Influence of internucleotide phosphate linkage on relative base stacking in 3'-5' and 2'-5' RNA: a circular dichroic spectroscopic study of RNA hexamer AACCUU.

The variations in base stacking interactions of two isomeric RNA hexamers, 3'-5'r (AACCUU) and 2'-5'r' (AACCUU), have been studied using temperature dependent CD spectroscopy. Both RNA hexamers, in single strand form, exhibited a right handed helical sense. Van't Hoff analysis of the CD spectral results, derived from a two state model, gave a higher enthalpy of stacking for 3'-5' RNA than for 2'-5'RNA. The results suggest that 3'-5' linkage in RNA facilitates formation of better helical stacks in relation to an isomeric 2'-5' linkage.     

Crystal structure of the 2'-5' RNA ligase from Thermus thermophilus HB8

The 2'-5' RNA ligase family members are bacterial and archaeal RNA ligases that ligate 5' and 3' half-tRNA molecules with 2',3'-cyclic phosphate and 5'-hydroxyl termini, respectively, to the product containing the 2'-5' phosphodiester linkage. Here, the crystal structure of the 2'-5' RNA ligase protein from an extreme thermophile, Thermus thermophilus HB8, was solved at 2.5A resolution. The structure of the 2'-5' RNA ligase superimposes well on that of the Arabidopsis thaliana cyclic phosphodiesterase (CPDase), which hydrolyzes ADP-ribose 1",2"-cyclic phosphate (a product of the tRNA splicing reaction) to the monoester ADP-ribose 1"-phosphate. Although the sequence identity between the two proteins is remarkably low (9.3%), the 2'-5' RNA ligase and CPDase structures have two HX(T/S)X motifs in their corresponding positions. The HX(T/S)X motifs play important roles in the CPDase activity, and are conserved in both the CPDases and 2'-5' RNA ligases. Therefore, the catalytic mechanism of the 2'-5' RNA ligase may be similar to that of the CPDase. On the other hand, the electrostatic potential of the cavity of the 2'-5' RNA ligase is positive, but that of the CPDase is negative. Furthermore, in the CPDase, two loops with low B-factors cover the cavity. In contrast, in the 2'-5' RNA ligase, the corresponding loops form an open conformation and are flexible. These characteristics may be due to the differences in the substrates, tRNA and ADP-ribose 1",2"-cyclic phosphate.     

Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages

We report Zn(2+)-dependent deoxyribozymes that ligate RNA. The DNA enzymes were identified by in vitro selection and ligate RNA with k(obs) up to 0.5 min(-)(1) at 1 mM Zn(2+) and 23 degrees C, pH 7.9, which is substantially faster than our previously reported Mg(2+)-dependent deoxyribozymes. Each new Zn(2+)-dependent deoxyribozyme mediates the reaction of a specific nucleophile on one RNA substrate with a 2',3'-cyclic phosphate on a second RNA substrate. Some of the Zn(2+)-dependent deoxyribozymes create native 3'-5' RNA linkages (with k(obs) up to 0.02 min(-)(1)), whereas all of our previous Mg(2+)-dependent deoxyribozymes that use a 2',3'-cyclic phosphate create non-native 2'-5' RNA linkages. On this basis, Zn(2+)-dependent deoxyribozymes have promise for synthesis of native 3'-5'-linked RNA using 2',3'-cyclic phosphate RNA substrates, although these particular Zn(2+)-dependent deoxyribozymes are likely not useful for this practical application. Some of the new Zn(2+)-dependent deoxyribozymes instead create non-native 2'-5' linkages, just like their Mg(2+) counterparts. Unexpectedly, other Zn(2+)-dependent deoxyribozymes synthesize one of three unnatural linkages that are formed upon the reaction of an RNA nucleophile other than a 5'-hydroxyl group. Two of these unnatural linkages are the 3'-2' and 2'-2' linear junctions created when the 2'-hydroxyl of the 5'-terminal guanosine of one RNA substrate attacks the 2',3'-cyclic phosphate of the second RNA substrate. The third unnatural linkage is a branched RNA that results from attack of a specific internal 2'-hydroxyl of one RNA substrate at the 2',3'-cyclic phosphate. When compared with the consistent creation of 2'-5' linkages by Mg(2+)-dependent ligation, formation of this variety of RNA ligation products by Zn(2+)-dependent deoxyribozymes highlights the versatility of transition metals such as Zn(2+) for mediating nucleic acid catalysis.     

Synthesis of (2'-5')(A)n from ATP. Characteristics of the reaction catalyzed by (2'-5')(A)n synthetase purified from mouse Ehrlich ascites tumor cells treated with interferon

The treatment of Ehrlich ascites tumor cells with mouse interferon increases the level of the latent enzyme (2'-5')(A)n synthetase. If activated by double-stranded RNA, this catalyzes the synthesis from ATP of a series of 2'-5'-oligoadenylates: (2'-5')(A)n where n extends from 2 to about 15. We isolated (2'-5')(A)n synthetase in a homogeneous state. In the presence of double-stranded RNA, the purified enzyme can convert the large majority (about 97%) of the ATP into (2'-5')(A)n and pyrophosphate, although it does not cleave the pyrophosphate. The stoichiometry of the reaction can be formulated as: (n + I) ATP leads to (2'-5') pppA(pA)n + n pyrophosphate. Added pyrophosphate does not inhibit the synthesis of (2'-5')(A)n. The extent of the reverse reaction, i.e. the pyrophosphorolysis of (2'-5')(A)n, was below the level of detection under our conditions. The affinity of the enzyme for ATP is low: the rate of the reaction increases by about 10% when the concentration of ATP is increased from 5 mM to 10 mM. The optimal concentration of double-stranded RNA increases with the concentration of the enzyme. As tested at 0.4, 2, and 10 micrograms/ml of enzyme concentrations, close to maximal (2'-5')(A)n synthesis can be obtained if reovirus double-stranded RNA or poly(I) . poly(C) are used at about half the concentration (in w/v) of the enzyme. The plot of the reaction rate versus enzyme concentration is sigmoidal. It remains to be seen if this reflects on a cooperative behavior of the enzyme.     

