The complete nucleotide sequence of the group II RNA coliphage GA

The complete nucleotide sequence of the RNA coliphage GA, a group II phage, is presented. The entire genome comprises 3466 bases. Three large open reading frames were identified, which correspond to the maturation protein gene (390 amino acids), the coat protein gene (129 amino acids) and the replicase beta-subunit protein gene (531 amino acids). In addition, untranslated regions occur at the 5' (135 bases) and 3' (122 bases) ends of the molecule. Two intercistronic untranslated regions occur between the cistrons for the maturation and coat proteins, and between the coat and beta-subunit proteins. We have compared the nucleotide sequence of GA RNA with the published sequence of MS2 RNA, and show that they are related. The comparative structures of two important regulatory regions are presented; the coat protein binding site which is involved in translational repression of the replicase beta-subunit protein gene, and a hairpin in a region proximal to the lysis protein gene.     

Crystal Structure of the Bacteriophage Qβ Coat Protein in Complex with the RNA Operator of the Replicase Gene

The coat proteins of single-stranded RNA bacteriophages specifically recognize and bind to a hairpin structure in their genome at the beginning of the replicase gene. The interaction serves to repress the synthesis of the replicase enzyme late in infection and contributes to the specific encapsidation of phage RNA. While this mechanism is conserved throughout the Leviviridae family, the coat protein and operator sequences from different phages show remarkable variation, serving as prime examples for the co-evolution of protein and RNA structure. To better understand the protein–RNA interactions in this virus family, we have determined the three-dimensional structure of the coat protein from bacteriophage Qβ bound to its cognate translational operator. The RNA binding mode of Qβ coat protein shares several features with that of the widely studied phage MS2, but only one nucleotide base in the hairpin loop makes sequence-specific contacts with the protein. Unlike in other RNA phages, the Qβ coat protein does not utilize an adenine-recognition pocket for binding a bulged adenine base in the hairpin stem but instead uses a stacking interaction with a tyrosine side chain to accommodate the base. The extended loop between β strands E and F of Qβ coat protein makes contacts with the lower part of the RNA stem, explaining the greater length dependence of the RNA helix for optimal binding to the protein. Consequently, the complex structure allows the proposal of a mechanism by which the Qβ coat protein recognizes and discriminates in favor of its cognate RNA.     

Long-range translational coupling in single-stranded RNA bacteriophages: an evolutionary analysis.

In coliphage MS2 RNA a long-distance interaction (LDI) between an internal segment of the upstream coat gene and the start region of the replicase gene prevents initiation of replicase synthesis in the absence of coat gene translation. Elongating ribosomes break up the repressor LDI and thus activate the hidden initiation site. Expression studies on partial MS2 cDNA clones identified base pairing between 1427-1433 and 1738-1744, the so-called Min Jou (MJ) interaction, as the molecular basis for the long-range coupling mechanism. Here, we examine the biological significance of this interaction for the control of replicase gene translation. The LDI was disrupted by mutations in the 3'-side and the evolutionary adaptation was monitored upon phage passaging. Two categories of pseudorevertants emerged. The first type had restored the MJ interaction but not necessarily the native sequence. The pseudorevertants of the second type acquired a compensatory substitution some 80 nt downstream of the MJ interaction that stabilizes an adjacent LDI. In one examined case we confirmed that the second site mutations had restored coat-replicase translational coupling. Our results show the importance of translational control for fitness of the phage. They also reveal that the structure that buries the replicase start extends to structure elements bordering the MJ interaction.     

Reversion of Q beta RNA phage mutants by homologous RNA recombination.

