共查询到20条相似文献,搜索用时 125 毫秒
1.
2.
Banumathi Sankaran Shilah A. Bonnett Kinjal Shah Scott Gabriel Robert Reddy Paul Schimmel Dmitry A. Rodionov Valérie de Crécy-Lagard John D. Helmann Dirk Iwata-Reuyl Manal A. Swairjo 《Journal of bacteriology》2009,191(22):6936-6949
GTP cyclohydrolase I (GCYH-I) is an essential Zn2+-dependent enzyme that catalyzes the first step of the de novo folate biosynthetic pathway in bacteria and plants, the 7-deazapurine biosynthetic pathway in Bacteria and Archaea, and the biopterin pathway in mammals. We recently reported the discovery of a new prokaryotic-specific GCYH-I (GCYH-IB) that displays no sequence identity to the canonical enzyme and is present in ∼25% of bacteria, the majority of which lack the canonical GCYH-I (renamed GCYH-IA). Genomic and genetic analyses indicate that in those organisms possessing both enzymes, e.g., Bacillus subtilis, GCYH-IA and -IB are functionally redundant, but differentially expressed. Whereas GCYH-IA is constitutively expressed, GCYH-IB is expressed only under Zn2+-limiting conditions. These observations are consistent with the hypothesis that GCYH-IB functions to allow folate biosynthesis during Zn2+ starvation. Here, we present biochemical and structural data showing that bacterial GCYH-IB, like GCYH-IA, belongs to the tunneling-fold (T-fold) superfamily. However, the GCYH-IA and -IB enzymes exhibit significant differences in global structure and active-site architecture. While GCYH-IA is a unimodular, homodecameric, Zn2+-dependent enzyme, GCYH-IB is a bimodular, homotetrameric enzyme activated by a variety of divalent cations. The structure of GCYH-IB and the broad metal dependence exhibited by this enzyme further underscore the mechanistic plasticity that is emerging for the T-fold superfamily. Notably, while humans possess the canonical GCYH-IA enzyme, many clinically important human pathogens possess only the GCYH-IB enzyme, suggesting that this enzyme is a potential new molecular target for antibacterial development.The Zn2+-dependent enzyme GTP cyclohydrolase I (GCYH-I; EC 3.5.4.16) is the first enzyme of the de novo tetrahydrofolate (THF) biosynthesis pathway (Fig. (Fig.1)1) (38). THF is an essential cofactor in one-carbon transfer reactions in the synthesis of purines, thymidylate, pantothenate, glycine, serine, and methionine in all kingdoms of life (38), and formylmethionyl-tRNA in bacteria (7). Recently, it has also been shown that GCYH-I is required for the biosynthesis of the 7-deazaguanosine-modified tRNA nucleosides queuosine and archaeosine produced in Bacteria and Archaea (44), respectively, as well as the 7-deazaadenosine metabolites produced in some Streptomyces species (33). GCYH-I is encoded in Escherichia coli by the folE gene (28) and catalyzes the conversion of GTP to 7,8-dihydroneopterin triphosphate (55), a complex reaction that begins with hydrolytic opening of the purine ring at C-8 of GTP to generate an N-formyl intermediate, followed by deformylation and subsequent rearrangement and cyclization of the ribosyl moiety to generate the pterin ring in THF (Fig. (Fig.1).1). Notably, the enzyme is dependent on an essential active-site Zn2+ that serves to activate a water molecule for nucleophilic attack at C-8 in the first step of the reaction (2).Open in a separate windowFIG. 1.Reaction catalyzed by GCYH-I, and metabolic fate of 7,8-dihydroneopterin triphosphate.A homologous GCYH-I is found in mammals and other higher eukaryotes, where it catalyzes the first step of the biopterin (BH4) pathway (Fig. (Fig.1),1), an essential cofactor in the biosynthesis of tyrosine and neurotransmitters, such as serotonin and l-3,4-dihydroxyphenylalanine (3, 52). Recently, a distinct class of GCYH-I enzymes, GCYH-IB (encoded by the folE2 gene), was discovered in microbes (26% of sequenced Bacteria and most Archaea) (12), including several clinically important human pathogens, e.g., Neisseria and Staphylococcus species. Notably, GCYH-IB is absent in eukaryotes.The distribution of folE (gene product renamed GCYH-IA) and folE2 (GCYH-IB) in bacteria is diverse (12). The majority of organisms possess either a folE (65%; e.g., Escherichia coli) or a folE2 (14%; e.g., Neisseria gonorrhoeae) gene. A significant number (12%; e.g., B. subtilis) possess both genes (a subset of 50 bacterial species is shown in Table Table1),1), and 9% lack both genes, although members of the latter group are mainly intracellular or symbiotic bacteria that rely on external sources of folate. The majority of Archaea possess only a folE2 gene, and the encoded GCYH-IB appears to be necessary only for the biosynthesis of the modified tRNA nucleoside archaeosine (44) except in the few halophilic Archaea that are known to synthesize folates, such as Haloferax volcanii, where GCYH-IB is involved in both archaeosine and folate formation (13, 44).
TABLE 1.
Distribution and candidate Zur-dependent regulation of alternative GCYH-I genes in bacteriaaOpen in a separate windowaGenes that are preceded by candidate Zur binding sites.bZur-regulated cluster is on the virulence plasmid pLVPK.cExamples of organisms with no folE genes are in boldface type.dZn-dependent regulation of B. subtilis folE2 by Zur was experimentally verified (17).Expression of the Bacillus subtilis folE2 gene, yciA, is controlled by the Zn2+-dependent Zur repressor and is upregulated under Zn2+-limiting conditions (17). This led us to propose that the GCYH-IB family utilizes a metal other than Zn2+ to allow growth in Zn2+-limiting environments, a hypothesis strengthened by the observation that an archaeal ortholog from Methanocaldococcus jannaschii has recently been shown to be Fe2+ dependent (22). To test this hypothesis, we investigated the physiological role of GCYH-IB in B. subtilis, an organism that contains both isozymes, as well as the metal dependence of B. subtilis GCYH-IB in vitro. To gain a structural understanding of the metal dependence of GCYH-IB, we determined high-resolution crystal structures of Zn2+- and Mn2+-bound forms of the N. gonorrhoeae ortholog. Notably, although the GCYH-IA and -IB enzymes belong to the tunneling-fold (T-fold) superfamily, there are significant differences in their global and active-site architecture. These studies shed light on the physiological significance of the alternative folate biosynthesis isozymes in bacteria exposed to various metal environments, and offer a structural understanding of the differential metal dependence of GCYH-IA and -IB. 相似文献3.
Pablo I. Nikel Andrea M. Giordano Alejandra de Almeida Manuel S. Godoy M. Julia Pettinari 《Applied and environmental microbiology》2010,76(22):7400-7406
The effect of eliminating d-lactate synthesis in poly(3-hydroxybutyrate) (PHB)-accumulating recombinant Escherichia coli (K24K) was analyzed using glycerol as a substrate. K24KL, an ldhA derivative, produced more biomass and had altered carbon partitioning among the metabolic products, probably due to the increased availability of carbon precursors and reducing power. This resulted in a significant increase of PHB and ethanol synthesis and a decrease in acetate production. Cofactor measurements revealed that cultures of K24K and K24KL had a high intracellular NADPH content and that the NADPH/NADP+ ratio was higher than the NADH/NAD+ ratio. The ldhA mutation affected cofactor distribution, resulting in a more reduced intracellular state, mainly due to a further increase in NADPH/NADP+. In 60-h fed-batch cultures, K24KL reached 41.9 g·liter−1 biomass and accumulated PHB up to 63% ± 1% (wt/wt), with a PHB yield on glycerol of 0.41 ± 0.03 g·g−1, the highest reported using this substrate.Poly(3-hydroxybutyrate) (PHB) is the best-known and most common polyhydroxyalkanoate (PHA). PHAs are polymers with thermoplastic properties that are totally biodegradable by microorganisms present in most environments and that can be produced from different renewable carbon sources (38). Accumulated as intracellular granules by many bacteria under unfavorable conditions (1, 21), PHAs are carbon and energy reserves and also act as electron sinks, enhancing the fitness and stress resistance of bacteria and contributing to redox balance (12, 30). Escherichia coli offers a well-defined physiological environment for the construction and manipulation of various metabolic pathways to produce different bioproducts, such as PHB, from cost-effective carbon sources.In recent years, a significant increase in the production of biodiesel has caused a sharp fall in the cost of glycerol, the main by-product of biodiesel synthesis. As a result, glycerol has become a very attractive substrate for bacterial fermentations (10), specially for reduced products, such as PHB (36). The E. coli strain used in this work, K24K, carries phaBAC, the structural genes responsible for PHB synthesis, from Azotobacter sp. strain FA8 (23) (Table (Table1).1). The pha genes in K24K are expressed from a chimeric promoter and consequently are not subject to the genetic regulatory systems present in natural PHA producers. Because of this, it can be assumed that regulation of PHA synthesis in the recombinants is restricted by enzyme activity levels, modulated principally by substrate availability. In most natural producers, and also in PHB-producing E. coli recombinants, PHB is synthesized through the condensation of two molecules of acetyl-coenzyme A (acetyl-CoA), catalyzed by an acetoacetyl-CoA transferase or 3-ketothiolase, resulting in acetoacetyl-CoA. This compound is subsequently reduced by an NAD(P)H-dependent acetoacetyl-CoA reductase to R-(−)-3-hydroxybutyryl-CoA, which is then polymerized by a specific PHA synthase (34).
Open in a separate windowaStrain obtained through the E. coli Genetic Stock Center, Yale University, New Haven, CT.bFor oligonucleotides, the ATG codon of ldhA is underlined and the sequences with homology to FRT-kan-FRT in the template plasmid pKD4 (11) are shown in boldface.Cells growing on glycerol are in a more reduced intracellular state than cells grown on glucose under similar conditions of oxygen availability. This has a significant effect on the intracellular redox state, which causes the cells to direct carbon flow toward the synthesis of more-reduced products when glycerol is used than when glucose is used in order to achieve redox balance (31). When metabolic product distribution was analyzed in bioreactor cultures of K24K using glucose or glycerol as the substrate, product distributions with the two substrates were found to be different, as glycerol-grown cultures produced smaller amounts of acetate, lactate, and formate and more ethanol than those grown on glucose. However, PHB production from glycerol was lower than that from glucose, except under conditions of low oxygen availability (13).Manipulations to enhance the synthesis of a metabolic product include several approaches to increase the availability of the substrates needed for its formation or to inhibit competing pathways. The effect of eliminating competing pathways on PHB production from glucose has been investigated through the inactivation of different genes, such as those encoding enzymes participating in the synthesis of acetate (ackA, pta, and poxB) or d-lactate (ldhA). A pta mutant, which produces very little acetate (6), and an frdA ldhA double mutant (40) had increased PHB accumulation from glucose. A recent report using an ackA pta poxB ldhA adhE mutant under microaerobic conditions attained similar results (17). The inactivation of ldhA has also been shown to have an important effect on the metabolic product distribution in recombinant E. coli with glycerol as the carbon source, promoting ethanol synthesis (28). In the present work we analyzed the effect of ldhA inactivation in strain K24K using glycerol as the carbon source, with special emphasis on changes in carbon distribution and in the intracellular redox state, determined through cofactor levels. 相似文献
TABLE 1.
E. coli strains, plasmids, and oligonucleotides used in this studyStrain, plasmid, or oligonucleotide | Relevant characteristicsb | Reference or source |
---|---|---|
E. coli strains | ||
K1060a | F−fadE62 lacI60 tyrT58(AS) fabB5 mel-1 | 29 |
K24 | Same as K1060, carrying pJP24; Apr | 23 |
K24K | Same as K1060, carrying pJP24K; Apr Kmr | 23 |
ALS786a | F− λ−rph-1 ΔldhA::kan; Kmr | 14 |
K24LT | Same as K1060 but ΔldhA::kan by K1060 × P1(ALS786), carrying pJP24; Apr Kmr | This work |
K24KL | Same as K1060 but ΔldhA by allelic replacement, carrying pJP24K; Kmr | This work |
TA3522a | F− λ− Δ(his-gnd)861 hisJo-701 | 2 |
TA3514a | Same as TA3522 but pta-200 | 19 |
TA3522L | Same as TA3522 but ΔldhA::kan by TA3522 × P1(ALS786); Kmr | This work |
TA3514L | Same as TA3514 but ΔldhA::kan by TA3514 × P1(ALS786); Kmr | This work |
Plasmids | ||
pQE32 | Expression vector, ColE1 ori; Apr | Qiagen GmbH, Hilden, Germany |
pJP24 | pQE32 derivative expressing a 4.3-kb BamHI-HindIII insert containing the phaBAC genes from Azotobacter sp. strain FA8 under the control of a T5 promoter/lac operator element; Apr | 23 |
pJP24K | pJP24 derivative; Apr Kmr | 23 |
pCP20 | Helper plasmid used for kan excision; Saccharomyces cerevisiae FLP λ cI857 λ PRrepA(Ts); Apr Cmr | 7 |
Oligonucleotides | ||
ΔldhA-F | 5′-TAT TTT TAG TAG CTT AAA TGT GAT TCA ACA TCA CTG GAG AAA GTC TTA TGG TGT AGG CTG GAG CTG CTT C-3′ | This work |
ΔldhA-R | 5′-CTC CCC TGG AAT GCA GGG GAG CGG CAA GAT TAA ACC AGT TCG TTC GGG CAC ATA TGA ATA TCC TCC TTA G-3′ | This work |
4.
Chris A. Whitehouse Carson Baldwin Rangarajan Sampath Lawrence B. Blyn Rachael Melton Feng Li Thomas A. Hall Vanessa Harpin Heather Matthews Marina Tediashvili Ekaterina Jaiani Tamar Kokashvili Nino Janelidze Christopher Grim Rita R. Colwell Anwar Huq 《Applied and environmental microbiology》2010,76(6):1996-2001
5.
6.
