DNA-binding study of anticancer drug cytarabine by spectroscopic and molecular docking techniques

The interaction of anticancer drug cytarabine with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multispectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove-binding mode, while the binding constant of UV-vis and the number of binding sites were 4.0 ± 0.2 × 10⁴ L mol^?1 and 1.39, respectively. The fluorimetric studies showed that the reaction between the drugs with CT-DNA is exothermic. Circular dichroism spectroscopy was employed to measure the conformational change of DNA in the presence of cytarabine. Furthermore, the drug induces detectable changes in its viscosity for DNA interaction. The molecular modeling results illustrated that cytarabine strongly binds to groove of DNA by relative binding energy of docked structure ?20.61 KJ mol^?1. This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the interaction of small molecular pollutants and drugs with biomacromolecules for clarifying the molecular mechanism of toxicity or side effect in vivo.     

DNA binding affinity of a macrocyclic copper(II) complex: Spectroscopic and molecular docking studies

The interaction of a novel macrocyclic copper(II) complex, ([CuL(ClO₄)₂] that L is 1,3,6,10,12,15-hexaazatricyclo[13.3.1.1^6,10]eicosane) with calf thymus DNA (ct-DNA) was investigated by various physicochemical techniques and molecular docking at simulated physiological conditions (pH = 7.4). The absorption spectra of the Cu(II) complex with ct-DNA showed a marked hyperchroism with 10 nm blue shift. The intrinsic binding constant (K_b) was determined as 1.25 × 10⁴ M^?1, which is more in keeping with the groove binding with DNA. Furthermore, competitive fluorimetric studies with Hoechst33258 have shown that Cu(II) complex exhibits the ability to displace the ct-DNA-bound Hoechst33258 indicating that it binds to ct-DNA in strong competition with Hoechst33258 for the groove binding. Also, no change in the relative viscosity of ct-DNA and fluorescence intensity of ct-DNA-MB complex in the present of Cu(II) complex is another evidence to groove binding. The thermodynamic parameters are calculated by van't Hoff equation, which demonstrated that hydrogen bonds and van der Waals interactions played major roles in the binding reaction. The experimental results were in agreement with the results obtained via molecular docking study.     

Spectroscopic and molecular docking studies on the interaction of antiviral drug nevirapine with calf thymus DNA

The interaction of calf thymus DNA with nevirapine at physiological pH was studied by using absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, salt effect studies and computational methods. The drug binds to ct-DNA in a groove binding mode, as shown by slight variation in the viscosity of ct-DNA. Furthermore, competitive fluorimetric studies with Hoechst 33258 indicate that nevirapine binds to DNA via groove binding. Moreover, the structure of nevirapine was optimized by DFT calculations and was used for the molecular docking calculations. The molecular docking results suggested that nevirapine prefers to bind on the minor groove of ct-DNA.     

Groove binding between ferulic acid and calf thymus DNA: spectroscopic methodology combined with chemometrics and molecular docking studies

Abstract

Ferulic acid (FA), a dietary phenolic acid compound, is proved to possess numerous biological activities. Hence, this study was devoted to explore the interaction between FA and calf thymus DNA (ctDNA) by UV???vis absorption, fluorescence, circular dichroism (CD) spectroscopy combined with multivariate curve resolution-alternating least-squares (MCR???ALS) and molecular docking studies. The concentration curves and the pure spectra of compositions (FA, ctDNA and FA???ctDNA complex) were obtained by MCR???ALS approach to verify and monitor the interaction of FA with ctDNA. The groove binding mode between FA and ctDNA was confirmed by the results of melting analysis, viscosity measurements, single-stranded DNA experiments, and competitive studies. The binding constant of FA???ctDNA complex was 4.87?×?10⁴ L mol^?1 at 298?K. The values of enthalpy (ΔH°) and entropy (ΔS°) changes in the interaction were ?16.24?kJ mol^?1 and 35.02?J mol^?1 K^?1, respectively, indicating that the main binding forces were hydrogen bonds and hydrophobic interactions. The result of CD spectra suggested that a decrease in right-handed helicity of ctDNA was induced by FA and the DNA conformational transition from the B-form to the A-form. The results of docking indicated that FA binding with ctDNA in the minor groove. These findings may be conducive to understand the interaction mechanism of FA with ctDNA and the pharmacological effects of FA.

