Water and ion binding around RNA and DNA (C,G) oligomers

The dynamics, hydration, and ion-binding features of two duplexes, the A(r(CG)(12)) and the B(d(CG)(12)), in a neutralizing aqueous environment with 0.25 M added KCl have been investigated by molecular dynamics (MD) simulations. The regular repeats of the same C=G base-pair motif have been exploited as a statistical alternative to long MD simulations in order to extend the sampling of the conformational space. The trajectories demonstrate the larger flexibility of DNA compared to RNA helices. This flexibility results in less well defined hydration patterns around the DNA than around the RNA backbone atoms. Yet, 22 hydration sites are clearly characterized around both nucleic acid structures. With additional results from MD simulations, the following hydration scale for C=G pairs can be deduced: A-DNA相似文献   

Modeling high-resolution hydration patterns in correlation with DNA sequence and conformation

Hydration around the DNA fragment d(C5T5).(A5G5) is presented from two molecular dynamics simulations of 10 and 12 ns total simulation time. The DNA has been simulated as a flexible molecule with both the CHARMM and AMBER force fields in explicit solvent including counterions and 0.8 M additional NaCl salt. From the previous analysis of the DNA structure B-DNA conformations were found with the AMBER force-field and A-DNA conformations with CHARMM parameters. High-resolution hydration patterns are compared between the two conformations and between C.G and T.A base-pairs from the homopolymeric parts of the simulated sequence. Crystallographic results from a statistical analysis of hydration sites around DNA crystal structures compare very well with the simulation results. Differences between the crystal sites and our data are explained by variations in conformation, sequence, and limitations in the resolution of water sites by crystal diffraction. Hydration layers are defined from radial distribution functions and compared with experimental results. Excellent agreement is found when the measured experimental quantities are compared with the equivalent distribution of water molecules in the first hydration shell. The number of water molecules bound to DNA was found smaller around T.A base-pairs and around A-DNA as compared to B-DNA. This is partially offset by a larger number of water molecules in hydrophobic contact with DNA around T.A base-pairs and around A-DNA. The numbers of water molecules in minor and major grooves have been correlated with helical roll, twist, and inclination angles. The data more fully explain the observed B-->A transition at low humidity.     

Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations

Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the observed water and ion atmosphere around the DNA sequences is the MD simulation is in good agreement with experimental observations.     

Deducing hydration sites of a protein from molecular dynamics simulations

Invariant water molecules that are of structural or functional importance to proteins are detected from their presence in the same location in different crystal structures of the same protein or closely related proteins. In this study we have investigated the location of invariant water molecules from MD simulations of ribonuclease A, HIV1-protease and Hen egg white lysozyme. Snapshots of MD trajectories represent the structure of a dynamic protein molecule in a solvated environment as opposed to the static picture provided by crystallography. The MD results are compared to an analysis on crystal structures. A good correlation is observed between the two methods with more than half the hydration sites identified as invariant from crystal structures featuring as invariant in the MD simulations which include most of the functionally or structurally important residues. It is also seen that the propensities of occupying the various hydration sites on a protein for structures obtained from MD and crystallographic studies are different. In general MD simulations can be used to predict invariant hydration sites when there is a paucity of crystallographic data or to complement crystallographic results.     

A molecular dynamics study of the 41-56 beta-hairpin from B1 domain of protein G.

The structural and dynamical behavior of the 41-56 beta-hairpin from the protein G B1 domain (GB1) has been studied at different temperatures using molecular dynamics (MD) simulations in an aqueous environment. The purpose of these simulations is to establish the stability of this hairpin in view of its possible role as a nucleation site for protein folding. The conformation of the peptide in the crystallographic structure of the protein GB1 (native conformation) was lost in all simulations. The new equilibrium conformations are stable for several nanoseconds at 300K (>10 ns), 350 K (>6.5 ns), and even at 450 K (up to 2.5 ns). The new structures have very similar hairpin-like conformations with properties in agreement with available experimental nuclear Overhauser effect (NOE) data. The stability of the structure in the hydrophobic core region during the simulations is consistent with the experimental data and provides further evidence for the role played by hydrophobic interactions in hairpin structures. Essential dynamics analysis shows that the dynamics of the peptide at different temperatures spans basically the same essential subspace. The main equilibrium motions in this subspace involve large fluctuations of the residues in the turn and ends regions. Of the six interchain hydrogen bonds, the inner four remain stable during the simulations. The space spanned by the first two eigenvectors, as sampled at 450 K, includes almost all of the 47 different hairpin structures found in the database. Finally, analysis of the hydration of the 300 K average conformations shows that the hydration sites observed in the native conformation are still well hydrated in the equilibrium MD ensemble.     