Pamela R. Hall Brian Hjelle Hadya Njus Chunyan Ye Virginie Bondu-Hawkins David C. Brown Kathleen A. Kilpatrick Richard S. Larson 《Journal of virology》2009,83(17):8965-8969
Specific therapy is not available for hantavirus cardiopulmonary syndrome caused by Andes virus (ANDV). Peptides capable of blocking ANDV infection in vitro were identified using antibodies against ANDV surface glycoproteins Gn and Gc to competitively elute a cyclic nonapeptide-bearing phage display library from purified ANDV particles. Phage was examined for ANDV infection inhibition in vitro, and nonapeptides were synthesized based on the most-potent phage sequences. Three peptides showed levels of viral inhibition which were significantly increased by combination treatment with anti-Gn- and anti-Gc-targeting peptides. These peptides will be valuable tools for further development of both peptide and nonpeptide therapeutic agents.Andes virus (ANDV), an NIAID category A agent linked to hantavirus cardiopulmonary syndrome (HCPS), belongs to the family Bunyaviridae and the genus Hantavirus and is carried by Oligoryzomys longicaudatus rodents (11). HCPS is characterized by pulmonary edema caused by capillary leak, with death often resulting from cardiogenic shock (9, 16). ANDV HCPS has a case fatality rate approaching 40%, and ANDV is the only hantavirus demonstrated to be capable of direct person-to-person transmission (15, 21). There is currently no specific therapy available for treatment of ANDV infection and HCPS.Peptide ligands that target a specific protein surface can have broad applications as therapeutics by blocking specific protein-protein interactions, such as preventing viral engagement of host cell receptors and thus preventing infection. Phage display libraries provide a powerful and inexpensive tool to identify such peptides. Here, we used selection of a cyclic nonapeptide-bearing phage library to identify peptides capable of binding the transmembrane surface glycoproteins of ANDV, Gn and Gc, and blocking infection in vitro.To identify peptide sequences capable of recognizing ANDV, we panned a cysteine-constrained cyclic nonapeptide-bearing phage display library (New England Biolabs) against density gradient-purified, UV-treated ANDV strain CHI-7913 (a gift from Hector Galeno, Santiago, Chile) (17, 18). To increase the specificity of the peptides identified, we eluted phage by using monoclonal antibodies (Austral Biologicals) prepared against recombinant fragments of ANDV Gn (residues 1 to 353) or Gc (residues 182 to 491) glycoproteins (antibodies 6B9/F5 and 6C5/D12, respectively). Peptide sequences were determined for phage from iterative rounds of panning, and the ability of phage to inhibit ANDV infection of Vero E6 cells was determined by immunofluorescent assay (IFA) (7). Primary IFA detection antibodies were rabbit polyclonal anti-Sin Nombre hantavirus (SNV) nucleoprotein (N) antibodies which exhibit potent cross-reactivity against other hantavirus N antigens (3). ReoPro, a commercially available Fab fragment which partially blocks infection of hantaviruses in vitro by binding the entry receptor integrin β3 (5), was used as a positive control (80 μg/ml) along with the original antibody used for phage elution (5 μg/ml). As the maximum effectiveness of ReoPro in inhibiting hantavirus entry approaches 80%, we set this as a threshold for maximal expected efficacy for normalization. The most-potent phage identified by elution with the anti-Gn antibody 6B9/F5 bore the peptide CPSNVNNIC and inhibited hantavirus entry by greater than 60% (61%) (Table (Table1).1). From phage eluted with the anti-Gc antibody 6C5/D12, those bearing peptides CPMSQNPTC and CPKLHPGGC also inhibited entry by greater than 60% (66% and 72%, respectively).
Open in a separate windowaStandard deviations of four experiments are shown in parentheses. Peptide-bearing phage were added at 109 phage/μl.bP values for the pairwise amino acid alignment score of each peptide versus that of integrin β3 were determined using an unpaired Student''s t test. P values considered statistically significant are shown in bold.To determine whether the peptide sequences of any of the identified inhibitory phage showed homology to integrin β3, a known entry receptor for pathogenic hantaviruses (6, 7), we used the Gap program to perform a pairwise amino acid alignment of each peptide versus the extracellular portion of integrin β3 and determined P values for the alignments. Of 45 phage eluted with the anti-Gn antibody, 6B9/F5, 27 of the peptide sequences showed homology to integrin β3 (P < 0.05), and 9 were highly significant (P ≤ 0.0005) (Fig. (Fig.1A).1A). Of the latter, CKFPLNAAC and CSQFPPRLC map to the hybrid domain (Fig. (Fig.1B),1B), which is proximal to the plexin-semaphorin-integrin domain (PSI) containing residue D39, shown to be critical for viral entry in vitro (19). Five sequences (CPSSPFNH, CPKHVLKVC, CNANKPKMC, CQSQTRNHC, and CDQRTTRLC) map to the I-like (or βA) domain near the binding site of ReoPro (2). Finally, CLPTDPIQC maps to the epidermal growth factor 4 (EGF-4) domain, and CSTRAENQC aligns to a portion of β3 untraceable in the crystal structure, specifically the linker region between the hybrid domain and EGF-1. Although this represents a disordered portion of the protein (22), the location of this loop proximal to the PSI domain is worth noting, due to the role of the PSI domain in facilitating viral entry (19). Therefore, 60% of phage eluted with the anti-Gn antibody showed some homology to integrin β3, and those with highly significant P values predominantly mapped to or proximal to regions of known interest in viral entry.Open in a separate windowFIG. 1.Inhibitory peptides identified through phage panning against ANDV show homology to integrin β3. (A) Alignment of phage peptide sequences with P values for integrin β3 pairwise alignment of less than 0.05. Residues comprising the signal peptide, transmembrane, and cytoplasmic domains, which were not included during pairwise alignment, are underlined. Residues 461 to 548, which are missing in the crystal structure, are italicized. Residues involved in the ReoPro binding site are highlighted in green (2). Residue D39 of the PSI domain is highlighted in yellow (19). Peptides are shown above the sequence of integrin β3, with antibody 6C5/D12-eluted sequences shown in blue text and sequences eluted with antibody 6B9/F5 shown in red. Peptide sequences with alignment P values of ≤0.0005 are highlighted in yellow. Percent inhibition of the peptide-bearing phage is shown in parentheses. (B) View of integrin αvβ3 (PDB ID 1U8C [23]). αv is shown in blue ribbon diagram, and β3 is shown in salmon-colored surface representation, with specific domains circled. Residues corresponding to the ReoPro binding site are shown in green, as in panel A, and D39 is shown in yellow. Regions corresponding to 6C5/D12-eluted peptides with P values of ≤0.0005 for alignment with integrin β3 (highlighted in panel A) are shown in blue, and those corresponding to 6B9/F5-eluted peptides with P values of ≤0.0005 for alignment with integrin β3 are shown in red. Alignment of peptide PLASTRT (P value of 0.0040) adjacent to D39 of the PSI domain is shown in magenta. Graphics were prepared using Pymol (DeLano Scientific LLC, San Carlos, CA).Of the 41 peptide-bearing phage eluted with the anti-Gc antibody 6C5/D12, 14 showed sequence homology to integrin β3 (P < 0.05), 4 of which had P values of ≤0.0005 (Fig. (Fig.1A).1A). Of the latter, sequence CTTMTRMTC mapped to the base of the I-like domain (Fig. (Fig.1B),1B), while CHGVYALHC and CRDTTPWWC mapped to the EGF-3 domain. Finally, sequence CTPTMHNHC mapped to the linker region untraceable in the crystal structure. Therefore, in contrast to peptide sequences identified by competition with the anti-Gn antibody, sequences identified by competition with the anti-Gc antibody 6C5/D12 appear to be mostly unrelated to integrin β3.As a low level of pathogenic hantavirus infection can be seen in cells lacking integrin β3, such as CHO cells (19), we asked if any of the identified peptide sequences could represent a previously unidentified receptor. We used the Basic Local Alignment Search Tool to search a current database of human protein sequences for potential alternate receptors represented by these peptides. However, none of the alignments identified proteins that are expressed at the cell surface, eliminating them as potential candidates for alternate viral entry receptors. This suggests that the majority of the peptides identified here likely represent novel sequences for binding ANDV surface glycoproteins.To determine whether synthetic peptides would also block infection, we synthesized cyclic peptides based on the 10 most-potent peptide-bearing phage. These peptides, in the context of phage presentation, showed levels of inhibition ranging from 44 to 72% (Table (Table2).2). When tested by IFA at 1 mM, four of the synthetic peptides showed inhibition levels significantly lower than those of the same peptide presented in the context of phage. This is not surprising, as steric factors due to the size of the phage and the multivalent presentation of peptide in the context of phage may both contribute to infection inhibition (8). However, there was no significant difference in inhibition by synthetic peptide versus peptide-bearing phage for six of the sequences, implying that inhibition in the context of phage was due solely to the nature of the peptide itself and not to steric factors or valency considerations contributed by the phage, which contrasts with our previous results, determined by using phage directed against αvβ3 integrin (10).
Open in a separate windowaStandard deviations of the results of at least four experiments are shown in parentheses.bMean percent inhibition between phage and synthetic peptide differs significantly (P < 0.05).The three most-potent synthetic peptides were examined for their ability to inhibit ANDV entry in a dose-dependent manner. The concentration of each peptide that produces 50% of its maximum potential inhibitory effect was determined. As shown in Fig. Fig.2A,2A, the 50% inhibitory concentration for each of the peptides was in the range of 10 μM, which from our experience is a reasonable potency for a lead compound to take forward for optimization.Open in a separate windowFIG. 2.Activities of synthetic peptides in inhibition of ANDV infection in vitro. (A) Peptides were examined for their ability to block ANDV infection of Vero E6 cells in a dose-dependent manner by IFA. (B) Peptides were tested in parallel for the ability to block infection of Vero E6 cells by ANDV, SNV, HTNV, and PHV. (C) Peptides were tested, singly or in combination, for the ability to block ANDV infection of Vero E6 cells. For all experiments, controls included media, ReoPro at 80 μg/ml, and monoclonal antibodies 6C5/D12 and 6B9/F5 at 5 μg/ml. All peptides were used at 1 mM. Data points represent n = 2 to 6, with error bars showing the standard errors of the means. Statistical analyses were performed on replicate samples using an unpaired Student''s t test.In order to determine the specificity of the three most-potent synthetic cyclic peptides in blocking ANDV, we examined them for inhibition of ANDV infection versus two other pathogenic hantaviruses, SNV and Hantaan virus (HTNV), or the nonpathogenic hantavirus Prospect Hill virus (PHV). As shown in Fig. Fig.2B,2B, ReoPro, which binds integrin β3, showed inhibition of infection by each of the pathogenic hantavirus strains, known to enter cells via β3, but not the nonpathogenic PHV, which enters via integrin β1 (6, 7). In contrast, peptides selected for the ability to bind ANDV were highly specific inhibitors of ANDV versus SNV, HTNV, or PHV. The specificities of peptides eluted by the anti-Gn monoclonal antibody are not surprising, as they are likely due to global differences in the Gn amino acid sequence. Specifically, sequence homologies between ANDV and SNV, HTNV, and PHV are 61%, 36%, and 51%, respectively, for the region corresponding to the immunogen for antibody 6B9/F5. Although homology between the immunogen for antibody 6C5/D12 and the corresponding Gc region of these viruses is somewhat higher (82% with SNV, 63% with HTNV, and 71% with PHV), the possibility that the monoclonal antibody used here recognizes a three-dimensional epitope lends itself to the high specificity of the peptides.The current model for cellular infection by hantaviruses (14) is as follows. Viral binding of the host cell surface target integrin is followed by receptor-mediated endocytosis and endosome acidification. Lowered pH induces conformational changes in Gn and/or Gc, which facilitate membrane fusion and viral release into the cytosol. As there is currently little information available about whether one glycoprotein is dominant in mediating infection, and as neutralizing epitopes have been found on both Gn and Gc glycoproteins (1, 4, 12, 13, 20), we examined whether combining anti-Gn- and anti-Gc-targeted synthetic peptides would lead to an increased infection blockade compared to those for single treatments. As shown in Fig. Fig.2C,2C, the combination of anti-Gn and anti-Gc peptides CMQSAAAHC and CTVGPTRSC resulted in a significant increase in infection inhibition (P = 0.0207 for CMQSAAAHC, and P = 0.0308 for CTVGPTRSC) compared to that resulting from single treatments. Although the high specificity of the peptides for ANDV makes it unlikely that this combination treatment will lead to more cross-reactivity with other pathogenic hantaviruses, this can be determined only by additional testing. Regardless, these data suggest a unique role for each of these viral proteins in the infection process as well as the benefits of targeting multiple viral epitopes for preventing infection.To our knowledge, the peptides reported here are the first identified that directly target ANDV, and this work further illustrates the power of coupling phage display and selective elution techniques in the identification of novel peptide sequences capable of specific protein-protein interactions from a large, random pool of peptide sequences. These novel peptide inhibitors (R. S. Larson, P. R. Hall, H. Njus, and B. Hjelle, U.S. patent application 61/205,211) provide leads for the development of more-potent peptide or nonpeptide organics for therapeutic use against HCPS. 相似文献
TABLE 1.