Q beta phage RNAs with inactivating insertion (8-base) or deletion (17-base) mutations within their replicase genes were prepared from modified Q beta cDNAs and transfected into Escherichia coli spheroplasts containing Q beta replicase provided in trans by a resident plasmid. Replicase-defective (Rep-) Q beta phage produced by these spheroplasts were detected as normal-sized plaques on lawns of cells containing plasmid-derived Q beta replicase, but were unable to form plaques on cells lacking this plasmid. When individual Rep- phage were isolated and grown to high titer in cells containing plasmid-derived Q beta replicase, revertant (Rep+) Q beta phage were obtained at a frequency of ca. 10(-8). To investigate the mechanism of this reversion, a point mutation was placed into the plasmid-derived Q beta replicase gene by site-directed mutagenesis. Q beta mutants amplified on cells containing the resultant plasmid also yielded Rep+ revertants. Genomic RNA was isolated from several of the latter phage revertants and sequenced. Results showed that the original mutation (insertion or deletion) was no longer present in the phage revertants but that the marker mutation placed into the plasmid was now present in the genomic RNAs, indicating that recombination was one mechanism involved in the reversion of the Q beta mutants. Further experiments demonstrated that the 3' noncoding region of the plasmid-derived replicase gene was necessary for the reversion-recombination of the deletion mutant, whereas this region was not required for reversion or recombination of the insertion mutant. Results are discussed in terms of a template-switching model of RNA recombination involving Q beta replicase, the mutant phage genome, and plasmid-derived replicase mRNA.     

Translational control by a long range RNA-RNA interaction; a basepair substitution analysis.

One of the two mechanisms that regulate expression of the replicase cistron in the single stranded RNA coliphages is translational coupling. This mechanism prevents ribosomes from binding at the start of the replicase cistron unless the upstream coat cistron is being translated. Genetic analysis had identified a maximal region of 132 nucleotides in the coat gene over which ribosomes should pass to activate the replicase start. Subsequent deletion studies in our laboratory had further narrowed down the regulatory region to 12 nucleotides. Here, we identify a long-distance RNA-RNA interaction of 6 base pairs as the basis of the translational polarity. The 3' side of the complementarity region is located in the coat-replicase intercistronic region, some 20 nucleotides before the start codon of the replicase. The 5' side encodes amino acids 31 and 32 of the coat protein. Mutations that disrupt the long-range interaction abolish the translational coupling. Repair of basepairing by second site base substitutions restores translational coupling.     

Overlapping genes in RNA phage: a new protein implicated in lysis.

We have identified a new 75 amino acid polypeptide (L protein) following f2 phage infection of E. coli. It is encoded by an out-of-phase overlapping gene which begins within the coat protein gene, ends in the replicase gene and covers the 36 base intercistronic space between them. A mutant f2 phage carrying a UGA mutation (op3), which complements mutations in the other three f2 genes (coat, A protein and replicase), fails to lyse cells (Model, Webster and Zinder, 1979) and also fails to produce L protein. Both lysis and L protein are restored following op3 infection of a UGA suppressor-containing strain or infection of wild-type bacteria with a revertant of op3. L protein is found in the insoluble fraction of artificially lysed cells. In this paper, we present the time course of its synthesis relative to the other f2-coded polypeptides: L protein synthesis increases as replicase synthesis decreases. We also report the discovery of another phage-coded polypeptide, which appears to be the product of a novel mode of translation: initiation at the coat protein initiation site, followed by translational frame shifting into the L protein frame and termination at the L protein terminus.     

The amino terminal half of the MS2-coded lysis protein is dispensable for function: implications for our understanding of coding region overlaps.

We have asked whether genetic overlaps only evolve to provide extra coding capacity in genomes of restricted size. As a model system we have used the lysis gene of the RNA bacteriophage MS2. This gene overlaps with the distal part of the coat protein gene and with the proximal part of the replicase gene. Using recombinant DNA procedures we have determined whether either of the two overlaps codes for amino acids that are not essential for the function of the 75 amino acid long lysis protein. We find that the first 40 amino acids of the lysis protein are dispensable for function. Thus all of the genetic information essential to the synthesis of the active C-terminal peptide lies within the overlap with the replicase gene, whereas all dispensable residues are encoded in the overlap with the coat protein gene and in the intercistronic region. This suggests that the overlap with the coat protein gene is not required for extra coding capacity but serves to regulate the expression of the lysis gene. Comparative sequence analysis is consistent with this idea.     