The effect of structural water molecules on the normal mode spectrum of dTn . dAn x dTn DNA

In this paper we present a theoretical treatment of triplex B type DNA hydration using normal mode calculation techniques. Discrete solvent is added as spines of hydration in the Watson-Crick and Crick-Hoogsteen grooves as well as water bridges between the Phosphate groups. The effect of binding the discrete structural waters on the normal mode of vibration of the system was studied by introducing a parameter, Xw, that is proportional to the degree of water binding and inversely proportional to the relative humidity (RH) of the system. We examined the variation of the dipole moments of characteristic modes with Xw. The results show that there is a direct relationship between the degree of binding of the water molecules to the atoms in the triple helix, the relative humidity of the system and the conformation and stability of the triple helix. At high RH and Xw = 0:0 the triple helix has mostly B type conformation characteristics, with C'2 -endo sugars. The emergence of normal modes of vibration characteristic to the A type conformation (C'3 - endo sugars) at Xw = 0:4 and 60% RH indicates a conformational shift towards A-type for some of the sugars between Xw = 0.2 (80% RH) and Xw = 0.4 (60% RH). These results are in agreement with the "economy of hydration hypothesis" of Saenger (Saenger et al., 1986) which maintains that the main difference in the hydration of A- and B- forms of DNA is the presence of water bridges between adjacent Phosphate groups in the low-hydration A-form but not in the B- form. Free energy calculations for the triplex DNA with structural waters show that there is a minimum of the free energy at Xw = 0.2 and the free energy increases with Xw and becomes larger than the free energy of the B conformation without structural waters for Xw equal to and larger than 0.4. This result indicates that the B conformation is more stable with bound structural water molecules (for degrees of water binding that are not over 20% higher than the degree of binding between bulk water molecules). The structural water molecules are bound much tighter in the A conformation than in the B conformation. The model predicts that the B to A transition occurs at higher relative humidities in D2O than in H2O. Part of these results (Dadarlat, 1997) have been subsequently confirmed by the experimental work and MD simulations of Ouali (Ouali et al., 1997). The experimental results showed that the N-type sugars corresponding to the A conformation are clearly detected below 75% RH.     

On the dependence of molecular conformation on the type of solvent environment: a molecular dynamics study of cyclosporin A

The dependence of the conformation of cyclosporin A (CPA), a cyclic undecapeptide with potent immunosuppressive activity, on the type of solvent environment is examined using the computer simulation method of molecular dynamics (MD). Conformational and dynamic properties of CPA in aqueous solution are obtained from MD simulations of a CPA molecule dissolved in a box with water molecules. Corresponding properties of CPA in apolar solution are obtained from MD simulations of CPA in a box with carbontetrachloride. The results of these simulations in H2O and in CCl4 are compared to each other and to those of previous simulations of crystalline CPA and of an isolated CPA molecule. The conformation of the backbone of the cyclic polypeptide is basically independent of the type of solvent. In aqueous solution the beta-pleated sheet is slightly weaker and the gamma-turn is a bit less pronounced than in apolar solution. Side chains may adopt different conformations in different solvents. In apolar solution the hydrophobic side chain of the MeBmt residue is in an extended conformation with its hydroxyl group hydrogen bonded to the backbone carbonyl group. In aqueous solution this hydrophobic side chain folds over the core of the molecule and the mentioned hydrogen bond is broken in favor of hydrogen bonding to water molecules. The conformation obtained from the MD simulation in CCl4 nicely agrees with experimental atom-atom distance data as obtained from nmr experiments in chloroform. In aqueous solution the relaxation of atomic motion tends to be slower than in apolar solution.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

Lipid hydration and mobility: an interplay between fluorescence solvent relaxation experiments and molecular dynamics simulations

Fluorescence solvent relaxation experiments are based on the characterization of time-dependent shifts in the fluorescence emission of a chromophore, yielding polarity and viscosity information about the chromophore’s immediate environment. A chromophore applied to a phospholipid bilayer at a well-defined location (with respect to the z-axis of the bilayer) allows monitoring of the hydration and mobility of the probed segment of the lipid molecules. Specifically, time-resolved fluorescence experiments, fluorescence quenching data and molecular dynamic (MD) simulations show that 6-lauroyl-2-dimethylaminonaphthalene (Laurdan) probes the hydration and mobility of the sn-1 acyl groups in a phosphatidylcholine bilayer. The time-dependent fluorescence shift (TDFS) of Laurdan provides information on headgroup compression and expansion induced by the addition of different amounts of cationic lipids to phosphatidylcholine bilayers. Those changes were predicted by previous MD simulations. Addition of truncated oxidized phospholipids leads to increased mobility and hydration at the sn-1 acyl level. This experimental finding can be explained by MD simulations, which indicate that the truncated chains of the oxidized lipid molecules are looping back into aqueous phase, hence creating voids below the glycerol level. Fluorescence solvent relaxation experiments are also useful in understanding salt effects on the structure and dynamics of lipid bilayers. For example, such experiments demonstrate that large anions increase hydration and mobility at the sn-1 acyl level of phosphatidylcholine bilayers, an observation which could not be explained by standard MD simulations. If polarizability is introduced into the applied force field, however, MD simulations show that big soft polarizable anions are able to interact with the hydrophilic/hydrophobic interface of the lipid bilayer, penetrating to the level probed by Laurdan, and that they expand and destabilize the bilayer making it more hydrated and mobile.     