Peptide-bearing phage eluted from ANDVPhage | % Inhibition (SD)a | P valueb |
---|---|---|
Phage bearing the following peptides eluted with anti-Gn antibody 6B9/F5 | ||
Group 1 (<30% inhibition) | ||
CDQRTTRLC | 8.45 (15.34) | 0.0002 |
CPHDPNHPC | 9.94 (7.72) | 0.333 |
CQSQTRNHC | 11.76 (13.25) | 0.0001 |
CLQDMRQFC | 13.26 (9.92) | 0.0014 |
CLPTDPIQC | 15.70 (14.05) | 0.0005 |
CPDHPFLRC | 16.65 (15.22) | 0.8523 |
CSTRAENQC | 17.56 (16.50) | 0.0004 |
CPSHLDAFC | 18.98 (20.06) | 0.0017 |
CKTGHMRIC | 20.84 (7.47) | 0.0563 |
CVRTPTHHC | 20.89 (27.07) | 0.1483 |
CSGVINTTC | 21.57 (19.61) | 0.0643 |
CPLASTRTC | 21.65 (5.98) | 0.004 |
CSQFPPRLC | 22.19 (8.26) | 0.0004 |
CLLNKQNAC | 22.34 (7.78) | 0.001 |
CKFPLNAAC | 22.89 (6.15) | 0.0001 |
CSLTPHRSC | 23.63 (16.74) | 0.0563 |
CKPWPMYSC | 23.71 (6.68) | 0.0643 |
CLQHDALNC | 24.01 (7.60) | 1 |
CNANKPKMC | 24.67 (11.67) | 0.0004 |
CPKHVLKVC | 25.30 (28.36) | 0.0003 |
CTPDKKSFC | 26.91 (11.15) | 0.399 |
CHGKAALAC | 27.22 (32.53) | 0.005 |
CNLMGNPHC | 28.08 (21.35) | 0.0011 |
CLKNWFQPC | 28.64 (18.49) | 0.0016 |
CKEYGRQMC | 28.76 (29.33) | 0.0362 |
CQPSDPHLC | 29.44 (31.22) | 0.0183 |
CSHLPPNRC | 29.70 (17.37) | 0.0061 |
Group 2 (30-59% inhibition) | ||
CSPLLRTVC | 33.05 (20.26) | 0.0023 |
CHKGHTWNC | 34.17 (12.50) | 0.0795 |
CINASHAHC | 35.62 (13.03) | 0.3193 |
CWPPSSRTC | 36.75 (26.95) | 0.0006 |
CPSSPFNHC | 37.78 (7.11) | 0.0001 |
CEHLSHAAC | 38.47 (7.60) | 0.0115 |
CQDRKTSQC | 38.74 (9.12) | 0.1802 |
CTDVYRPTC | 38.90 (25.03) | 0.006 |
CGEKSAQLC | 39.11 (27.52) | 0.0013 |
CSAAERLNC | 40.13 (6.33) | 0.0033 |
CFRTLEHLC | 42.07 (5.01) | 0.0608 |
CEKLHTASC | 43.60 (27.92) | 0.1684 |
CSLHSHKGC | 45.11 (49.81) | 0.0864 |
CNSHSPVHC | 45.40 (28.80) | 0.0115 |
CMQSAAAHC | 48.88 (44.40) | 0.5794 |
CPAASHPRC | 51.84 (17.09) | 0.1935 |
CKSLGSSQC | 53.90 (13.34) | 0.0145 |
Group 3 (60-79% inhibition) | ||
CPSNVNNIC | 61.11 (25.41) | 0.1245 |
Negative control | 0 (6.15) | |
6B9/F5 (5 μg/ml) | 26.77 (5.33) | |
ReoPro (80 μg/ml) | 79.86 (4.88) | |
Phage bearing the following peptides eluted with anti-Gc antibody 6C5/D12 | ||
Group 1 (<30% inhibition) | ||
CHPGSSSRC | 1.01 (7.03) | 0.0557 |
CSLSPLGRC | 10.56 (13.62) | 0.7895 |
CTARYTQHC | 12.86 (3.83) | 0.3193 |
CHGVYALHC | 12.91 (7.32) | 0.0003 |
CLQHNEREC | 16.79 (13.72) | 0.0958 |
CHPSTHRYC | 17.23 (14.53) | 0.0011 |
CPGNWWSTC | 19.34(9.91) | 0.1483 |
CGMLNWNRC | 19.48 (19.42) | 0.0777 |
CPHTQFWQC | 20.44 (13.65) | 0.0008 |
CTPTMHNHC | 20.92 (11.68) | 0.0001 |
CDQVAGYSC | 21.79 (23.60) | 0.0063 |
CIPMMTEFC | 24.33 (9.28) | 0.2999 |
CERPYSRLC | 24.38 (9.09) | 0.0041 |
CPSLHTREC | 25.06 (22.78) | 0.1202 |
CSPLQIPYC | 26.30 (34.29) | 0.4673 |
CTTMTRMTC (×2) | 29.27 (8.65) | 0.0001 |
Group 2 (30-59% inhibition) | ||
CNKPFSLPC | 30.09 (5.59) | 0.4384 |
CHNLESGTC | 31.63 (26.67) | 0.751 |
CNSVPPYQC | 31.96 (6.51) | 0.0903 |
CSDSWLPRC | 32.95 (28.54) | 0.259 |
CSAPFTKSC | 33.40 (10.64) | 0.0052 |
CEGLPNIDC | 35.63 (19.90) | 0.0853 |
CTSTHTKTC | 36.28 (13.42) | 0.132 |
CLSIHSSVC | 36.40 (16.44) | 0.8981 |
CPWSTQYAC | 36.81 (32.81) | 0.5725 |
CTGSNLPIC | 36.83 (31.64) | 0.0307 |
CSLAPANTC | 39.73 (4.03) | 0.1664 |
CGLKTNPAC | 39.75 (16.98) | 0.2084 |
CRDTTPWWC | 40.08 (18.52) | 0.0004 |
CHTNASPHC | 40.26 (4.77) | 0.5904 |
CTSMAYHHC | 41.89 (8.61) | 0.259 |
CSLSSPRIC | 42.13 (29.75) | 0.2463 |
CVSLEHQNC | 45.54 (6.55) | 0.5065 |
CRVTQTHTC | 46.55 (8.45) | 0.3676 |
CPTTKSNVC | 49.28 (14.00) | 0.3898 |
CSPGPHRVC | 49.50 (42.60) | 0.0115 |
CKSTSNVYC | 51.20 (4.60) | 0.0611 |
CTVGPTRSC | 57.30 (11.31) | 0.0176 |
Group 3 (60-79% inhibition) | ||
CPMSQNPTC | 65.60 (13.49) | 0.014 |
CPKLHPGGC | 71.88 (27.11) | 0.0059 |
Negative control | 0.26 (4.53) | |
6C5/D12 (5 μg/ml) | 22.62 (8.40) | |
ReoPro (80 μg/ml) | 80.02 (76.64) |
TABLE 2.
Synthetic cyclic peptides inhibit ANDV infectionTarget | Sample | % Inhibition bya:
| |
---|---|---|---|
Peptide-bearing phage | Synthetic peptide | ||
Gn | CMQSAAAHC | 48.88 (44.40) | 59.66 (11.17) |
Gc | CTVGPTRSC | 57.30 (11.31) | 46.47 (7.61) |
Gn | CPSNVNNIC | 61.11 (25.41) | 44.14 (10.74) |
Gn | CEKLHTASC | 43.60 (27.92) | 34.87 (9.26) |
Gc | CPKLHPGGC | 71.88 (27.11) | 30.95 (7.73)b |
Gn | CSLHSHKGC | 45.11 (49.81) | 29.79 (9.34) |
Gc | CPMSQNPTC | 65.60 (13.49) | 18.19 (8.55)b |
Gn | CKSLGSSQC | 53.90 (13.34) | 18.10 (7.55)b |
Gn | CNSHSPVHC | 45.40 (28.80) | 15.52 (10.48) |
Gn | CPAASHPRC | 51.84 (17.09) | 0 (10.72)b |
Integrin β3 | ReoPro | 80.10 (7.72) | |
Gn | 6B9/F5 antibody | 42.72 (6.75) | |
Gc | 6C5/D12 antibody | 31.04 (7.81) |
7.
Lutz Geue Sabrina Klare Christina Schnick Birgit Mintel Katharina Meyer Franz J. Conraths 《Applied and environmental microbiology》2009,75(21):6947-6953
Twelve cluster groups of Escherichia coli O26 isolates found in three cattle farms were monitored in space and time. Cluster analysis suggests that only some O26:H11 strains had the potential for long-term persistence in hosts and farms. As judged by their virulence markers, bovine enterohemorrhagic O26:H11 isolates may represent a considerable risk for human infection.Shiga toxin (Stx)-producing Escherichia coli (STEC) strains comprise a group of zoonotic enteric pathogens (42). In humans, infections with some STEC serotypes result in hemorrhagic or nonhemorrhagic diarrhea, which can be complicated by hemolytic-uremic syndrome (HUS) (49). These STEC strains are also designated “enterohemorrhagic E. coli” (EHEC). Consequently, EHEC strains represent a subgroup of STEC with a high pathogenic potential for humans. Strains of the E. coli serogroup O26 were originally classified as enteropathogenic E. coli due to their association with outbreaks of infantile diarrhea in the 1940s. In 1977, Konowalchuk et al. (37) recognized that these bacteria produced Stx, and 10 years later, the Stx-producing E. coli O26:H11/H− strains were classified as EHEC. EHEC O26 strains constitute the most common non-O157 EHEC group associated with diarrhea and HUS in Europe (12, 21, 23, 24, 26, 27, 55, 60). Reports on an association between EHEC O26 and HUS or diarrhea from North America including the United States (15, 30, 33), South America (51, 57), Australia (22), and Asia (31, 32) provide further evidence for the worldwide spread of these organisms. Studies in Germany and Austria (26, 27) on sporadic HUS cases between 1996 and 2003 found that EHEC O26 accounted for 14% of all EHEC strains and for ∼40% of non-O157 EHEC strains obtained from these patients. A proportion of 11% EHEC O26 strains was detected in a case-control study in Germany (59) between 2001 and 2003. In the age group <3 years, the number of EHEC O26 cases was nearly equal to that of EHEC O157 cases, although the incidence of EHEC O26-associated disease is probably underestimated because of diagnostic limitations in comparison to the diagnosis of O157:H7/H− (18, 34). Moreover, EHEC O26 has spread globally (35). Beutin (6) described EHEC O26:H11/H−, among O103:H2, O111:H, O145:H28/H−, and O157:H7/H−, as the well-known pathogenic “gang of five,” and Bettelheim (5) warned that we ignore the non-O157 STEC strains at our peril.EHEC O26 strains produce Stx1, Stx2, or both (15, 63). Moreover, these strains contain the intimin-encoding eae gene (11, 63), a characteristic feature of EHEC (44). In addition, EHEC strains possess other markers associated with virulence, such as a large plasmid that carries further potential virulence genes, e.g., genes coding for EHEC hemolysin (EHEC-hlyA), a catalase-peroxidase (katP), and an extracellular serine protease (espP) (17, 52). The efa1 (E. coli factor for adherence 1) gene was identified as an intestinal colonization factor in EHEC (43). EHEC O26 represents a highly dynamic group of organisms that rapidly generate new pathogenic clones (7, 8, 63).Ruminants, especially cattle, are considered the primary reservoir for human infections with EHEC. Therefore, the aim of this study was the molecular characterization of bovine E. coli field isolates of serogroup O26 using a panel of typical virulence markers. The epidemiological situation in the beef herds from which the isolates were obtained and the spatial and temporal behavior of the clonal distribution of E. coli serogroup O26 were analyzed during the observation period. The potential risk of the isolates inducing disease in humans was assessed.In our study, 56 bovine E. coli O26:H11 isolates and one bovine O26:H32 isolate were analyzed for EHEC virulence-associated factors. The isolates had been obtained from three different beef farms during a long-term study. They were detected in eight different cattle in farm A over a period of 15 months (detected on 10 sampling days), in 3 different animals in farm C over a period of 8 months (detected on 3 sampling days), and in one cow on one sampling day in farm D (Table (Table1)1) (28).