Communicated by Ramaswamy H. Sarma

     

Capecitabine as a minor groove binder of DNA: molecular docking,molecular dynamics,and multi-spectroscopic studies

The interaction mechanism and binding mode of capecitabine with ctDNA was extensively investigated using docking and molecular dynamics simulations, fluorescence and circular dichroism (CD) spectroscopy, DNA thermal denaturation studies, and viscosity measurements. The possible binding mode and acting forces on the combination between capecitabine and DNA had been predicted through molecular simulation. Results indicated that capecitabine could relatively locate stably in the G-C base-pairs-rich DNA minor groove by hydrogen bond and several weaker nonbonding forces. Fluorescence spectroscopy and fluorescence lifetime measurements confirmed that the quenching was static caused by ground state complex formation. This phenomenon indicated the formation of a complex between capecitabine and ctDNA. Fluorescence data showed that the binding constants of the complex were approximately 2 × 10⁴ M^?1. Calculated thermodynamic parameters suggested that hydrogen bond was the main force during binding, which were consistent with theoretical results. Moreover, CD spectroscopy, DNA melting studies, and viscosity measurements corroborated a groove binding mode of capecitabine with ctDNA. This binding had no effect on B-DNA conformation.     

Characterization of the binding of paylean and DNA by fluorescence,UV spectroscopy and molecular docking techniques

The interaction of paylean (PL) with calf thymus DNA (ctDNA) was investigated using fluorescence spectroscopy, UV absorption, melting studies, ionic strength, viscosity experiments and molecular docking under simulated physiological conditions. Values for the binding constant K_a between PL and DNA were 5.11 × 10³, 2.74 × 10³ and 1.74 × 10³ L mol^–1 at 19, 29 and 39°C respectively. DNA quenched the intrinsic fluorescence of PL via a static quenching procedure as shown from Stern–Volmer plots. The relative viscosity and the melting temperature of DNA were basically unchanged in the presence of PL. The fluorescence intensity of PL–DNA decreased with increasing ionic strength. The value of K_a for PL with double‐stranded DNA (dsDNA) was larger than that for PL with single‐stranded DNA (ssDNA). All the results revealed that the binding mode was groove binding, and molecular docking further indicated that PL was preferentially bonded to A–T‐rich regions of DNA. The values for ΔH, ΔS and ΔG suggested that van der Waals forces or hydrogen bonding might be the main acting forces between PL and DNA. The binding distance was determined to be 3.37 nm based on the theory of Förster energy transference, which indicated that a non‐radiation energy transfer process occurred. Copyright © 2015 John Wiley & Sons, Ltd.     

Binding properties of palmatine to DNA: spectroscopic and molecular modeling investigations

Palmatine, an isoquinoline alkaloid, is an important medicinal herbal extract with diverse pharmacological and biological properties. In this work, spectroscopic and molecular modeling approaches were employed to reveal the interaction between palmatine and DNA isolated from herring sperm. The absorption spectra and iodide quenching results indicated that groove binding was the main binding mode of palmatine to DNA. Fluorescence studies indicated that the binding constant (K) of palmatine and DNA was ~ 10⁴ L·mol^?1. The associated thermodynamic parameters, ΔG, ΔH, and ΔS, indicated that hydrogen bonds and van der Waals forces played major roles in the interaction. The effects of chemical denaturant, thermal denaturation and pH on the interaction were investigated and provided further support for the groove binding mode. In addition to experimental approaches, molecular modeling was conducted to verify binding pattern of palmatine–DNA. Copyright © 2015 John Wiley & Sons, Ltd.     

Multi-spectroscopic and molecular docking studies on the interaction of neotame with calf thymus DNA

Abstract

In this paper, we have studied the in vitro binding of neotame (NTM), an artificial sweetener, with native calf thymus DNA using different methods including spectrophotometric, spectrofluorometric, competition experiment, circular dichroism (CD), and viscosimetric techniques. From the spectrophotometric studies, the binding constant (K_b) of NTM-DNA was calculated to be 2?×?10³ M^?1. The quenching of the intrinsic fluorescence of NTM in the presence of DNA at different temperatures was also used to calculate binding constants (K_b) as well as corresponding number of binding sites (n). Moreover, the obtained results indicated that the quenching mechanism involves static quenching. By comparing the competitive fluorimetric studies with Hoechst 33258, as a known groove probe, and methylene blue, as a known intercalation probe, and iodide quenching experiments it was revealed that NTM strongly binds in the grooves of the DNA helix, which was further confirmed by CD and viscosimetric studies. In addition, a molecular docking method was employed to further investigate the binding interactions between NTM and DNA, and confirm the obtained results.     