Interference with viral infection by RNA replicase deleted at the carboxy-terminal region

Escherichia coli cells harboring an altered Q beta RNA replicase which has amino acid substitutions of the glycine residue at position 357 in the conserved sequence Tyr356-Gly357-Asp358-Asp359 of the beta-subunit protein lost the replicase activity but interfered with proliferation of Q beta phage [Inokuchi and Hirashima (1987) J. Virol. 61, 3946-3949]. To examine the mechanism of the interference, we further analyzed various mutants lacking the carboxy-terminal region of the beta-subunit protein. The cells expressing the beta-subunit gene with up to 17% deletion from the carboxy-terminus of the protein prevented the proliferation of Q beta phage. However, in the case that the deletion extended beyond 25% from the carboxy-terminus, the cells showed no interference. In addition, when the interference took place, the phage coat protein synthesis was inhibited. These results indicate that the region between amino acids 440 and 487 of the beta-subunit protein is involved in the interference and suggest that the defective replicase inhibits the phage coat protein synthesis by competing with the ribosomes at the initiation site of the coat gene.     

RNA binding properties of the coat protein from bacteriophage GA.

The coat protein of bacteriophage GA, a group II RNA phage, binds to a small RNA hairpin corresponding to its replicase operator. Binding is specific, with a Ka of 71 microM -1. This interaction differs kinetically from the analogous coat protein-RNA hairpin interactions of other RNA phage and also deviates somewhat in its pH and salt dependence. Despite 46 of 129 amino acid differences between the GA and group I phage R17 coat proteins, the binding sites are fairly similar. The essential features of the GA coat protein binding site are a based-paired stem with an unpaired purine and a four nucleotide loop having an A at position -4 and a purine at -7. Unlike the group I phage proteins, the GA coat protein does not distinguish between two alternate positions for the unpaired purine and does not show high specificity for a pyrimidine at position -5 of the loop.     

The binding site for coat protein on bacteriophage Qbeta RNA.

The site of interaction of phage Qbeta coat protein with Qbeta RNA was determined by ribonuclease T1 degradation of complexes of coat protein and [32P]-RNA obtained by codialysis of the components from urea into buffer solutions. The degraded complexes were recovered by filtration through nitrocellulose filters, and bound [32P]RNA fragments were extracted and separated by polyacrylamide gel electrophoresis. Fingerprinting and further sequence analysis established that the three main fragments obtained (chain lengths 88, 71 and 27 nucleotides) all consist of sequences extending from the intercistronic region to the beginning of the replicase cistron. These results suggest that in the replication of Qbeta, as in the case of R17, coat protein acts as a translational repressor by binding to the ribosomal initiation site of the replicase cistron.     

Analysis of six new genes encoding lysis proteins and coat proteins in Escherichia coli group A RNA phages

Group A RNA phages consist of four genes-maturation protein, coat protein, lysis protein and replicase genes. We analyzed six plasmids containing lysis protein genes and coat protein genes of Escherichia coli group A RNA phages and compared their amino acid sequences with the known proteins of E. coli(group A), Pseudomonas aeruginosa(PP7) RNA phages and Rg-lysis protein from Qbeta phage. The size of lysis proteins was different by the groups but the coat proteins were almost the same size among phages. The phylogenetic analysis shows that the sub-groups A-I and A-II of E. coli RNA phages were clearly dispersed into two clusters.     

Genome structure of caulobacter phage phiCb5

The complete genome sequence of caulobacter phage phiCb5 has been determined, and four open reading frames (ORFs) have been identified and characterized. As for related phages, the ORFs code for maturation, coat, replicase, and lysis proteins, but unlike other Leviviridae members, the lysis protein gene of phiCb5 entirely overlaps with the replicase in a different reading frame. The lysis protein of phiCb5 is about two times longer than that of the distantly related MS2 phage and presumably contains two transmembrane helices. Analysis of the proposed genome secondary structure revealed a stable 5' stem-loop, similar to other phages, and a substantially shorter 3' untranslated region (UTR) structure with only three stem-loops.     