Open in a separate windowastx1/stx2, gene stx1 or stx2.befa1 was detected by two hybridizations (with lifA1-lifA2 and lifA3-lifA4 probes). +/+, complete gene; +/− or −/+, incomplete gene; −/−, efa1 negative.The serotyping of the O26 isolates was confirmed by the results of the fliC PCR-restriction fragment length polymorphism (RFLP) analysis performed according to Fields et al. (25), with slight modifications described by Zhang et al. (62). All O26:H11 isolates showed the H11 pattern described by Zhang et al. (62). In contrast, the O26:H32 isolate demonstrated a different fliC RFLP pattern that was identical to the H32 pattern described by the same authors. It has been demonstrated that EHEC O26:H11 strains belong to at least four different sequence types (STs) in the common clone complex 29 (39). In the multilocus sequence typing analysis for E. coli (61), the tested five EHEC O26:H11 isolates (WH-01/02/003-1, WH-01/20/005-3, WH-01/27/009-9, WH-03/14/004-8, and WH-04/22/001-1) of different farms and clusters were characterized as two sequence types (ST 21 and ST 396). The isolates from farms A and C belong to ST 21, the most frequent ST of EHEC O26:H11 isolates found in humans and animals (39), but the single isolate from farm D was characterized as ST 396.Typing and subtyping of genes (stx1 and/or stx2, eae, tir, espA, espB, EHEC-hlyA, katP, and espP) associated with EHEC were performed with LightCycler fluorescence PCR (48) and different block-cycler PCRs. To identify the subtypes of the stx2 genes and of the locus of enterocyte effacement-encoding genes eae, tir, espA, and espB, the PCR products were digested by different restriction endonucleases (19, 26, 46). The complete pattern of virulence markers was detected in most bovine isolates examined in our study. An stx1 gene was present in all O26 isolates. In addition, an stx2 gene was found in nine O26:H11 isolates in farm A and in three isolates of the same type in farm C, as well as in the O26:H32 isolate. Both Stx1 and Stx2 were closely related to families of Stx1 and Stx2 variants or alleles. EHEC isolates with stx2 genes are significantly more often associated with HUS and other severe disease manifestations than isolates with an stx1 gene, which are more frequently associated with uncomplicated diarrhea and healthy individuals (13). In contrast to STEC strains harboring stx2 gene variants, however, STEC strains of the stx2 genotype were statistically significantly associated with HUS (26). The stx2 genotype was found in all O26 isolates with an stx2 gene, while the GK3/GK4 amplification products after digestion with HaeIII and FokI restriction enzymes showed the typical pattern for this genotype described by Friedrich et al. (26). The nucleotide sequences of the A and B subunits of the stx2 gene of the selected bovine O26:H11 isolate WH-01/27/017-1 (GenBank accession no. ) were identical to the stx2 genes of different sorbitol-fermenting EHEC O157:H− strains associated with human HUS cases and other EHEC infections in Germany ( EU70049110) and 99.3% identical in their DNA sequences to the stx2 gene of the EHEC type strain EDL933, a typical O157:H7 isolate from an HUS patient. A characteristic stx1 genotype was present in all O26 isolates. The nucleotide sequences of the A and B subunits of the stx1 gene of the tested bovine O26:H11 isolate WH-01/27/017-1 (GenBank accession no. ) were nearly identical to those of the stx1 genes of the EHEC O26:H11 reference type strains H19 and DEC10B, which had been associated with human disease outbreaks in Canada and Australia. Nucleotide exchanges typical for stx1c and stx1d subtypes as described by Kuczius et al. ( EU70049038) were not found. All bovine O26:H11 strains produced an Stx1 with high cytotoxicity for Vero cells tested by Stx enzyme-linked immunosorbent assay and Vero cell neutralization assay (53). The Stx2 cytotoxicity for Vero cells was also very high in the O26:H11 isolates.Not only factors influencing the basic and inducible Stx production are important in STEC pathogenesis. It has been suggested that the eae and EHEC-hlyA genes are likely contributors to STEC pathogenicity (2, 3, 13, 50). Ritchie et al. (50) found both genes in all analyzed HUS-associated STEC isolates. In all O26:H11 isolates we obtained, stx genes were present in combination with eae genes. Only the O26:H32 isolate lacked an eae gene. To date, 10 distinct variants of eae have been described (1, 19, 36, 45, 47). Some serotypes were closely associated with a particular intimin variant: the O157 serogroup was linked to γ-eae, the O26 serogroup to β-eae, and the O103 serogroup to ɛ-eae (4, 19, 20, 58). Our study confirms these associations. All bovine O26:H11 isolates were also typed as members of the β-eae subgroup. A translocated intimin receptor gene (tir gene) and the type III secreted proteins encoded by the espA and espB genes were found in all 56 O26:H11 isolates but not in the O26:H32 isolate. These other tested locus of enterocyte effacement-associated genes belonged to the β-subgroups. These results are in accord with the results of China et al. (19), who detected the pathotypes β-eae, β-tir, β-espA, and β-espB in all investigated human O26 strains. Like the eae gene, the EHEC-hlyA gene was found in association with severe clinical disease in humans (52). Aldick et al. (2) showed that EHEC hemolysin is toxic (cytolytic) to human microvascular endothelial cells and may thus contribute to the pathogenesis of HUS. In our study, the EHEC-hlyA gene was detected in 50 of the 56 bovine E. coli O26:H11 isolates which harbored virulence-associated plasmids of different sizes (Table (Table1).1). The presence of virulence-associated plasmids corresponded to the occurrence of additional virulence markers such as the espP and katP genes (17). The katP gene and the espP gene were detected in 49 and 50 of the 56 O26:H11 isolates, respectively. The espP gene was missing in six of the seven bovine O26:H11 isolates in which the katP genes were also absent. Both genes were not found in the O26:H32 isolate (Table (Table1).1). Although we found large plasmids of the same size in O26:H11 isolates, they lacked one or more of the plasmid-associated virulence factors (Table (Table1).1). Two DNA probes were used to detect the efa1 genes by colony hybridization. (DNA probes were labeled with digoxigenin [DIG] with lifA1-lifA2 and lifA3-lifA4 primers [14] using the PCR DIG probe synthesis kit [Roche Diagnostics, Mannheim, Germany]; DIG Easy Hyb solution [Roche] was used for prehybridization and hybridization.) Positive results with both DNA probes were obtained for 52 of 56 E. coli O26:H11 isolates. A positive signal was only found in three isolates with the lifA1-lifA2 DNA probe and in one isolate with the lifA3-lifA4 probe. An efa1 gene was not detected in the O26:H32 isolate (Table (Table11).We also analyzed the spatial and temporal behavior of the O26:H11/H32 isolates in the beef herds by cluster analysis (conducted in PAUP* for Windows version 4.0, 2008 [http://paup.csit.fsu.edu/about.html]). This was performed with distance matrices using the neighbor-joining algorithm, an agglomerative cluster method which generates a phylogenetic tree. The distance matrices were calculated by pairwise comparisons of the fragmentation patterns produced by genomic typing through pulsed-field gel electrophoresis analysis with four restriction endonucleases (XbaI, NotI, BlnI, and SpeI) and the presence or absence of potential virulence markers (Fig. (Fig.11 and Table Table1).1). To this end, the total character difference was used, which counts the pairwise differences between two given patterns. During a monitoring program of 3 years in four cattle farms (29), different O26:H11 cluster groups and one O26:H32 isolate were detected in three different farms. The genetic distance of the O26:H32 isolate was very high relative to the O26:H11 isolates. Therefore, the O26:H32 isolate was outgrouped. The O26:H11 isolates of each farm represented independent cluster groups. The single isolate from farm D fitted better to the isolates from farm C than to those from farm A. This finding is in accord with the geographical distance between the farms. The fact that the farms were located in neighboring villages may suggest that direct or indirect connections between the farms were possible (e.g., by person contacts or animal trade). However, the isolates from farm C and farm D belonged to different sequence types (ST 21 and ST 396), which may argue against a direct connection. Interestingly, O26:H11 isolates with and without stx2 genes were detected in the same clusters. This phenomenon was observed in both farm A and farm C. In farm A, the isolates with additional stx2 genes were found in animal 27 and were grouped in clusters 8 and 9 (day 218). An stx2 gene was repeatedly found (four isolates) in the same animal (animal 27). The isolates grouped in cluster 8 on a later day of sampling (day 478). All other O26:H11 isolates grouped in the same clusters and obtained from the same animals (27 and 29) on different sampling days lacked an stx2 gene. Also, the isolates obtained from animal 27 on previous sampling days, which grouped in clusters 3 and 5, exhibited no stx2 genes. In farm C, the three isolates with additional stx2 genes obtained from animal 7 grouped in clusters 11 and 12. An stx2 gene was absent from all other O26:H11 isolates grouped in the same cluster 12 on later sampling days, and no other isolates of cluster 11 were found later on. However, we detected members of many clusters over relatively long periods (clusters 5, 8, and 9 in farm A and cluster 12 in farm C), but members of other clusters were only found on single occasions. This patchy temporal pattern is apparently not a unique property of O26:H11, as we found similar results for cluster groups of other EHEC serotypes of bovine origin (28). The isolates grouped in the dominant cluster 8 were found on 5 of 9 sampling days over a period of 10 months. In contrast, we found the members of clusters 4, 5, 9, and 12 only on two nonconsecutive sampling days. The period during which isolates of these groups were not detected was particularly long for cluster 4 (231 days). We also observed the coexistence of different clusters over long periods in the same farm and in the same cattle (clusters 8 and 9), while one of the clusters dominated. Transmission of clusters between cattle was also observed. These results suggest that some of the EHEC O26:H11 strains had the potential for a longer persistence in the host population, while others had not. The reasons for this difference are not yet clear. Perhaps the incomplete efa1 gene found in isolates of clusters which were only detected once might explain why some strains disappeared rapidly. Efa1 has been discussed as a potential E. coli colonization factor for the bovine intestine used by non-O157 STEC, including O26 (54, 56). The O165:H25 cluster detected during a longer period in farm B may have disappeared after it had lost its efa1 gene (28). The precise biological activity of Efa1 in EHEC O26 is not yet known, but it has been demonstrated that the molecule is a non-Stx virulence determinant which can increase the virulence of EHEC O26 in humans (8).Open in a separate windowFIG. 1.Neighbor-joining tree of bovine E. coli O26:H11/H32 strains based on the restriction pattern obtained after digestion with XbaI, NotI, BlnI, and SpeI.We distinguished 12 different clusters, but complete genetic identity was only found in two isolates. The variations in the O26:H11 clusters may be due to increasing competition between the bacterial populations of the various subtypes in the bovine intestine or to potential interactions between EHEC O26:H11 and the host.The ephemeral occurrence of additional stx2 genes in different clusters and farms may be the result of recombination events due to horizontal gene transfer (16). The loss of stx genes may occur rapidly in the course of an infection, but the reincorporation by induction of an stx-carrying bacteriophage into the O26:H11 strains is possible at any time (9, 40). Nevertheless, an additional stx2 gene may increase the dangerousness of the respective EHEC O26:H11 strains. While all patients involved in an outbreak caused by an EHEC O26:H11 strain harboring the gene encoding Stx2 developed HUS (41), the persons affected by another outbreak caused by an EHEC O26:H11 strain that produced exclusively Stx1 had only uncomplicated diarrhea (60).In conclusion, our results showed that bovine O26:H11 isolates can carry virulence factors of EHEC that are strongly associated with EHEC-related disease in humans, particularly with severe clinical manifestations such as hemorrhagic colitis and HUS. Therefore, strains of bovine origin may represent a considerable risk for human infection. Moreover, some clusters of EHEC O26:H11 persisted in cattle and farms over longer periods, which may increase the risk of transmission to other animals and humans even further. 相似文献
TABLE 1.
Typing of E. coli O26 isolatesSampling day, source, and isolate | Serotype | Virulence profile by: | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
fliC PCR-RFLP | stx1 gene | stx2 gene | Stx1 (toxin) | Stx2 (toxin) | Subtype(s) | efa1 geneb | EHEC-hlyA gene | katP gene | espP gene | Plasmid size(s) in kb | Cluster | ||||||
stx1/stx2 | eae | tir | espA | espB | |||||||||||||
Day 15 | |||||||||||||||||
Animal 6 (farm A) | |||||||||||||||||
WH-01/06/002-1 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 7 |
WH-01/06/002-2 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 7 |
WH-01/06/002-3 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 7 |
Animal 8 (farm A) | |||||||||||||||||
WH-01/08/002-2 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 7 |
Animal 26 (farm A) | |||||||||||||||||
WH-01/26/001-2 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 130, 12 | 7 |
WH-01/26/001-5 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 7 |
WH-01/26/001-6 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 7 |
WH-01/26/001-7 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/− | + | + | + | 110, 12 | 7 |
Day 29 | |||||||||||||||||
Animal 2 (farm A) | |||||||||||||||||
WH-01/02/003-1 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 6 |
WH-01/02/003-2 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 6 |
WH-01/02/003-5 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 6 |
WH-01/02/003-6 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | − | + | + | 110, 12 | 6 |
WH-01/02/003-7 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 6 |
WH-01/02/003-8 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | −/+ | + | + | + | 110, 12 | 6 |
WH-01/02/003-9 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110 | 6 |
WH-01/02/003-10 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110 | 6 |
Animal 26 (farm A) | |||||||||||||||||
WH-01/26/002-2 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 130, 12 | 5 |
WH-01/26/002-5 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 130, 12 | 5 |
WH-01/26/002-8 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 130, 12 | 5 |
WH-01/26/002-9 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | − | − | 110, 12 | 5 |
WH-01/26/002-10 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 130, 12 | 5 |
Day 64 | |||||||||||||||||
Animal 20 (farm A) | |||||||||||||||||
WH-01/20/005-3 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | − | − | − | 130, 2.5 | 2 |
Day 78 | |||||||||||||||||
Animal 29 (farm A) | |||||||||||||||||
WH-01/29/002-1 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/− | + | − | − | 130, 12, 2.5 | 4 |
WH-01/29/002-2 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 130, 12, 2.5 | 4 |
WH-01/29/002-3 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 130, 12, 2.5 | 4 |
WH-01/29/002-4 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 130, 12, 2.5 | 4 |
WH-01/29/002-5 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | − | − | + | 130, 12, 2.5 | 4 |
Day 106 | |||||||||||||||||
Animal 27 (farm A) | |||||||||||||||||
WH-01/27/005-2 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/− | + | + | + | 145, 110, 12 | 3 |
WH-01/27/005-5 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 130, 12, 2.5 | 5 |
WH-01/27/005-6 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | − | − | − | 130, 12, 2.5 | 5 |
Day 113 | |||||||||||||||||
Animal 7 (farm C) | |||||||||||||||||
WH-04/07/001-2 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | − | + | + | 55, 35, 2.5 | 11 |
WH-04/07/001-4 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | + | + | + | 55 | 12 |
WH-04/07/001-6 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | + | + | + | 55 | 12 |
Day 170 | |||||||||||||||||
Animal 22 (farm C) | |||||||||||||||||
WH-04/22/001-1 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12, 6.3 | 12 |
WH-04/22/001-4 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12, 6.3 | 12 |
WH-04/22/001-5 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12, 6.3 | 12 |
Day 176 | |||||||||||||||||
Animal 14 (farm D) | |||||||||||||||||
WH-03/14/004-8 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | − | + | + | 110 | 10 |
Day 218 | |||||||||||||||||
Animal 27 (farm A) | |||||||||||||||||
WH-01/27/009-1 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | + | + | + | 110, 12 | 9 |
WH-01/27/009-2 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | + | + | + | 110, 12 | 9 |
WH-01/27/009-3 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | + | + | + | 110, 12 | 8 |
WH-01/27/009-8 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | + | − | − | 110, 12 | 8 |
WH-01/27/009-9 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | + | + | + | 110, 12 | 9 |
Day 309 | |||||||||||||||||
Animal 29 (farm A) | |||||||||||||||||
WH-01/29/010-1 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 35, 12 | 4 |
WH-01/29/010-2 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | − | − | 130, 55, 35 | 8 |
WH-01/29/010-3 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 130, 35, 12 | 8 |
Day 365 | |||||||||||||||||
Animal 8 (farm C) | |||||||||||||||||
WH-04/08/008-6 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 55 | 12 |
Day 379 | |||||||||||||||||
Animal 9 (farm A) | |||||||||||||||||
WH-01/09/016-2 | O26:H32 | H32 | + | + | − | − | stx1/stx2 | − | − | − | − | −/− | − | − | − | 145, 130, 1.8 | 1 |
Animal 27 (farm A) | |||||||||||||||||
WH-01/27/014-3 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 9 |
WH-01/27/014-4 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 9 |
WH-01/27/014-5 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12 | 8 |
Day 407 | |||||||||||||||||
Animal 29 (farm A) | |||||||||||||||||
WH-01/29/013-4 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12, 2.5 | 8 |
WH-01/29/013-7 | O26:H11 | H11 | + | − | + | − | stx1 | β | β | β | β | +/+ | + | + | + | 110, 12, 2.5 | 8 |
Day 478 | |||||||||||||||||
Animal 27 (farm A) | |||||||||||||||||
WH-01/27/017-1 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | + | + | + | 110, 12 | 8 |
WH-01/27/017-5 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | + | + | + | 110, 12 | 8 |
WH-01/27/017-6 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | + | + | + | 110 | 8 |
WH-01/27/017-7 | O26:H11 | H11 | + | + | + | + | stx1/stx2 | β | β | β | β | +/+ | + | + | + | 110 | 8 |
WH-01/27/017-10 | O26:H11 | H11 | + | − | + | + | stx1 | β | β | β | β | +/+ | + | + | + | 130, 12, 2.5 | 8 |
8.