Exploring the binding mode of donepezil with calf thymus DNA using spectroscopic and molecular docking methods

Donepezil (DNP) is one of approved drugs to treat Alzheimer's disease (AD). However, the potential effect of DNP on DNA is still unclear. Therefore, the interaction of DNP with calf thymus DNA (DNA) was studied in vitro using spectroscopic and molecular docking methods. Steady‐state and transient fluorescence experiments showed that there was a clear binding interaction between DNP and DNA, resulting from DNP fluorescence being quenched using DNA. DNP and DNA have one binding site between them, and the binding constant (K_b) was 0.78 × 10⁴ L·mol^?1 at 298 K. In this binding process, hydrophobic force was the main interaction force, because enthalpy change (ΔH) and entropy change (ΔS) of DNP–DNA were 67.92 kJ·mol^?1 and 302.96 J·mol^?1·K^?1, respectively. DNP bound to DNA in a groove‐binding mode, which was verified using a competition displacement study and other typical spectroscopic methods. Fourier transform infrared (FTIR) spectrum results showed that DNP interacted with guanine (G) and cytosine (C) bases of DNA. The molecular docking results further supported the results of spectroscopic experiments, and suggested that both Pi‐Sigma force and Pi‐Alkyl force were the major hydrophobic force functioning between DNP and DNA.     

Experimental and computational studies on the effects of valganciclovir as an antiviral drug on calf thymus DNA

DNA-binding properties of an antiviral drug, valganciclovir (valcyte) was studied by using emission, absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, and computational studies. The drug bound to calf thymus DNA (ct-DNA) in a groove-binding mode. The calculated binding constant of UV-vis, K_a, is comparable to groove-binding drugs. Competitive fluorimetric studies with Hoechst 33258 showed that valcyte could displace the DNA-bound Hoechst 33258. The drug could not displace intercalated methylene blue from DNA double helix. Furthermore, the induced detectable changes in the CD spectrum of ct-DNA as well as changes in its viscosity confirm the groove-binding mode. In addition, an integrated molecular docking was employed to further investigate the binding interactions between valcyte and calf thymus DNA.     

Micronomicin/tobramycin binding with DNA: fluorescence studies using of ethidium bromide as a probe and molecular docking analysis

Two aminoglycosides, micronomicin (MN), and tobramycin (TB), binding with DNA were studied using various spectroscopic techniques including fluorescence, UV–Vis, FT-IR, and CD spectroscopy coupled with relative viscosity and molecular docking. Studies of fluorescence quenching and time-resolved fluorescence spectroscopy all revealed that MN/TB quenching the fluorescence of DNA–EB belonged to static quenching. The binding constants and binding sites were obtained. The values of ΔH, ΔS, and ΔG suggested that van der Waals force or hydrogen bond might be the main binding force. FT-IR and CD spectroscopy revealed that the binding of MN/TB with DNA had an effect on the secondary structure of DNA. Binding mode of MN/TB with DNA was groove binding which was ascertained by viscosity measurements, CD spectroscopy, ionic strength, melting temperature (T_m), contrast experiments with single stranded (ssDNA), and double stranded DNA (dsDNA). Molecular docking analysis further confirmed that the groove binding was more acceptable result.     

Combined spectroscopic and molecular docking approach to probing binding interactions between lovastatin and calf thymus DNA

The binding interaction of lovastatin with calf thymus DNA (ct‐DNA) was studied using UV/Vis absorption spectroscopy, fluorescence emission spectroscopy, circular dichroism (CD), viscosity measurement and molecular docking methods. The experimental results showed that there was an obvious binding interaction of lovastatin with ct‐DNA and the binding constant (K_b) was 5.60 × 10³ M^–1 at 298 K. In the binding process of lovastatin with ct‐DNA, the enthalpy change (ΔH⁰) and entropy change (ΔS⁰) were –24.9 kJ/mol and –12.0 J/mol/K, respectively, indicating that the main binding interaction forces were van der Waal's force and hydrogen bonding. The molecular docking results suggested that lovastatin preferred to bind on the minor groove of different B‐DNA fragments and the conformation change of lovastatin in the lovastatin–DNA complex was obviously observed, implying that the flexibility of lovastatin molecule plays an important role in the formation of the stable lovastatin–ct‐DNA complex. Copyright © 2015 John Wiley & Sons, Ltd.     