Binding of mammalian ribosomes to MS2 phage RNA reveals an overlapping gene encoding a lysis function.

The main binding site for mammalian ribosomes on the single-stranded RNA of bacteriophage MS2 is located nine tenths of the way through the coat protein gene. Translation initiated at an AUG triplet in the +1 frame yields a 75 amino acid polypeptide which terminates within the synthetase gene at a UAA codon, also in the +1 frame. Partial amino acid sequence analysis of the product synthesized in relatively large amounts by mammalian ribosomes confirms this assignment of the overlapping cistron. The same protein is made in an E. coli cell-free system, but only in very small amounts. Analysis of the translation products directed by RNA from op3, a UGA nonsense mutant of phage f2, identifies the overlapping cistron as a lysis gene. In this paper we show that the op3 mutation is a C yield U transition occurring in the second codon of the synthetase cistron, which explains the lowered production of phage replicase (as well as lack of lysis) upon op3 infection of nonpermissive cells. We discuss the properties of the overlapping gene in relation to its lysis function, recognition of the lysis initiator region by E. coli versus eucaryotic ribosomes and op3 as a ribosome binding site mutant for the f2 synthetase cistron.     

Secondary structure of coliphage Q beta RNA. Analysis by electron microscopy

The secondary structure of genomic RNA from the coliphage Q beta has been examined by electron microscopy in the presence of varying concentrations of spermidine using the Kleinschmidt spreading technique. The size and position of structural features that cover 70% of the viral genome have been mapped. The structural features that are visualized by electron microscopy in Q beta RNA are large. They range in size from 170 to 1600 nucleotides. A loop containing approximately 450 nucleotides is located at the 5' end of the RNA. It includes the initiation region for the viral maturation protein. A large hairpin containing approximately 1600 nucleotides is located in the center of the molecule. It is multibranched and includes most of the viral coat gene, the readthrough region of the A1 gene, and approximately one third of the viral replicase gene. Within the central hairpin, the initiation region for the viral replicase gene pairs with a region within the distal third of the viral coat gene. This structure may participate in the regulation of translational initiation of the viral replicase gene. Two structural variants of the central hairpin were observed. One of them brings the internal S and M viral replicase binding regions into juxtaposition. These observations suggest that the central hairpin may also participate in the regulation of translation of the viral coat gene. The secondary structures that are observed in Q beta RNA differ significantly from structures that we described previously in the genomic RNA of coliphage MS2 but are similar to structures we observed by electron microscopy in the related group B coliphage SP.     

The regulatory region of MS2 phage RNA replicase cistron. Functional activity of individual MS2 RNA fragments

The present work deals with the structural-functional organization of regulatory regions of messenger RNAs. Some principles of the action of a translational repressor (coat protein) and the formation of the ribosomal initiation complex at the replicase cistron have been studied with MS2 phage RNA. When the complex of MS2 RNA with the coat protein is treated with T₁ ribonuclease, the coat protein selectively protects mainly two fragments (59 and 103 nucleotides in length) from digestion; these fragments contain the intercistronic regulatory region and the beginning of the MS2 replicase cistron. These polynucleotides have been isolated in a pure state and their primary structure has been established.It has been established that both MS2 RNA fragments contain all the necessary information for specific interaction with MS2 coat protein and form a complex with it with an efficiency close to that observed in the case of native MS2 RNA. They also provide the normal polypeptide chain initiation at the replicase cistron. Enzymatic binding of the second aminoacyl-tRNA and electrophoretic analysis of N-terminal dipeptides prove that only the true initiator codon of the replicase cistron is recognized by a ribosome despite the presence of a few additional AUG triplets within the polynucleotides. Under conditions of limited hydrolysis by T₁ ribonuclease, the beginning of the replicase cistron has been removed from the shortest polynucleotide leading to a complete loss of its ability to bind both the coat protein and a ribosome.Some principles of the functioning of the regulatory region in MS2 RNA as well as the nature of the initiator signal of protein biosynthesis are discussed.     