9.
10.
Tatiana N. Stekhanova Andrey V. Mardanov Ekaterina Y. Bezsudnova Vadim M. Gumerov Nikolai V. Ravin Konstantin G. Skryabin Vladimir O. Popov 《Applied and environmental microbiology》2010,76(12):4096-4098
Short-chain alcohol dehydrogenase, encoded by the gene Tsib_0319 from the hyperthermophilic archaeon Thermococcus sibiricus, was expressed in Escherichia coli, purified and characterized as an NADPH-dependent enantioselective oxidoreductase with broad substrate specificity. The enzyme exhibits extremely high thermophilicity, thermostability, and tolerance to organic solvents and salts.Alcohol dehydrogenases (ADHs; EC 1.1.1.1.) catalyze the interconversion of alcohols to their corresponding aldehydes or ketones by using different redox-mediating cofactors. NAD(P)-dependent ADHs, due to their broad substrate specificity and enantioselectivity, have attracted particular attention as catalysts in industrial processes (5). However, mesophilic ADHs are unstable at high temperatures, sensitive to organic solvents, and often lose activity during immobilization. In this relation, there is a considerable interest in ADHs from extremophilic microorganisms; among them, Archaea are of great interest. The representatives of all groups of NAD(P)-dependent ADHs have been detected in genomes of Archaea (11, 12); however, only a few enzymes have been characterized, and the great majority of them belong to medium-chain (3, 4, 14, 16, 19) or long-chain iron-activated ADHs (1, 8, 9). Up to now, a single short-chain archaeal ADH from Pyrococcus furiosus (10, 18) and only one archaeal aldo-keto reductase also from P. furiosus (11) have been characterized.Thermococcus sibiricus is a hyperthermophilic anaerobic archaeon isolated from a high-temperature oil reservoir capable of growth on complex organic substrates (15). The complete genome sequence of T. sibiricus has been recently determined and annotated (13). Several ADHs are encoded by the T. sibiricus genome, including three short-chain ADHs (Tsib_0319, Tsib_0703, and Tsib_1998) (13). In this report, we describe the cloning and expression of the Tsib_0319 gene from T. sibiricus and the purification and the biochemical characterization of its product, the thermostable short-chain ADH (TsAdh319).The Tsib_0319 gene encodes a protein with a size of 234 amino acids and the calculated molecular mass of 26.2 kDa. TsAdh319 has an 85% degree of sequence identity with short-chain ADH from P. furiosus (AdhA; PF_0074) (18). Besides AdhA, close homologs of TsAdh319 were found among different bacterial ADHs, but not archaeal ADHs. The gene flanked by the XhoI and BamHI sites was PCR amplified using two primers (sense primer, 5′-GTTCTCGAGATGAAGGTTGCTGTGATAACAGGG-3′, and antisense primer, 5′-GCTGGATCCTCAGTATTCTGGTCTCTGGTAGACGG-3′) and cloned into the pET-15b vector. TsAdh319 was overexpressed, with an N-terminal His6 tag in Escherichia coli Rosetta-gami (DE3) and purified to homogeneity by metallochelating chromatography (Hi-Trap chelating HP column; GE Healthcare) followed by gel filtration on Superdex 200 10/300 GL column (GE Healthcare) equilibrated in 50 mM Tris-HCl (pH 7.5) with 200 mM NaCl. The homogeneity and the correspondence to the calculated molecular mass of 28.7 kDa were verified by SDS-PAGE (7). The molecular mass of native TsAdh319 was 56 to 60 kDa, which confirmed the dimeric structure in solution.The standard ADH activity measurement was made spectrophotometrically at the optimal pH by following either the reduction of NADP (in 50 mM Gly-NaOH buffer; pH 10.5) or the oxidation of NADPH (in 0.1 M sodium phosphate buffer; pH 7.5) at 340 nm at 60°C. The enzyme exhibited a strong preference for NADP(H) and broad substrate specificity (Table (Table1).1). The highest oxidation rates were found with pentoses d-arabinose (2.0 U mg−1) and d-xylose (2.46 U mg−1), and the highest reduction rates were found with dimethylglyoxal (5.9 U mg−1) and pyruvaldehyde (2.2 U mg−1). The enzyme did not reduce sugars which were good substrates for the oxidation reaction. The kinetic parameters of TsAdh319 determined for the preferred substrates are shown in Table Table2.2. The enantioselectivity of the enzyme was estimated by measuring the conversion rates of 2-butanol enantiomers. TsAdh319 showed an evident preference, >2-fold, for (S)-2-butanol over (RS)-2-butanol. The enzyme stereoselectivity is confirmed by the preferred oxidation of d-arabinose over l-arabinose (Table (Table1).1). The fact that TsAdh319 is metal independent was supported by the absence of a significant effect of TsAdh319 preincubation with 10 mM Me2+ for 30 min before measuring the activity in the presence of 1 mM Me2+ or EDTA (Table (Table3).3). TsAdh319 also exhibited a halophilic property, so the enzyme activity increased in the presence of NaCl and KCl and the activation was maintained even at concentration of 4 M and 3 M, respectively (Table (Table33).
Open in a separate windowaSubstrates were present in 250 mM or 50 mM (*) concentrations.bRelative rates, measured under standard conditions, were calculated by defining the activity for 2-propanol as 100%, which corresponds to 1.0 U mg−1. Data are averages from triplicate experiments.cRelative rates, measured under standard conditions, were calculated by defining the activity for pyruvaldehyde as 100%, which corresponds to 2.2 U mg−1. Data are averages from triplicate experiments.
Open in a separate windowaActivity was measured under standard conditions with 2-propanol. Data are averages from triplicate experiments.bActivity was measured under standard conditions with pyruvaldehyde. Data are averages from triplicate experiments.
Open in a separate windowaThe activity was measured under standard conditions with 2-propanol; relative rates were calculated by defining the activity without salts as 100%, which corresponds to 0.9 U mg−1. Data are averages from duplicate experiments.The most essential distinctions of TsAdh319 are the thermophilicity and high thermostability of the enzyme. The optimum temperature for the 2-propanol oxidation catalyzed by TsAdh319 was not achieved. The initial reaction rate of oxidation increased up to 100°C (Fig. (Fig.1).1). The Arrhenius plot is a straight line, typical of a single rate-limited thermally activated process, but there is no obvious transition point due to the temperature-dependent conformational changes of the protein molecule. The activation energy for the oxidation of 2-propanol was estimated at 84.0 ± 5.8 kJ·mol−1. The thermostability of TsAdh319 was calculated from residual TsAdh319 activity after preincubation of 0.4 mg/ml enzyme solution in 50 mM Tris-HCl buffer (pH 7.5) containing 200 mM NaCl at 70, 80, 90, or 100°C. The preincubation at 70°C or 80°C for 1.5 h did not cause a decrease in the TsAdh319 activity, but provoked slight activation. The residual TsAdh319 activities began to decrease after 2 h of preincubation at 70°C or 80°C and were 10% and 15% down from the control, respectively. The determined half-life values of TsAdh319 were 2 h at 90°C and 1 h at 100°C.Open in a separate windowFIG. 1.Temperature dependence of the initial rate of the 2-propanol reduction by TsAdh319. The reaction was initiated by enzyme addition to a prewarmed 2-propanol-NADP mixture. The inset shows the Arrhenius plot of the same data.Protein thermostability often correlates with such important biotechnological properties as increased solvent tolerance (2). We tested the influence of organic solvents at a high concentration (50% [vol/vol]) on TsAdh319 by using either preincubation of the enzyme at a concentration of 0.2 mg/ml with solvents for 4 h at 55°C or solvent addition into the reaction mixture to distinguish the effect of solvent on the protein stability and on the enzyme activity. TsAdh319 showed significant solvent tolerance in both cases (Table (Table4),4), and the effects of solvents could be modulated by salts, acting apparently as molecular lyoprotectants (17). Furthermore, TsAdh319 maintained 57% of its activity in 25% (vol/vol) 2-propanol, which could be used as the cosubstrate in cofactor regeneration (6).
Open in a separate windowaThe activity measured at the standard condition with 2-propanol as a substrate. Data are averages from triplicate experiments.bPreincubation for 4 h at 55°C in the presence of 50% (vol/vol) of solvent prior the activity assay.cWithout preincubation, solvent addition to the reaction mixture up to 50% (vol/vol) or using the buffer saturated by a solvent (*).dDMSO, dimethyl sulfoxide.eDMFA, dimethylformamide.From all the aforesaid we may suppose TsAdh319 or its improved variant to be interesting both for the investigation of structural features of protein tolerance and for biotechnological applications. 相似文献
TABLE 1.
Substrate specificity of TsAdh319Substratea | Relative activity (%) |
---|---|
Oxidation reactionb | |
Methanol | 0 |
2-Methoxyethanol | 0 |
Ethanol | 36 |
1-Butanol | 80 |
2-Propanol | 100 |
(RS)-(±)-2-Butanol | 86 |
(S)-(+)-2-Butanol | 196 |
2-Pentanol | 67 |
1-Phenylmethanol | 180 |
1.3-Butanediol | 91 |
Ethyleneglycol | 0 |
Glycerol | 16 |
d-Arabinose* | 200 |
l-Arabinose* | 17 |
d-Xylose* | 246 |
d-Ribose* | 35 |
d-Glucose* | 146 |
d-Mannose* | 48 |
d-Galactose* | 0 |
Cellobiose* | 71 |
Reduction reactionc | |
Pyruvaldehyde | 100 |
Dimethylglyoxal | 270 |
Glyoxylic acid | 36 |
Acetone | 0 |
Cyclopentanone | 0 |
Cyclohexanone | 4 |
3-Methyl-2-pentanone* | 13 |
d-Arabinose* | 0 |
d-Xylose* | 0 |
d-Glucose* | 0 |
Cellobiose* | 0 |
TABLE 2.
Apparent Km and Vmax values for TsAdh319Coenzyme or substrate | Apparent Km (mM) | Vmax (U mg−1) | kcat (s−1) |
---|---|---|---|
NADPa | 0.022 ± 0.002 | 0.94 ± 0.02 | 0.45 ± 0.01 |
NADPHb | 0.020 ± 0.003 | 3.16 ± 0.11 | 1.51 ± 0.05 |
2-Propanol | 168 ± 29 | 1.10 ± 0.09 | 0.53 ± 0.04 |
d-Xylose | 54.4 ± 7.4 | 1.47 ± 0.09 | 0.70 ± 0.04 |
Pyruvaldehyde | 17.75 ± 3.38 | 4.26 ± 0.40 | 2.04 ± 0.19 |
TABLE 3.
Effect of various ions and EDTA on TsAdh319aCompound | Concn (mM) | Relative activity (%) |
---|---|---|
None | 0 | 100 |
NaCl | 400 | 206 |
600 | 227 | |
4,000 | 230 | |
KCl | 600 | 147 |
2,000 | 200 | |
3,000 | 194 | |
MgCl2 | 10 | 78 |
CoCl2 | 10 | 105 |
NiSO4 | 10 | 100 |
ZnSO4 | 10 | 79 |
FeSO4 | 10 | 74 |
EDTA | 1 | 100 |
5 | 80 |
TABLE 4.
Influence of various solvents on TsAdh319 activityaSolvent | Relative activity (%)b | Relative activity (%)c | |
---|---|---|---|
Buffer without NaCl | Buffer with 600 mM NaCl | ||
None | 100 | 100 | 100 |
DMSOd | 98 | 0 | 40 |
DMFAe | 101 | 13 | 41 |
Methanol | 98 | 25 | 9 |
Acetonitrile | 95 | 0 | 0 |
Ethyl acetate | 47 | 0* | 33* |
Chloroform | 105 | 79* | 81* |
n-Hexane | 105 | 60* | 118* |
n-Decane | 36 | 91* | 107* |
11.
12.
13.
Two amino acids, Leu149 and Val223, were identified as proteolytically sensitive when Pseudozyma antarctica lipase (PalB) was heterologously expressed in Escherichia coli. The functional expression was enhanced using the double mutant for cultivation. However, the recombinant protein production was still limited by PalB misfolding, which was resolved by DsbA coexpression.Though Escherichia coli retains popularity as a host for recombinant protein production, it has technical limitations for expressing eukaryotic proteins. Host/protein incompatibility is critical, since eukaryotic proteins heterologously expressed in E. coli are recognized as a foreign object that can induce heat shock responses and drive protease-mediated degradation. E. coli contains several proteases situated in various intracellular compartments, including the cytoplasm, periplasm, inner membrane, and outer membrane (7, 9). While these proteases play a pivotal role in maintaining cell physiology by clearing up abnormal proteins (4), they can potentially degrade recombinant proteins (6). Nevertheless, the mechanisms associated with protein degradation and protein substrate specificity are incompletely understood.Since the proteolysis of recombinant proteins is a common issue, approaches to overcome this limitation have been extensively explored. These include using protease-deficient mutants as an expression host (10, 18), lowering the cultivation temperature (3), coexpressing folding factors (19, 20), applying protein fusion technology (2, 8), eliminating protease cleavage sites (5, 15), and modifying target protein hydrophobicity (11). While genetic elimination of proteolytically sensitive sequences without impacting the target protein''s bioactivity appears to be technically attractive, there is no effective prediction or identification of potential protease cleavage sites. Proteolytically sensitive sequences might not be specific to certain proteases. Various factors affecting the folding, solubility, steric hindrance, and binding of the substrate protein, e.g., neighboring domains or amino acids, can contribute to the sensitivity of proteolytic sites, making sequence manipulation for proteolysis alleviation more difficult.Herein, the recombinant protein''s sensitivity toward intracellular proteolysis was genetically alleviated to enhance the functional expression of PalB, an industrial enzyme with justified applications (1), in E. coli and to understand the relationship between proteolytic specificity and substrate protein sequence. Since there are three intramolecular disulfide bonds whose formation can potentially affect PalB structure and bioactivity, PalB expression in the oxidative periplasm of E. coli was explored (20, 22). However, the expressed PalB protein was extremely sensitive to intracellular proteolysis, resulting in complete degradation. To overcome this problem, PalB mutant variants that were stable against proteolysis were derived (Table (Table11).