Induced fit and the entropy of structural adaptation in the complexation of CAP and lambda-repressor with cognate DNA sequences

Molecular dynamics (MD) simulations of 5 ns on protein-DNA complexes of catabolite-activator protein (CAP), lambda-repressor, and their corresponding uncomplexed protein and DNA, are reported. These cases represent two extremes of DNA bending, with CAP DNA bent severely and the lambda-operator nearly straight when complexed with protein. The calculations were performed using the AMBER suite of programs and the parm94 force field, validated for these studies by good agreement with experimental nuclear magnetic resonance data on DNA. An explicit computational model of structural adaptation and computation of the quasiharmonic entropy of association were obtained from the MD. The results indicate that, with respect to canonical B-form DNA, the extreme bending of the DNA in the complex with CAP is approximately 60% protein-induced and 40% intrinsic to the sequence-dependent structure of the free oligomer. The DNA in the complex is an energetically strained form, and the MD results are consistent with a conformational-capture mechanism. The calculated quasiharmonic entropy change accounts for the entropy difference between the two cases. The calculated entropy was decomposed into contributions from protein adaptation, DNA adaptation, and protein-DNA structural correlations. The origin of the entropy difference between CAP and lambda-repressor complexation arises more from the additional protein adaptation in the case of lambda, than to DNA bending and entropy contribution from DNA bending. The entropy arising from protein DNA cross-correlations, a contribution not previously discussed, is surprisingly large.     

Rationalisation of the Differences between APOBEC3G Structures from Crystallography and NMR Studies by Molecular Dynamics Simulations

The human APOBEC3G (A3G) protein is a cellular polynucleotide cytidine deaminase that acts as a host restriction factor of retroviruses, including HIV-1 and various transposable elements. Recently, three NMR and two crystal structures of the catalytic deaminase domain of A3G have been reported, but these are in disagreement over the conformation of a terminal β-strand, β2, as well as the identification of a putative DNA binding site. We here report molecular dynamics simulations with all of the solved A3G catalytic domain structures, taking into account solubility enhancing mutations that were introduced during derivation of three out of the five structures. In the course of these simulations, we observed a general trend towards increased definition of the β2 strand for those structures that have a distorted starting conformation of β2. Solvent density maps around the protein as calculated from MD simulations indicated that this distortion is dependent on preferential hydration of residues within the β2 strand. We also demonstrate that the identification of a pre-defined DNA binding site is prevented by the inherent flexibility of loops that determine access to the deaminase catalytic core. We discuss the implications of our analyses for the as yet unresolved structure of the full-length A3G protein and its biological functions with regard to hypermutation of DNA.     

Conformational properties of a cyclic peptide bradykinin B2 receptor antagonist using experimental and theoretical methods.

The solution conformation of the cyclic peptide J324 (cyclo0,6-[Lys0,Glu6,D-Phe7]BK), an antagonist targeted at the bradykinin (BK) B2 receptor, has been investigated using experimental and theoretical methods. In order to gain insight into the structural requirements essential for BK antagonism, we carried out molecular dynamics (MD) simulations using simulated annealing as the sampling protocol. Following a free MD simulation we performed simulations using nuclear Overhauser enhancement (NOE) distance constraints determined by NMR experiments. The low-energy structures obtained were compared with each other, grouped into families and analyzed with respect to the presence of secondary structural elements in their backbone. We also introduced new ways of plotting structural data for a more comprehensive analysis of large conformational sets. Finally, the relationship between characteristic backbone conformations and the spatial arrangement of specific pharmacophore centers was investigated.     

Triplex hydration: nanosecond molecular dynamics simulation of the solvated triplex formed by mixed sequences

A theoretical model for the hydration pattern and motion of ions around the triple helical DNA with mixed sequences d(GACTGGTGAC)d(GTCACCAGTC)*d(GACTGGTGAC) in solution, during MD simulation, using the particle mesh Ewald sum method, is elaborated here. The AMBER 5.0 force field has been used during the simulation in solvent. The simulation studies support a dynamically stable atmosphere around the DNA triplex in solution over the entire length of the trajectory. The results have been compared with Hoogsteen triplexes and examined in the context of the observed behaviour of hydration in crystallographic data of duplexes. The dynamical organization of counterions and water molecules around the triplex formed by mixed sequences is described here. It has been observed that cations prefer to bind between two adjoining purines of the second and the third strands. The idea of localized complexes (mobile counterions in unspecific electronegative pockets around the DNA triplex with water molecules) may have important implications for understanding the specificity of the interactions of nucleic acids with proteins and other ligands.     