Role of ribosome recycling factor (RRF) in translational coupling

RNA phage GA coat and lysis protein expression are translationally coupled through an overlapping termination and initiation codon UAAUG. Essential for this coupling are the proximity of the termination codon of the upstream coat gene to the initiation codon of the lysis gene (either a <3 nucleotide separation or physical closeness through a possible hairpin structure) but not the Shine-Dalgarno sequence. This suggests that the ribosomes completing the coat gene translation are exclusively responsible for translation of the lysis gene. Inactivation of ribosome recycling factor (RRF), which normally releases ribosomes at the termination codon, did not influence the expression of the reporter gene fused to the lysis gene. This suggests the possibility that RRF may not release ribosomes from the junction UAAUG. However, RRF is essential for correct ribosomal recognition of the AUG codon as the initiation site for the lysis gene.     

The lysis function of RNA bacteriophage Qbeta is mediated by the maturation (A2) protein

Complete or partial cDNA sequences of the RNA bacteriophage Qbeta were cloned in plasmids under the control of the lambdaP(L) promoter to allow regulated expression in Escherichia coli harbouring the gene for the temperature-sensitive lambdaCI857 repressor. Induction of the complete Qbeta sequence leads to a 100-fold increase in phage production, accompanied by cell lysis. Induction of the 5'-terminal sequence containing the intact maturation protein (A2) cistron also causes cell lysis. Alterations of the A2 cistron, leading to proteins either devoid of approximately 20% of the C-terminal region or of six internal amino acids, abolish the lysis function. Expression of other cistrons in addition to the A2 cistron does not enhance host lysis. Thus, in Qbeta, the A2 protein, in addition to its functions as maturation protein, appears to trigger cell lysis. This contrasts with the situation in the distantly related group I RNA phages such as f2 and MS2 where a small lysis polypeptide is coded for by a region overlapping the end of the coat gene and the beginning of the replicase gene.     

Nucleoside and nucleotide inactivation of R17 coat protein: evidence for a transient covalent RNA-protein bond

R17 coat protein forms a specific complex with a 21-nucleotide RNA hairpin containing the initiation site for the phage replicase gene. The RNA binding activity of the protein is inhibited by prior incubation with 5-bromouridine (BrU). The inactivation occurs with pseudo-first-order kinetics, and the inactive protein is stable to dilution. RNA binding activity of the BrU-inactivated protein is restored upon incubation with dithiothreitol. Inactivation of coat protein by N-ethylmaleimide or p-(chloromercuri)-benzenesulfonate indicates that a cysteine residue is located near the RNA binding site. Since 5-bromodeoxyuridine does not inactivate coat protein, a specific binding event appears to be required before inactivation can occur. Surprisingly, unmodified cytidine nucleotides also inactivate coat protein, with a specificity similar to the modified analogues. These results are discussed with regard to the formation of a transient covalent RNA-protein bond.     

Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.     

Role of the coat Protein-RNA interaction in the life cycle of bacteriophage MS2

The coat protein of the RNA bacteriophage MS2 interacts with viral RNA to translationally repress replicase synthesis. This protein-RNA interaction is also thought to play a role in genome encapsidation. In this study the strength of the interaction was perturbed by constructing a recombinant genome containing a super-repressing coat mutation. Because replicase synthesis is prematurely repressed, the mutant produces plaques about five orders of magnitude less efficiently than wild-type. The few plaques obtained are second-site revertants of the original coat mutation and fall into two categories. Those of the first type contain nucleotide substitutions within the translational operator that reduce or destroy its ability to bind coat protein, showing that this interaction is not necessary for genome encapsidation. Revertants of the second type are double mutants in which one substitution converts the coat initiator AUG to AUA and the other substitutes an A for the G normally present two nucleotides upstream of the coat start codon. The mutation of the coat protein gene AUG to AUA, by itself, reduces coat protein synthesis to a few percent of the wild-type level. The second substitution destabilizes the coat initiator stem-loop and restores coat protein synthesis to within a few fold of wild-type levels. Received: 17 June 1996 / Accepted: 5 December 1996