Open in a separate windowaFor oligonucleotides, italic indicates mutated nucleotides, underlining indicates restriction site (silent mutation), and bold indicates a mutation codon.bSDM, site-directed mutagenesis.The results for functional expression of various PalB variants are summarized in Table Table22 and Fig. Fig.1.1. Neither PalB activity nor PalB-related polypeptide was detectable for the BL21(DE3)(pETG) culture sample, suggesting that the expressed gene product was degraded. Error-prone PCR (ep-PCR) was conducted using pETG as the template and LB-P10/LB-P11 as the primers. Potential mutants were screened on tributyrin agar plates. A colony developed a large halo, and the harboring plasmid (i.e., pETGM-2) was purified for sequencing. Two mutations, Leu149Val and Val223Ile, were identified in the expressed PalB mutant (i.e., M-2). High PalB activity was obtained for the BL21(DE3) (pETGM-2) culture sample. However, a PalB-related polypeptide was detected in both the soluble and insoluble fractions, implying potential protein misfolding. It was previously reported that the functional expression of PalB could be limited by disulfide bond formation associated with folding (21). It was intriguing to observe the structural effect of these two simple mutations on improving PalB stabilization and functional expression.Open in a separate windowFIG. 1.Western blotting analysis of the culture samples for the expression of various PalB mutants. Both soluble and insoluble fractions are shown. The number (n = 2 to 12) represents the PalB mutant (M-n) with the use of BL21(DE3) harboring the expression plasmid pETGM-n, summarized in Tables Tables11 and and2.2. “G” represents the control experiment using BL21(DE3) harboring pETG. “C” and “I” represent the cultures without and with IPTG induction, respectively.
Open in a separate windowaBL21(DE3) was used as an expression host to harbor various plasmids. PalB enzyme assay was conducted at 37°C and pH 8.0 using a pH stat with olive oil as a substrate. One unit of enzyme activity is defined as the amount of enzyme required to liberate one μmole of fatty acid per min.bOD600, optical density at 600 nm; w/o and w/IPTG, without and with isopropyl-β-d-thiogalactopyranoside, respectively.cThese activities represent IPTG-induced cultures. No activity was detected for all control cultures without IPTG induction. ND, not detected.Site-directed mutagenesis was conducted to introduce various single mutations of Leu149 and Val223 for a further understanding of the structural effect. Note that only hydrophobic amino acid residues were selected for the replacement to avoid any major structural disturbances. Among the five single mutations on Leu149, only Leu149Val and Leu149Ile were associated with a slight improvement in functional expression, and Leu149Val was more effective than Leu149Ile, whereas the others behaved similarly to the wild type. Among the five single mutations at Val223, only Val223Phe, Val223Gly, and Val223Ile showed a slight improvement in functional expression, with Val223Ile as the most effective one, whereas the others showed no improvement. The results suggest that Leu149 and Val223 are two amino acids critically affecting the proteolytic susceptibility of PalB in E. coli, with a synergistic effect on PalB stabilization from Leu149Val and Val223Ile mutations.Several amino acids were identified as being involved in the catalytic mechanism (17), such as Ser107-Asp189-His226, forming the catalytic triad, and Thr42 and Gly108, acting as the hydrogen bond donors in the oxyanion hole of the active site. However, Leu149 is located at the entrance of the partially formed lid of the protein structure, whereas Val223 is situated near one of the catalytic triad residues, His226, in the active site. The substitutions at Leu149 and/or Val223 with a PalB stabilization effect potentially convert the overall protein conformation into a less proteolytically sensitive form without changing the enzyme kinetics or activity. It was interesting to observe a similarly positive effect upon replacing Val223 with either a bulky Phe or a small Gly, implying that the molecular size of this amino acid residue was not critical for alleviation of the proteolytic sensitivity. Note that PalB-related polypeptide was present in the insoluble fraction for all the PalB mutants with improved functional expression, suggesting another expression hurdle of protein misfolding.To overcome the protein misfolding, coexpression of two periplasmic folding factors, DsbA and DsbC, was explored, and the cultivation results are summarized in Fig. Fig.2.2. DsbA coexpression significantly boosted functional expression, with specific PalB activity of more than twofold that of the control culture and a slight reduction of insoluble PalB. However, the improving effect associated with DsbC coexpression was minimal. The results suggest that the initiation but not isomerization for disulfide bond formation in the periplasm became limiting. The chaperone activity associated with DsbA could assist the folding of the expressed PalB double mutant.Open in a separate windowFIG. 2.Effect of DsbA or DsbC coexpression on the functional expression of the PalB double mutant. Cultivations were performed in a bioreactor containing 1 liter LB medium and operated at pH 7.0, 28°C, and 650 rpm. The cultures were induced with 0.1 mM isopropyl-β-d-thiogalactopyranoside and/or 0.2 g/liter arabinose at a ∼0.5 optical density at 600 nm (OD600) cell density. (A) Time profiles of cell density; (B) time profiles of the specific PalB activity [note that there was no detectable activity for BL21(DE3) (pETG) culture samples]; (C) Western blotting analysis of the final samples of the four cultures. Both soluble and insoluble fractions are shown. Lanes 1 and 5, BL21(DE3) (pETG); lanes 2 and 6, BL21(DE3) (pETGM-2); lane 3 and 7, BL21(DE3) (pETGM-2, pARDsbC); lanes 4 and 8, BL21(DE3) (pETGM-2, pARDsbA).While many studies based on rational mutagenesis, directed evolution, and gene shuffling are conducted to derive PalB mutants with improved enzyme properties, such as thermostability, bioactivity, or enantioselectivity (12-14, 16), this is an approach to improve protein manufacturing by deriving the variants with less proteolytic susceptibility. Though it has been perceived that the proteolytic specificity can be intrinsically determined by the protein substrate sequence, experimental demonstration of this is rarely reported. This study complements the lack of such experimental demonstration by showing the proteolytic specificity and sensitivity of PalB heterologously expressed in E. coli can be drastically altered by simple amino acid substitutions. It also demonstrates the application of molecular manipulation to enhance recombinant protein production in E. coli. 相似文献
TABLE 1.
Strains, plasmids, and oligonucleotidesStrain, plasmid, or oligonucleotide | Relevant genotype or DNA sequencea |
---|---|
Strain | |
BL21(DE3) | F−ompT dcm lon hsdSB (rB− mB−) gal λ(DE3[lacIind1sam7 nin5 lacUV5-T7 gene 1]) |
Plasmids | |
pARDsbA (20) | ParaB::dsbA, Ori (pACYC184), Cmr |
pARDsbC (20) | ParaB::dsbA, Ori (pACYC184), Cmr |
pETG (20) | PT7-pelB::palB, Ori (pBR322), Apr |
pETGM-2 | pETG derivative containing two mutations of Leu149Val and Val223Ile in palB (by ep-PCR with pETG and LB-P10/LB-P11) |
pETGM-3 | pETG derivative containing mutation of Leu149Gly in palB (by SDMb with pETG and P104/P114) |
pETGM-4 | pETG derivative containing mutation of Leu149Val in palB (by SDM with pETG and P103/P113) |
pETGM-5 | pETG derivative containing mutation of Leu149Ala in palB (by SDM with pETG and P105/P115) |
pETGM-6 | pETG derivative containing mutation of Leu149Met in palB (by SDM with pETG and P106/P116) |
pETGM-7 | pETG derivative containing mutation of Leu149Ile in palB (by SDM with pETG and P107/P117) |
pETGM-8 | pETG derivative containing mutation of Val223Phe in palB (by SDM with pETG and P112/P122) |
pETGM-9 | pETG derivative containing mutation of Val223Met in palB (by SDM with pETG and P111/P121) |
pETGM-10 | pETG derivative containing mutation of Val223Ala in palB (by SDM with pETG and P110/P120) |
pETGM-11 | pETG derivative containing mutation of Val223Gly in palB (by SDM with pETG and P109/P119) |
pETGM-12 | pETG derivative containing mutation of Val223Ile in palB (by SDM with pETGM-2 and P136/P137, i.e., by reverting the mutation of Val149 to Leu in pETGM-2) |
Oligonucleotides | |
LB-P10 | 5′-GGCCATGGGTCTACCTTCCGGTTCGG-3′ |
LB-P11 | 5′-CTGAATTCTCAGGGGGTGACGATGCCGGAGCAGG-3′ |
P103 | 5′-CCTCTCGATGCAGTCGCGGTTAGTGCACCC-3′ |
P113 | 5′-GGGTGCACTAACCGCGACTGCATCGAGAGG-3′ |
P104 | 5′-CCTCTCGATGCAGGCGCCGTTAGTGCACCC-3′ |
P114 | 5′-GGGTGCACTAACGGCGCCTGCATCGAGAGG-3′ |
P105 | 5′-CCTCTCGATGCAGCCGCGGTTAGTGCACCC-3′ |
P115 | 5′-GGGTGCACTAACCGCGGCTGCATCGAGAGG-3′ |
P106 | 5′-CCTCTCGATGCCATGGCGGTTAGTGCACCC-3′ |
P116 | 5′-GGGTGCACTAACCGCCATGGCATCGAGAGG-3′ |
P107 | 5′-CCTCTCGATGCGATCGCGGTTAGTGCACCC-3′ |
P117 | 5′-GGGTGCACTAACCGCGATCGCATCGAGAGG-3′ |
P109 | 5′-GGGCCGCTGTTCGGGATCGACCATGCAGGC-3′ |
P119 | 5′-GCCTGCATGGTCGATCCCGAACAGCGGCCC-3′ |
P110 | 5′-GGGCCGCTGTTCGCGATCGACCATGCAGGC-3′ |
P120 | 5′-GCCTGCATGGTCGATCGCGAACAGCGGCCC-3′ |
P111 | 5′-GGGCCGCTGTTCATGATCGACCATGCAGGC-3′ |
P121 | 5′-GCCTGCATGGTCGATCATGAACAGCGGCCC-3′ |
P112 | 5′-GGGCCGCTGTTCTTTATCGACCATGCAGGC-3′ |
P122 | 5′-GCCTGCATGGTCGATAAAGAACAGCGGCCC-3′ |
P136 | 5′-CCTCTCGATGCACTGGCGGTTAGTGCACCC-3′ |
P137 | 5′-GGGTGCACTAACCGCCAGTGCATCGAGAGG-3′ |
TABLE 2.
Cultivation performance for production of PalB mutant variantsaPlasmid | Cell density (OD600)b
| Activity (U/liter/OD600)c | Mutation in PalB | |
---|---|---|---|---|
w/o IPTG | w/IPTG | |||
pETG | 3.1 ± 0.0 | 3.3 ± 0.1 | ND | None |
pETGM-2 | 3.4 ± 0.1 | 3.3 ± 0.0 | 155 | Leu149Val, Val223Ile |
pETGM-3 | 3.2 ± 0.1 | 3.3 ± 0.0 | ND | Leu149Gly |
pETGM-4 | 3.4 ± 0.1 | 3.6 ± 0.1 | 60 | Leu149Val |
pETGM-5 | 3.3 ± 0.1 | 3.5 ± 0.1 | ND | Leu149Ala |
pETGM-6 | 2.7 ± 0.1 | 3.0 ± 0.1 | ND | Leu149Met |
pETGM-7 | 3.5 ± 0.0 | 3.2 ± 0.0 | 38 | Leu149Ile |
pETGM-8 | 3.0 ± 0.0 | 3.6 ± 0.0 | 50 | Val223Phe |
pETGM-9 | 2.9 ± 0.1 | 2.8 ± 0.0 | ND | Val223Met |
pETGM-10 | 3.4 ± 0.1 | 3.3 ± 0.1 | ND | Val223Ala |
pETGM-11 | 3.5 ± 0.0 | 3.5 ± 0.1 | 30 | Val223Gly |
pETGM-12 | 3.6 ± 0.1 | 3.5 ± 0.1 | 57 | Val223Ile |
14.
15.
Lisa Jacobsen Lisa Durso Tyrell Conway Kenneth W. Nickerson 《Applied and environmental microbiology》2009,75(13):4633-4635
Escherichia coli isolates (72 commensal and 10 O157:H7 isolates) were compared with regard to physiological and growth parameters related to their ability to survive and persist in the gastrointestinal tract and found to be similar. We propose that nonhuman hosts in E. coli O157:H7 strains function similarly to other E. coli strains in regard to attributes relevant to gastrointestinal colonization.Escherichia coli is well known for its ecological versatility (15). A life cycle which includes both gastrointestinal and environmental stages has been stressed by both Savageau (15) and Adamowicz et al. (1). The gastrointestinal stage would be subjected to acid and detergent stress. The environmental stage is implicit in E. coli having transport systems for fungal siderophores (4) as well as pyrroloquinoline quinone-dependent periplasmic glucose utilization (1) because their presence indicates evolution in a location containing fungal siderophores and pyrroloquinoline quinone (1).Since its recognition as a food-borne pathogen, there have been numerous outbreaks of food-borne infection due to E. coli O157:H7, in both ground beef and vegetable crops (6, 13). Cattle are widely considered to be the primary reservoir of E. coli O157:H7 (14), but E. coli O157:H7 does not appear to cause disease in cattle. To what extent is E. coli O157:H7 physiologically unique compared to the other naturally occurring E. coli strains? We feel that the uniqueness of E. coli O157:H7 should be evaluated against a backdrop of other wild-type E. coli strains, and in this regard, we chose the 72-strain ECOR reference collection originally described by Ochman and Selander (10). These strains were chosen from a collection of 2,600 E. coli isolates to provide diversity with regard to host species, geographical distribution, and electromorph profiles at 11 enzyme loci (10).In our study we compared the 72 strains of the ECOR collection against 10 strains of E. coli O157:H7 and six strains of E. coli which had been in laboratory use for many years (Table (Table1).1). The in vitro comparisons were made with regard to factors potentially relevant to the bacteria''s ability to colonize animal guts, i.e., acid tolerance, detergent tolerance, and the presence of the Entner-Doudoroff (ED) pathway (Table (Table2).2). Our longstanding interest in the ED pathway (11) derives in part from work by Paul Cohen''s group (16, 17) showing that the ED pathway is important for E. coli colonization of the mouse large intestine. Growth was assessed by replica plating 88 strains of E. coli under 40 conditions (Table (Table2).2). These included two LB controls (aerobic and anaerobic), 14 for detergent stress (sodium dodecyl sulfate [SDS], hexadecyltrimethylammonium bromide [CTAB], and benzalkonium chloride, both aerobic and anaerobic), 16 for acid stress (pH 6.5, 6.0, 5.0, 4.6, 4.3, 4.2, 4.1, and 4.0), four for the ability to grow in a defined minimal medium (M63 glucose salts with and without thiamine), and four for the presence or absence of a functional ED pathway (M63 with gluconate or glucuronate). All tests were done with duplicate plates in two or three separate trials. The data are available in Tables S1 to S14 in the supplemental material, and they are summarized in Table Table22.