New phthalimide‐appended Schiff bases: Studies of DNA binding,molecular docking and antioxidant activities

Herein, we investigated new phthalimide‐based Schiff base molecules as promising DNA‐binding and free radical scavenging agents. Physicochemical properties of these molecules were demonstrated on the basis of elemental analysis, ultraviolet–visible (UV–Vis), infra‐red (IR), ¹H and ¹³C nuclear magnetic resonance (NMR) spectroscopy. All spectral data are agreed well with the proposed Schiff base framework. The DNA‐binding potential of synthesized compounds were investigated by means of UV–visible, fluorescence, iodide quenching, circular dichroism, viscosity and thermal denaturation studies. The intrinsic binding constants (K _b) were calculated from absorption studies were found to be 1.1 × 10⁴ and 1.0 × 10⁴ M^?1 for compounds 2a and 2b suggesting that compound 2a binding abilities with DNA were stronger than the compound 2b. Our studies showed that the presented compounds interact with DNA through groove binding. Molecular docking studies were carried out to predict the binding between Ct‐DNA and test compounds. Interestingly, in silico predictions were corroborated with in vitro DNA‐binding conclusions. Furthermore, the title compounds displayed remarkable antioxidant activity compared with reference standard.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Interaction of procarbazine with calf thymus DNA—a biophysical and molecular docking study

Interaction of procarbazine (PCZ) with calf thymus DNA was studied using biophysical and molecular docking studies. Procarbazine was to interact with DNA with a binding constant of 6.52 × 10³ M⁻¹ as calculated using ultraviolet‐visible spectroscopy. To find out the binding mode, molecular docking was performed that predicted PCZ to interact with DNA through groove binding mode with binding affinity of −6.7 kcal/mole. To confirm the groove binding nature, different experiments were performed. Dye displacement assays confirmed the non‐intercalative binding mode. Procarbazine displaced Hoechst dye from the minor groove of DNA while it was unable to displace intercalating dyes. There was no increase in the viscosity of DNA solution in presence of PCZ. Also, negligible change in the secondary structure of DNA was observed in presence of PCZ as evident by circular dichroism spectra. Procarbazine caused decrease in the melting temperature of DNA possibly because of decrease in the stability of DNA caused by groove binding interaction of PCZ with DNA.     

Combined spectroscopies and molecular docking approach to characterizing the binding interaction of enalapril with bovine serum albumin

The binding interaction between bovine serum albumin (BSA) and enalapril (ENPL) at the imitated physiological conditions (pH = 7.4) was investigated using UV–vis absorption spectroscopy (UV–vis), fluorescence emission spectroscopy (FES), synchronous fluorescence spectroscopy (SFS), Fourier transform infrared spectroscopy (FT‐IR), circular dichroism (CD) and molecular docking methods. It can be deduced from the experimental results from the steady‐state fluorescence spectroscopic titration that the intrinsic BSA fluorescence quenching mechanism induced by ENPL is static quenching, based on the decrease in the BSA quenching constants in the presence of ENPL with increase in temperature and BSA quenching rates >10¹⁰ L mol^?1 sec^?1. This result indicates that the ENPL–BSA complex is formed through an intermolecular interaction of ENPL with BSA. The main bonding forces for interaction of BSA and ENPL are van der Waal's forces and hydrogen bonding interaction based on negative values of Gibbs free energy change (ΔG ⁰), enthalpic change (ΔH ⁰) and entropic change (ΔS ⁰). The binding of ENPL with BSA is an enthalpy‐driven process due to |ΔH °| > |T ΔS °| in the binding process. The results of competitive binding experiments and molecular docking confirm that ENPL binds in BSA sub‐domain IIA (site I) and results in a slight change in BSA conformation, but BSA still retains its α‐helical secondary structure.     

