization temperature. These results are discussed with respect to the use of oligonucleotides as probes for the isolation of specific cloned DNA sequences.     

Recognition of base pair inversions in duplex by chimeric (alpha,beta) triplex-forming oligonucleotides

DNA recognition by triplex-forming oligonucleotides (TFOs) is usually limited by homopurine-homopyrimidine sequence in duplexes. Modifications of the third strand may overcome this limitation. Chimeric alpha-beta TFOs are expected to form triplex DNA upon binding to non-regular sequence duplexes. In the present study we describe binding properties of chimeric alpha-beta oligodeoxynucleotides in the respect to short DNA duplexes with one, three, and five base pair inversions. Non-natural chimeric TFO's contained alpha-thymidine residues inside (GT) or (GA) core sequences. Modified residues were addressed to AT/TA inversions in duplexes. It was found in the non-denaturing gel-electrophoresis experiments that single or five adjacent base pair inversions in duplexes may be recognized by chimeric alpha-beta TFO's at 10 degrees C and pH 7.8. Three dispersed base pair inversions in the double stranded DNA prevented triplex formation by either (GT) or (GA) chimeras. Estimation of thermal stability of chimeric alpha-beta triplexes showed decrease in T(m) values as compared with unmodified complexes.     

A second-generation copper(II)-mediated metallo-DNA-base pair

Metal-dependent pairing of nucleobases represents an alternative DNA base pairing scheme. Our first-generation copper(II)-mediated pyridine-2,6-dicarboxylate (Dipic) and pyridine (Py) metallo-base pair has a stability comparable to the natural base pairs dA:dT and dC:dG but does not have the selectivity of the Watson Crick base pairs. In order to increase the selectivity of base pair formation, a second-generation metallo-base pair was generated consisting of a pyridine-2,6-dicarboxamide (Dipam) and a pyridine (Py) nucleobase. This new metallo-base pair is more stable than the natural base pairs dA:dT and dC:dG and highly selective against mispairing. In addition, incorporation of multiple metallo-base pairs into DNA results in the formation of stable duplexes demonstrating that hydrogen bonding base pairs can efficiently be replaced by metal-dependent base pairs at multiple sites in DNA.     

Effects of internal nonbonded bases and a G.U base pair on the stability of a short ribonucleic acid helix.

Proton nuclear magnetic resonance has been used to examine the effect of both noncomplementary and G.U oppositions in the duplexes formed by the synthetic pentaribonucleotides CpApApUpG, CpApUpUpG, CpApGpUpG, and CpApCpUpG. The lack of any sigmoidal behavior in the chemical shift vs. temperature plots of the base protons in the individual pentaribonucleotides indicates that duplexes with noncomplementary base oppositions of the type: formula: (see text), (where X = A, U, G, or C) do not form. Variable temperature spectra of the mixture of CpApGpUpG and CpApUpUpG were recorded over the range of 70--10 degrees C. The chemical shift vs. temperature plot of the purine aromatic protons displayed sigmoidal curves. This demonstrated both duplex formation and the presence of a G.U. base pair. The average Tm of the duplex was found to be 23.4 +/- 2.0 degrees C. This is similar to that of the duplex formed by CpApUpG (24.0 +/- 1.0 degrees C) but less than the Tm of the following duplexes: CpApApUpG:CpApUpUpG (Tm = 28.5 +/- 2.1 degrees C), CpApGpUpG:CpApCpUpG (Tm = 38.4 +/- 0.6 degrees C) and CpApUpApUpG (Tm = 41.5 +/- 1.1 degrees C). The G.U base pair has a Tm (20.0 degrees C) significantly lower than the rest of the duplex (24 +/- 1 degree C) and is a region of local instability within the double helix. This 1H NMR study is the first to investigate both the formation and relative stability of an internal G.U. base pair neighboring regular Watson--Crick base pairs.     

Nearest-neighbor thermodynamics and NMR of DNA sequences with internal A.A, C.C, G.G, and T.T mismatches

Thermodynamic measurements are reported for 51 DNA duplexes with A.A, C.C, G.G, and T.T single mismatches in all possible Watson-Crick contexts. These measurements were used to test the applicability of the nearest-neighbor model and to calculate the 16 unique nearest-neighbor parameters for the 4 single like with like base mismatches next to a Watson-Crick pair. The observed trend in stabilities of mismatches at 37 degrees C is G.G > T.T approximately A.A > C.C. The observed stability trend for the closing Watson-Crick pair on the 5' side of the mismatch is G.C >/= C.G >/= A.T >/= T.A. The mismatch contribution to duplex stability ranges from -2.22 kcal/mol for GGC.GGC to +2.66 kcal/mol for ACT.ACT. The mismatch nearest-neighbor parameters predict the measured thermodynamics with average deviations of DeltaG degrees 37 = 3.3%, DeltaH degrees = 7. 4%, DeltaS degrees = 8.1%, and TM = 1.1 degrees C. The imino proton region of 1-D NMR spectra shows that G.G and T.T mismatches form hydrogen-bonded structures that vary depending on the Watson-Crick context. The data reported here combined with our previous work provide for the first time a complete set of thermodynamic parameters for molecular recognition of DNA by DNA with or without single internal mismatches. The results are useful for primer design and understanding the mechanism of triplet repeat diseases.