Open in a separate window
Open in a separate windowaEight LB controls were run, two for each set of LB experiments: SDS, CTAB, benzalkonium chloride (BAC), and pH stress.bGrowth was measured as either +++, +, or 0 (good, poor, and none, respectively), with +++ being the growth achieved on the LB control plates. “Variable” means that two or three replicates did not agree. All experiments were done at 37°C.c“Anaerobic” refers to use of an Oxoid anaerobic chamber. Aerobic and anaerobic growth data are presented together when the results were identical and separately when the results were not the same or the anaerobic set had not been done. LB plates were measured after 1 (aerobic) or 2 (anaerobic) days, and the M63 plates were measured after 2 or 3 days.dCTAB used at 0.05, 0.2%, and 0.4%.eM63 defined medium (3) was supplemented with glucose, gluconate, or glucuronate, all at 0.2%.fIdentical results were obtained with and without 0.0001% thiamine.gND, not determined. 相似文献
TABLE 1.
E. coli strains used in this studyE. coli strain (n) | Source |
---|---|
ECOR strains (72) | Thomas Whittman |
Laboratory adapted (6) | |
K-12 Davis | Paul Blum |
CG5C 4401 | Paul Blum |
K-12 Stanford | Paul Blum |
W3110 | Paul Blum |
B | Tyler Kokjohn |
AB 1157 | Tyler Kokjohn |
O157:H7 (10) | |
FRIK 528 | Andrew Benson |
ATCC 43895 | Andrew Benson |
MC 1061 | Andrew Benson |
C536 | Tim Cebula |
C503 | Tim Cebula |
C535 | Tim Cebula |
ATCC 43889 | William Cray, Jr. |
ATCC 43890 | William Cray, Jr. |
ATCC 43888 | Willaim Cray, Jr. |
ATCC 43894 | William Cray, Jr. |
TABLE 2.
Physiological comparison of 88 strains of Escherichia coliGrowth medium or condition | Oxygenc | No. of strains with type of growthb
| |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ECOR strains (n = 72)
| Laboratory strains (n = 6)
| O157:H7 strains (n = 10)
| |||||||||||
Good | Poor | None | Variable | Good | Poor | None | Variable | Good | Poor | None | Variable | ||
LB controla | Both | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 | 0 | 0 |
1% SDS | Aerobic | 69 | 3 | 0 | 0 | 6 | 0 | 0 | 0 | 8 | 0 | 0 | 2 |
5% SDS | Aerobic | 68 | 4 | 0 | 0 | 6 | 0 | 0 | 0 | 8 | 2 | 0 | 0 |
1% SDS | Anaerobic | 53 | 15 | 4 | 0 | 2 | 3 | 1 | 0 | 1 | 7 | 0 | 2 |
5% SDS | Anaerobic | 0 | 68 | 4 | 0 | 0 | 4 | 2 | 0 | 0 | 7 | 0 | 4 |
CTABd (all) | Both | 0 | 0 | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 |
0.05% BAC | Aerobic | 3 | 11 | 58 | 2 | 0 | 2 | 2 | 2 | 0 | 0 | 9 | 1 |
0.2% BAC | Aerobic | 0 | 1 | 71 | 0 | 1 | 0 | 5 | 0 | 0 | 0 | 10 | 0 |
0.05% BAC | Anaerobic | 2 | 3 | 67 | 0 | 0 | 1 | 5 | 0 | 0 | 0 | 9 | 1 |
0.2% BAC | Anaerobic | 0 | 0 | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 |
pH 6.5 | Both | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 | 0 | 0 |
pH 6 | Both | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 | 0 | 0 |
pH 5 | Both | 70 | 2 | 0 | 0 | 6 | 0 | 0 | 0 | 9 | 0 | 0 | 1 |
pH 4.6 | Both | 70 | 2 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 | 0 | 0 |
pH 4.3 | Aerobic | 14 | 0 | 1 | 57 | 3 | 1 | 2 | 0 | 3 | 2 | 0 | 5 |
pH 4.3 | Anaerobic | 69 | 3 | 0 | 0 | 3 | 1 | 2 | 0 | 1 | 1 | 0 | 0 |
pH 4.1 or 4.2 | Aerobic | 0 | 0 | 72 | 0 | NDg | ND | ||||||
pH 4.0 | Both | 0 | 0 | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 9 | 1 |
M63 with supplemente | |||||||||||||
Glucose | Aerobicf | 69 | 1 | 2 | 0 | 5 | 0 | 1 | 0 | 9 | 0 | 1 | 0 |
Glucose | Anaerobicf | 70 | 0 | 2 | 0 | 5 | 0 | 1 | 0 | 9 | 0 | 1 | 0 |
Gluconate | Both | 69 | 1 | 2 | 0 | 5 | 0 | 1 | 0 | 9 | 0 | 1 | 0 |
Glucuronate | Aerobic | 68 | 2 | 2 | 0 | 5 | 0 | 1 | 0 | 9 | 0 | 1 | 0 |
Glucuronate | Anaerobic | 69 | 1 | 2 | 0 | 5 | 0 | 1 | 0 | 9 | 0 | 1 | 0 |
16.
Camilla L. Nesb? Rajkumari Kumaraswamy Marlena Dlutek W. Ford Doolittle Julia Foght 《Applied and environmental microbiology》2010,76(14):4896-4900
All cultivated Thermotogales are thermophiles or hyperthermophiles. However, optimized 16S rRNA primers successfully amplified Thermotogales sequences from temperate hydrocarbon-impacted sites, mesothermic oil reservoirs, and enrichment cultures incubated at <46°C. We conclude that distinct Thermotogales lineages commonly inhabit low-temperature environments but may be underreported, likely due to “universal” 16S rRNA gene primer bias.Thermotogales, a bacterial group in which all cultivated members are anaerobic thermophiles or hyperthermophiles (5), are rarely detected in anoxic mesothermic environments, yet their presence in corresponding enrichment cultures, bioreactors, and fermentors has been observed using metagenomic methods and 16S rRNA gene amplification (6) (see Table S1 in the supplemental material). The most commonly detected lineage is informally designated here “mesotoga M1” (see Table S1 in the supplemental material). PCR experiments indicated that mesotoga M1 sequences amplified inconsistently using “universal” 16S rRNA gene primers, perhaps explaining their poor detection in DNA isolated from environmental samples (see text and Table S2 in the supplemental material). We therefore designed three 16S rRNA PCR primer sets (Table (Table1)1) targeting mesotoga M1 bacteria and their closest cultivated relative, Kosmotoga olearia. Primer set A was the most successful set, detecting a wider diversity of Thermotogales sequences than set B and being more Thermotogales-specific than primer set C (Table (Table22).
Open in a separate windowaHeterogeneity hot spots identified in reference 1.
Open in a separate windowaSee the supplemental material for site and methodological details. NA, not applicable; ND, not determined.bThe number of OTUs observed at a 0.01 distance cutoff is given for each primer set. The numbers of clones with Thermotogales sequences are in parentheses. —, PCR was attempted but no Thermotogales sequences were obtained or the PCR consistently failed.c+, sequence(s) detected; −, not detected. For more information on the enrichments, see the text and Table S3 in the supplemental material.dFrom April to May 2004, the temperature at the depth where the sample was taken was 12°C (7).eThere were no water samples from DWH and HSAT available for enrichment cultures, and no DNA was available from HWH.fThis reservoir has been treated with biocides; moreover, at this site, the water is filtered before being reinjected into the reservoir.gTemperatures of the oil pool where the water sample was obtained. The HSAT facility receives water from two oil pools, one at 41°C and one at 50°C.hWe screened DNA from samples taken in 2006 and 2008 but detected the same sequences in both, so sequences from the two samples were pooled.iThe mesotoga M1 and Kosmotoga sequences from DWH and DF were >99% similar and were assembled into one sequence in Fig. Fig.11.jThis reservoir has been injected with water from a neighboring oil reservoir.Since the putative mesophilic Thermotogales have been overwhelmingly associated with polluted and hydrocarbon-impacted environments and mesothermic oil reservoirs are the only natural environments where mesotoga M1 sequences previously were detected (see Table S1 in the supplemental material), we selected four oil reservoirs with in situ temperatures of 14°C to 53°C and two temperate, chronically hydrocarbon-impacted sites for analysis (Table (Table2).2). Total community DNA was extracted, the 16S rRNA genes were amplified, cloned, and sequenced as described in the supplemental material. 相似文献
TABLE 1.
Primers targeting mesotoga M1 bacteria constructed and used in this studyPrimer | Sequence (5′ to 3′) | Position in mesotoga 16S rRNA gene | No. of heterogeneity hot spotsa | Potential primer match in other Thermotogales lineages |
---|---|---|---|---|
Primer set A | 1 (helix 17) | |||
NMes16S.286F | CGGCCACAAGGAYACTGAGA | 286 | Perfect match in Kosmotoga olearia. The last 7 or 8 nucleotides at the 3′ end are conserved in other Thermotogales lineages. | |
NMes16S.786R | TGAACATCGTTTAGGGCCAG | 786 | One 5′ mismatch in Kosmotoga olearia and Petrotoga mobilis; 2-4 internal and 5′ mismatches in other lineages | |
Primer set B | None | |||
BaltD.42F | ATCACTGGGCGTAAAGGGAG | 540 | Perfect match in Kosmotoga olearia; one or two 3′ mismatches in most other Thermotogales lineages | |
BaltD.494R | GTGGTCGTTCCTCTTTCAAT | 992 | No match in other Thermotogaleslineages. The primer is located in heterogeneity hot spot helices 33 and 34. This primer also fails to amplify some mesotoga M1 sequences. | |
Primer set C | 9 (all 9 regions) | |||
TSSU-3F | TATGGAGGGTTTGATCCTGG | 3 | Perfect match in Thermotoga spp., Kosmotoga olearia, and Petrotoga mobilis; two or three 5′ mismatches in other Thermotogales lineages; one 5′ mismatch to mesotoga M1 16S rRNA genes | |
Mes16S.R | ACCAACTCGGGTGGCTTGAC | 1390 | One 5′ mismatch in Kosmotoga olearia; 1-3 internal or 5′ mismatches in other Thermotogales lineages |
TABLE 2.
Mesotoga clade sequences detected in environmental samples and enrichment cultures screened in this studyaSite (abbreviation) | Temp in situ(°C) | Waterflooded | Environmental samplesb | Enrichment cultures | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Primer set A | Primer set B | Primer set C | Thermotogalesdetected by primer setc: | Lineage(s) detected | ||||||||
No. of OTUs (no. of clones) | Lineage | No. of OTUs (no. of clones) | Lineage | No. of OTUs (no. of clones) | Lineage | A | B | C | ||||
Sidney Tar Ponds sediment (TAR) | Temperate | NA | 1 (5) | M1 | 1 | M1 | — | — | + | + | + | M1, M2, M5 |
Oil sands settling basin tailings (05mlsb) | ∼12d | NA | — | — | 1 (6) | M1 | — | — | − | + | − | M1 |
Grosmont A produced water (GrosA) | 20 | No | 1 (15) | M1 | 1 (22) | M1 | 2 (14) | M1 | + | + | + | M1 |
Foster Creek produced water (FC) | 14 | No | 1 (21) | M1 | 1 (23) | M1 | 1 (1) | M1 | + | ND | − | M1 |
Oil field D wellhead water (DWH)e,f | 52-53g | Yes | 1 (14) | Kosmotogai | 1 (6) | M1i | 1 (1) | Kosmotogai | NA | NA | NA | NA |
Oil field D FWKO water (DF)f,h | 20-30 | Yes | 1 (45) | Kosmotogai | 1 (17) | M1i | — | — | + | + | − | M1, Kosmotoga, Petrotoga |
Oil field H FWKO water (HF)j | 30-32 | Yes | 7 (59) | M1, M2, M3, M4, Kosmotoga | 1 (29) | M1 | — | — | + | + | − | M1, Petrotoga |
Oil field H satellite water (HSAT)e,j | 41 and 50g | Yes | 1 (8) | M1 | — | — | 2 (16) | Kosmotoga, Thermotoga | NA | NA | NA | NA |
Oil field H wellhead water (HWH)e,j | 41 and 50g | Yes | NA | — | — | NA | NA | NA | + | + | + | M1, Petrotoga |
17.
18.