DNA-binding affinity,cytotoxicity, apoptosis,cell cycle inhibition and molecular docking studies of a new stilbene derivative

Stilbene derivatives have been found to possess promising anticancer activities against human cancer cell lines in vitro. In the present study, we have investigated cytotoxic, apoptosis induction and DNA binding activity of new stilbene derivative, (E)-1-(4-Chlorophenyl)-4,5-diphenyl-2-[4-(4-methoxystryl)phenyl]-1H-imidazol (STIM) on K562 chronic myeloid leukemia cell line. Via MTT assay STIM demonstrated cytotoxic activity against K562 cell line with IC₅₀ value of 150?µM. Apoptosis, as the mechanism of cell death, was evaluated by morphological study and flow cytometric analysis. In vitro DNA binding property of STIM has been studied by vital spectroscopic techniques, which indicated that STIM interact with ctDNA through groove binding mode and binding constant (K_b) was estimated to be 6.9?×?10⁴?M^?1. Docking studies revealed that hydrophobic is the most important interaction in STIM-DNA complex, and that the ligand (STIM) interacts with DNA via groove binding mode and the bindiyspng energy was calculated as ?13.37?kcal/mol. Taken together, the present study suggests that STIM exhibits anticancer effect on K562 cell line through the induction of apoptosis as well as cell cycle arrest at Sub-G1 phase and also can bind to double helix DNA in vitro.     

Biological interaction of thiamine with lysozyme using binding capacity concept and molecular docking

The binding of thiamine (vitamin B₁) on lysozyme has been examined at various ionic strengths of phosphate buffer (pH 6.9), various pH values, and various protein concentrations at 25°C using thiamine selective membrane electrode. This method is faster and more precise than equilibrium dialysis technique which can obtain sufficient and accurate data for binding analysis. The values of Hill equation parameters were estimated for each set using binding capacity concept and used for calculation of intrinsic binding affinity. The results represent two binding sets for thiamine on lysozyme at various experimental conditions.     

Molecular docking and spectroscopic studies on the interaction of new fifth-generation antibacterial drug ceftobiprole with calf thymus DNA

Abstract

The interaction of the cefobiprole drug with calf thymus DNA (ct-DNA) at physiological pH was investigated by UV-visible spectrophotometry, fluorescence measurement, dynamic viscosity measurements, circular dichroism spectroscopy and molecular modeling. The binding constant obtained of UV–visible was 4?×?10⁴ L mol^?1. Moreover, the results of circular dichroism (CD) and viscosity measurements displayed that the binding of the cefobiprole to ct-DNA can change the conformation of ct-DNA. Furthermore, thermodynamic parameters indicated that hydrogen bond and van der waals play main roles in the binding of cefobiprole to ct-DNA. Optimal results of docking, it can be concluded that ceftobiprole-DNA docked model is in approximate correlation with our experimental results.     

Characterization of the binding of neomycin/paromomycin sulfate with DNA using acridine orange as fluorescence probe and molecular docking technique

The binding of neomycin sulfate (NS)/paromomycin sulfate (PS) with DNA was investigated by fluorescence quenching using acridine orange (AO) as a fluorescence probe. Fluorescence lifetime, FT-IR, circular dichroism (CD), relative viscosity, ionic strength, DNA melting temperature, and molecular docking were performed to explore the binding mechanism. The binding constant of NS/PS and DNA was 6.70 × 10³/1.44 × 10³ L mol^?1 at 291 K. The values of ΔH^θ, ΔS^θ, and ΔG^θ suggested that van der Waals force or hydrogen bond might be the main binding force between NS/PS and DNA. The results of Stern–Volmer plots and fluorescence lifetime measurements all revealed that NS/PS quenching the fluorescence of DNA–AO was static in nature. FT-IR indicated that the interaction between DNA and NS/PS did occur. The relative viscosity and melting temperature of DNA were almost unchanged when NS/PS was introduced to the solution. The fluorescence intensity of NS/PS–DNA–AO was decreased with the increase in the ionic strength. For CD spectra of DNA, the intensity of positive band at nearly 275 nm was decreased and that of negative band at nearly 245 nm was increased with the increase in the concentration of NS/PS. The binding constant of NS/PS with double-stranded DNA (dsDNA) was larger than that of NS/PS with single-stranded DNA (ssDNA). From these studies, the binding mode of NS/PS with DNA was evaluated to be groove binding. The results of molecular docking further indicated that NS/PS could enter into the minor groove in the A–T rich region of DNA.