Monte Carlo simulations of a protein molecule with and without hydration energy calculated by the hydration-shell model

Monte Carlo simulations of a small protein, carmbin, were carried out with and without hydration energy. The methodology presented here is characterized, as compared with the other similar simulations of proteins in solution, by two points: (1) protein conformations are treated in fixed geometry so that dihedral angles are independent variables rather than cartesian coordinates of atoms; and (2) instead of treating water molecules explicitly in the calculation, hydration energy is incorporated in the conformational energy function in the form of g _i A _i, whereA _i is the accessible surface area of an atomic groupi in a given conformation, andg _i is the free energy of hydration per unit surface area of the atomic group (i.e., hydration-shell model). Reality of this model was tested by carrying out Monte Carlo simulations for the two kinds of starting conformations, native and unfolded ones, and in the two kinds of systems,in vacuo and solution. In the simulations starting from the native conformation, the differences between the mean propertiesin vacuo and solution simulations are not very large, but their fluctuations around the mean conformation during the simulation are relatively smaller in solution thanin vacuo. On the other hand, in the simulations starting from the unfolded conformation, the molecule fluctuates much more largely in solution thanin vacuo, and the effects of taking into account the hydration energy are pronounced very much. The results suggest that the method presented in this paper is useful for the simulations of proteins in solution.     

Revisiting the planarity of nucleic acid bases: Pyramidilization at glycosidic nitrogen in purine bases is modulated by orientation of glycosidic torsion

We describe a novel, fundamental property of nucleobase structure, namely, pyramidilization at the N1/9 sites of purine and pyrimidine bases. Through a combined analyses of ultra-high-resolution X-ray structures of both oligonucleotides extracted from the Nucleic Acid Database and isolated nucleotides and nucleosides from the Cambridge Structural Database, together with a series of quantum chemical calculations, molecular dynamics (MD) simulations, and published solution nuclear magnetic resonance (NMR) data, we show that pyramidilization at the glycosidic nitrogen is an intrinsic property. This property is common to isolated nucleosides and nucleotides as well as oligonucleotides—it is also common to both RNA and DNA. Our analysis suggests that pyramidilization at N1/9 sites depends in a systematic way on the local structure of the nucleoside. Of note, the pyramidilization undergoes stereo-inversion upon reorientation of the glycosidic bond. The extent of the pyramidilization is further modulated by the conformation of the sugar ring. The observed pyramidilization is more pronounced for purine bases, while for pyrimidines it is negligible. We discuss how the assumption of nucleic acid base planarity can lead to systematic errors in determining the conformation of nucleotides from experimental data and from unconstrained MD simulations.     

Exploring the counterion atmosphere around DNA: what can be learned from molecular dynamics simulations?

The counterion distribution around a DNA dodecamer (5'-CGCGAATTCGCG-3') is analyzed using both standard and novel techniques based on state of the art molecular dynamics simulations. Specifically, we have explored the population of Na(+) in the minor groove of DNA duplex, and whether or not a string of Na(+) can replace the spine of hydration in the narrow AATT minor groove. The results suggest that the insertion of Na(+) in the minor groove is a very rare event, but that when once the ion finds specific sites deep inside the groove it can reside there for very long periods of time. According to our simulation the presence of Na(+) inside the groove does not have a dramatic influence in the structure or dynamics of the duplex DNA. The ability of current MD simulations to obtain equilibrated pictures of the counterion atmosphere around DNA is critically discussed.     

Molecular dynamics of anthraquinone DNA intercalators with polyethylene glycol side chains

The interactions of a homologous series of four anthraquinone (AQ) intercalators with increasing lengths of polyethylene glycol (PEG) side chains with DNA have been studied via molecular dynamics (MD) simulations. The geometry, conformation, interactions, and hydration of the complexes were examined. The geometries of the four ligands were similar with parallel stacking to the long axis of the adjacent DNA base pairs. Hydrogen bonding between the AQ amide and DNA led to a preference for the trans-syn conformer. As the side chain lengthened, binding to DNA reduced the conformational space, resulting in an increase in unfavorable entropy. Increased localization of the PEG side chain in the DNA groove, indicating some interaction of the side chain with DNA, also contributed unfavorably to the entropy. The changes in free energy of binding due to entropic considerations (-3.9 to -6.3 kcal/mol) of AQ I-IV were significant. The hydration of the PEG side chain decreased upon binding to DNA. Understanding of side chain conformations, interactions, and hydration changes that accompany the formation of a ligand-DNA complex may be important in the development of new applications of pegylated small molecules that target biological macromolecules.