C. P. A. de Haan R. Kivist? M. L. H?nninen 《Applied and environmental microbiology》2010,76(20):6942-6943
Cj0859c variants fspA1 and fspA2 from 669 human, poultry, and bovine Campylobacter jejuni strains were associated with certain hosts and multilocus sequence typing (MLST) types. Among the human and poultry strains, fspA1 was significantly (P < 0.001) more common than fspA2. FspA2 amino acid sequences were the most diverse and were often truncated.Campylobacter jejuni is the leading cause of bacterial gastroenteritis worldwide and responsible for more than 90% of Campylobacter infections (7). Case-control studies have identified consumption or handling of raw and undercooked poultry meat, drinking unpasteurized milk, and swimming in natural water sources as risk factors for acquiring domestic campylobacteriosis in Finland (7, 9). Multilocus sequence typing (MLST) has been employed to study the molecular epidemiology of Campylobacter (4) and can contribute to virulotyping when combined with known virulence factors (5). FspA proteins are small, acidic, flagellum-secreted nonflagellar proteins of C. jejuni that are encoded by Cj0859c, which is expressed by a σ28 promoter (8). Both FspA1 and FspA2 were shown to be immunogenic in mice and protected against disease after challenge with a homologous strain (1). However, FspA1 also protected against illness after challenge with a heterologous strain, whereas FspA2 failed to do the same at a significant level. Neither FspA1 nor FspA2 protected against colonization (1). On the other hand, FspA2 has been shown to induce apoptosis in INT407 cells, a feature not exhibited by FspA1 (8). Therefore, our aim was to study the distributions of fspA1 and fspA2 among MLST types of Finnish human, chicken, and bovine strains.In total, 367 human isolates, 183 chicken isolates, and 119 bovine isolates (n = 669) were included in the analyses (3). PCR primers for Cj0859c were used as described previously (8). Primer pgo6.13 (5′-TTGTTGCAGTTCCAGCATCGGT-3′) was designed to sequence fspA1. Fisher''s exact test or a chi-square test was used to assess the associations between sequence types (STs) and Cj0859c. The SignalP 3.0 server was used for prediction of signal peptides (2).The fspA1 and fspA2 variants were found in 62.6% and 37.4% of the strains, respectively. In 0.3% of the strains, neither isoform was found. Among the human and chicken strains, fspA1 was significantly more common, whereas fspA2 was significantly more frequent among the bovine isolates (Table (Table1).1). Among the MLST clonal complexes (CCs), fspA1 was associated with the ST-22, ST-45, ST-283, and ST-677 CCs and fspA2 was associated with the ST-21, ST-52, ST-61, ST-206, ST-692, and ST-1332 CCs and ST-58, ST-475, and ST-4001. Although strong CC associations of fspA1 and fspA2 were found, the ST-48 complex showed a heterogeneous distribution of fspA1 and fspA2. Most isolates carried fspA2, and ST-475 was associated with fspA2. On the contrary, ST-48 commonly carried fspA1 (Table (Table1).1). In our previous studies, ST-48 was found in human isolates only (6), while ST-475 was found in both human and bovine isolates (3, 6). The strict host associations and striking difference between fspA variants in human ST-48 isolates and human/bovine ST-475 isolates suggest that fspA could be important in host adaptation.
Open in a separate windowaIn 0.3% of the strains, neither isoform was found. NF, not found.bNA, not associated.A total of 28 isolates (representing 6 CCs and 13 STs) were sequenced for fspA1 and compared to reference strains NCTC 11168 and 81-176. All isolates in the ST-22 CC showed the same one-nucleotide (nt) difference with both NCTC 11168 and 81-176 strains, resulting in a Thr→Ala substitution in the predicted protein sequence (represented by isolate FB7437, GenBank accession number ; Fig. HQ104931Fig.1).1). Eight other isolates in different CCs showed a 2-nt difference (isolate 1970, GenBank accession number ; Fig. HQ104932Fig.1)1) compared to strains NCTC 11168 and 81-176, although this did not result in amino acid substitutions. All 28 isolates were predicted to encode a full-length FspA1 protein.Open in a separate windowFIG. 1.Comparison of FspA1 and FspA2 isoforms. FspA1 is represented by 81-176, FB7437, and 1970. FspA2 is represented by C. jejuni strains 76763 to 1960 (GenBank accession numbers ). Scale bar represents amino acid divergence.In total, 62 isolates (representing 7 CCs and 35 STs) were subjected to fspA2 sequence analysis. Although a 100% sequence similarity between different STs was found for isolates in the ST-21, ST-45, ST-48, ST-61, and ST-206 CCs, fspA2 was generally more heterogeneous than fspA1 and we found 13 predicted FspA2 amino acid sequence variants in total (Fig. HQ104933 to HQ104946(Fig.1).1). In several isolates with uncommon and often unassigned (UA) STs, the proteins were truncated (Fig. (Fig.1),1), with most mutations being ST specific. For example, all ST-58 isolates showed a 13-bp deletion (isolate 3074_2; Fig. Fig.1),1), resulting in a premature stop codon. Also, all ST-1332 CC isolates were predicted to have a premature stop codon by the addition of a nucleotide between nt 112 and nt 113 (isolate 1960; Fig. Fig.1),1), a feature shared with two isolates typed as ST-4002 (UA). A T68A substitution in ST-1960 (isolate T-73494) also resulted in a premature stop codon. Interestingly, ST-1959 and ST-4003 (represented by isolate 4129) both lacked one triplet (nt 235 to 237), resulting in a shorter FspA2 protein. SignalP analysis showed the probability of a signal peptide between nt 22 and 23 (ACA-AA [between the underlined nucleotides]). An A24C substitution in two other strains, represented by isolate 76580, of ST-693 and ST-993 could possibly result in a truncated FspA2 protein as well.In conclusion, our results showed that FspA1 and FspA2 showed host and MLST associations. The immunogenic FspA1 seems to be conserved among C. jejuni strains, in contrast to the heterogeneous apoptosis-inducing FspA2, of which many isoforms were truncated. FspA proteins could serve as virulence factors for C. jejuni, although their roles herein are not clear at this time. 相似文献
TABLE 1.
Percent distributions of fspA1 and fspA2 variants among 669 human, poultry, and bovine Campylobacter jejuni strains and their associations with hosts, STs, and CCsHost or ST complex/ST (no. of isolates) | % of strains witha: | P valueb | |
---|---|---|---|
fspA1 | fspA2 | ||
Host | |||
All (669) | 64.3 | 35.4 | |
Human (367) | 69.5 | 30.0 | <0.001 |
Poultry (183) | 79.2 | 20.8 | <0.001 |
Bovine (119) | 25.2 | 74.8 | <0.0001 |
ST complex and STs | |||
ST-21 complex (151) | 2.6 | 97.4 | <0.0001 |
ST-50 (76) | NF | 100 | <0.0001 |
ST-53 (19) | NF | 100 | <0.0001 |
ST-451 (9) | NF | 100 | <0.0001 |
ST-883 (11) | NF | 100 | <0.0001 |
ST-22 complex (22) | 100 | NF | <0.0001 |
ST-22 (11) | 100 | NF | <0.01 |
ST-1947 (9) | 100 | NF | 0.03 |
ST-45 complex (268) | 99.3 | 0.7 | <0.0001 |
ST-11 (7) | 100 | NF | NA |
ST-45 (173) | 99.4 | 0.6 | <0.0001 |
ST-137 (22) | 95.5 | 4.5 | 0.001 |
ST-230 (14) | 100 | NF | <0.0001 |
ST-48 complex (18) | 44.4 | 55.6 | NA |
ST-48 (7) | 100 | NF | NA |
ST-475 (8) | NF | 100 | <0.001 |
ST-52 complex (5) | NF | 100 | <0.01 |
ST-52 (4) | NF | 100 | 0.02 |
ST-61 complex (21) | NF | 100 | <0.0001 |
ST-61 (11) | NF | 100 | <0.0001 |
ST-618 (3) | NF | 100 | 0.04 |
ST-206 complex (5) | NF | 100 | <0.01 |
ST-283 complex (24) | 100 | NF | <0.0001 |
ST-267 (23) | 100 | NF | <0.0001 |
ST-677 complex (59) | 100 | NF | <0.0001 |
ST-677 (48) | 100 | NF | <0.0001 |
ST-794 (11) | 100 | NF | <0.001 |
ST-692 complex (3) | NF | 100 | 0.04 |
ST-1034 complex (5) | NF | 80 | NA |
ST-4001 (3) | NF | 100 | 0.04 |
ST-1287 complex/ST-945 (8) | 100 | NF | NA |
ST-1332 complex/ST-1332 (4) | NF | 100 | 0.02 |
Unassigned STs | |||
ST-58 (6) | NF | 100 | <0.01 |
ST-586 (6) | 100 | NF | NA |
19.
Aurelio Cafaro Stefania Bellino Fausto Titti Maria Teresa Maggiorella Leonardo Sernicola Roger W. Wiseman David Venzon Julie A. Karl David O'Connor Paolo Monini Marjorie Robert-Guroff Barbara Ensoli 《Journal of virology》2010,84(17):8953-8958
The effects of the challenge dose and major histocompatibility complex (MHC) class IB alleles were analyzed in 112 Mauritian cynomolgus monkeys vaccinated (n = 67) or not vaccinated (n = 45) with Tat and challenged with simian/human immunodeficiency virus (SHIV) 89.6Pcy243. In the controls, the challenge dose (10 to 20 50% monkey infectious doses [MID50]) or MHC did not affect susceptibility to infection, peak viral load, or acute CD4 T-cell loss, whereas in the chronic phase of infection, the H1 haplotype correlated with a high viral load (P = 0.0280) and CD4 loss (P = 0.0343). Vaccination reduced the rate of infection acquisition at 10 MID50 (P < 0.0001), and contained acute CD4 loss at 15 MID50 (P = 0.0099). Haplotypes H2 and H6 were correlated with increased susceptibility (P = 0.0199) and resistance (P = 0.0087) to infection, respectively. Vaccination also contained CD4 depletion (P = 0.0391) during chronic infection, independently of the challenge dose or haplotype.Advances in typing of the major histocompatibility complex (MHC) of Mauritian cynomolgus macaques (14, 20, 26) have provided the opportunity to address the influence of host factors on vaccine studies (13). Retrospective analysis of 22 macaques vaccinated with Tat or a Tat-expressing adenoviral vector revealed that monkeys with the H6 or H3 MHC class IB haplotype were overrepresented among aviremic or controller animals, whereas macaques with the H2 or H5 haplotype clustered in the noncontrollers (12). More recently, the H6 haplotype was reported to correlate with control of chronic infection with simian immunodeficiency virus (SIV) mac251, regardless of vaccination (18).Here, we performed a retrospective analysis of 112 Mauritian cynomolgus macaques, which included the 22 animals studied previously (12), to evaluate the impact of the challenge dose and class IB haplotype on the acquisition and severity of simian/human immunodeficiency virus (SHIV) 89.6Pcy243 infection in 45 control monkeys and 67 monkeys vaccinated with Tat from different protocols (Table (Table11).
Open in a separate windowaAll animals were inoculated with the indicated dose of Tat plasmid DNA (pCV-tat [8], adenovirus-tat [Ad-tat] [27]) or protein, Gag protein, or empty vectors (pCV-0, adenovirus [Ad]) by the indicated route. Doses are in micrograms unless indicated otherwise.bAlum, aluminum phosphate (4); RIBI oil-in-water emulsions containing squalene, bacterial monophosphoryl lipid A, and refined mycobacterial products (4); Iscom, immune-stimulating complex (4); H1D are biocompatible anionic polymeric microparticles used for vaccine delivery (10, 12, 25a).cs.c., subcutaneous; i.m., intramuscular; i.d., intradermal; i.n., intranasal; i.t., intratracheal.dAll animals were inoculated intravenously with the indicated dose of the same SHIV89.6.Pcy243 stock.eAccording to the virological outcome upon challenge, monkeys were grouped as aviremic (A), controllers (C), or viremic (V).fBecause of the short follow-up, controller status could not be determined and all infected monkeys of the ISS-TG protocol were therefore considered viremic.gNA, not applicable. 相似文献
TABLE 1.
Summary of treatment, challenge dose, and outcome of infection in cynomolgus monkeysProtocol code | No. of monkeys | Immunogen (dose)a | Adjuvantb | Schedule of immunization (wk) | Routec | Challenged (MID50) | Virological outcomee | Reference(s) or source | ||
---|---|---|---|---|---|---|---|---|---|---|
A | C | V | ||||||||
ISS-ST | 6 | Tat (10) | Alum or RIBI | 0, 2, 6, 12, 15, 21, 28, 32, 36 | s.c., i.m. | 10 | 4 | 1 | 1 | 4, 17 |
ISS-ST | 1 | Tat (6) | None | 0, 5, 12, 17, 22, 27, 32, 38, 42, 48 | i.d. | 10 | 1 | 0 | 0 | 4, 17 |
ISS-PCV | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben | 0, 2, 6, 11, 15, 21, 28, 32, 36 | i.m. | 10 | 3 | 0 | 0 | 6 |
ISS-ID | 3 | Tat (6) | none | 0, 4, 8, 12, 16, 20, 24, 28, 39, 43, 60 | i.d. | 10 | 1 | 1 | 1 | B. Ensoli, unpublished data |
ISS-TR | 6 | Tat (10) | Alum-Iscom | 0, 2, 6, 11, 16, 21, 28, 32, 36 | s.c., i.d., i.m. | 10 | 4 | 2 | 0 | Ensoli, unpublished |
ISS-TGf | 3 | Tat (10) | Alum | 0, 4, 12, 22 | s.c. | 15 | 0 | 3 | Ensoli, unpublished | |
ISS-TG | 3 | Tatcys22 (10) | Alum | 15 | 0 | 3 | Ensoli, unpublished | |||
ISS-TG | 4 | Tatcys22 (10) + Gag (60) | Alum | 15 | 0 | 4 | Ensoli, unpublished | |||
ISS-TG | 4 | Tat (10) + Gag (60) | Alum | 15 | 0 | 4 | Ensoli, unpublished | |||
ISS-MP | 3 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 38 | s.c., i.m. | 15 | 0 | 2 | 1 | Ensoli, unpublished |
ISS-MP | 3 | Tat (10) | Alum | s.c. | 15 | 0 | 0 | 3 | Ensoli, unpublished | |
ISS-GS | 6 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 36 | s.c., i.m. | 15 | 1 | 3 | 2 | Ensoli, unpublished |
NCI-Ad-tat/Tat | 7 | Ad-tat (5 × 108 PFU), Tat (10) | Alum | 0, 12, 24, 36 | i.n., i.t., s.c. | 15 | 2 | 3 | 2 | Ensoli, unpublished |
NCI-Tat | 9 | Tat (6 and 10) | Alum/Iscom | 0, 2, 6, 11, 15, 21, 28, 32, 36 | s.c., i.d., i.m. | 15 | 2 | 4 | 3 | 12 |
ISS-NPT | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 0 | 0 | 3 | Ensoli, unpublished |
ISS-NPT | 3 | pCV-tatcys22 (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 1 | 1 | 1 | |
Total vaccinated | 67 | 19 | 17 | 31 | ||||||
Naive | 11 | None | None | NAg | NA | 10 or 15 | 1 | 3 | 7 | |
Control | 34 | None, Ad, or pCV-0 | Alum, RIBI, H1D, Iscom or bupivacaine + methylparaben-Iscom | s.c., i.d., i.n., i.t., i.m. | 10, 15, or 20 | 5 | 13 | 16 | ||
Total controls | 45 | 6 | 16 | 23 | ||||||
Total | 112 | 25 | 33 | 54 |