Interferon action: binding of viral RNA to the 40-kilodalton 2''-5''-oligoadenylate synthetase in interferon-treated HeLa cells infected with encephalomyocarditis virus.

The 40-kDa 2'-5'-oligoadenylate [(2'-5') (A)n] synthetase isoenzyme was proven to be a mediator of the inhibition of encephalomyocarditis virus (EMCV) replication by interferon (IFN). When activated by double-stranded RNA, this enzyme converts ATP into 2'-5'-oligoadenylate [(2'-5') (A)n], and (2'-5') (A)n was found to accumulate in IFN-treated, EMCV-infected cells. The only known function of (2'-5') (A)n is the activation of RNase L, a latent RNase, and this was also implicated in the inhibition of EMCV replication. Intermediates or side products in EMCV RNA replication, presumed to be partially double stranded, were shown to activate (2'-5') (A)n synthetase in vitro. These findings served as the basis of the long-standing hypothesis that the activator of (2'-5') (A)n synthetase in IFN-treated, EMCV-infected cells is the viral RNA. To test this hypothesis, we have generated a polyclonal rabbit antiserum to the human 40-kDa (2'-5') (A)n synthetase. The antiserum immunoprecipitated, from IFN-treated HeLa cells that had been infected with EMCV, the 40-kDa (2'-5') (A)n synthetase protein in complex with both strands of EMCV RNA. The immunoprecipitate was active in (2'-5') (A)n synthesis even without addition of double-stranded RNA, whereas the immunoprecipitate from IFN-treated, uninfected cells was not. These and other results demonstrate that in IFN-treated, EMCV-infected cells, viral RNA is bound to the (2'-5') (A)n synthetase and suggest that the agent activating the (2'-5') (A)n synthetase is the bound viral RNA.     

5'-modified agonist and antagonist (2'-5')(A)n analogues: synthesis and biological activity

Two 5'-modified (2'-5')(A)4 oligomers with an increased resistance to phosphatase degradation were synthesized and evaluated for their ability to develop an antiviral response when introduced into intact cells by microinjection or by chemical conjugation to poly(L-lysine). The enzymatic synthesis of 5'-gamma-phosphorothioate and beta,gamma-difluoromethylene (2'-5')(A)4 from adenosine 5'-O-(3-thiotriphosphate) and adenosine beta,gamma-difluoromethylenetriphosphate by (2'-5')-oligoadenylate synthetase is described. The isolation and characterization of these (2'-5')(A)4 analogues were achieved by high-performance liquid chromatography. The structures of 5'-modified tetramers were corroborated by enzyme digestion. These two 5'-modified tetramers compete as efficiently as natural (2'-5')(A)4 for the binding of a radiolabeled (2'-5')(A)4 probe to ribonuclease (RNase) L. Nevertheless, at the opposite to 5'-gamma-phosphorothioate (2'-5')(A)4, beta,gamma-difluoromethylene (2'-5')(A)4 failed to induce an antiviral response after microinjection in HeLa cells. In addition, it behaves as an antagonist of RNase L as demonstrated by its ability to inhibit the antiviral properties of 5'-gamma-phosphorothioate (2'-5')(A)4 when both are microinjected in HeLa cells. The increased metabolic stability of 5'-gamma-phosphorothioate (2'-5')(A)4 as compared to that of (2'-5')(A)4 was first demonstrated in cell-free extracts and then confirmed in intact cells after introduction in the form of a conjugate to poly(L-lysine). Indeed, 5'-gamma-phosphorothioate (2'-5')(A)4-poly(L-lysine) conjugate induces protein synthesis inhibition and characteristic ribosomal RNA cleavages for longer times than unmodified (2'-5')(A)4-poly(L-lysine) in the same cell system.(ABSTRACT TRUNCATED AT 250 WORDS)     

Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation

Previous experiments have identified numerous RNA ligase deoxyribozymes, each of which can synthesize either 2',5'-branched RNA, linear 2'-5'-linked RNA, or linear 3'-5'-linked RNA. These products may be formed by reaction of a 2'-hydroxyl or 3'-hydroxyl of one RNA substrate with the 5'-triphosphate of a second RNA substrate. Here the inherent propensities for nucleophilic reactivity of specific hydroxyl groups were assessed using RNA substrates related to the natural sequences of spliceosome substrates and group II introns. With the spliceosome substrates, nearly half of the selected deoxyribozymes mediate a ligation reaction involving the natural branch-point adenosine as the nucleophile. In contrast, mostly linear RNA is obtained with the group II intron substrates. Because the two sets of substrates differ at only three nucleotides, we conclude that the location of the newly created ligation junction in DNA-catalyzed branch formation depends sensitively on the RNA substrate sequences. During the experiment that led primarily to branched RNA, we abruptly altered the selection strategy to demand that the deoxyribozymes create linear 3'-5' linkages by introducing an additional selection step involving the 3'-5'-selective 8-17 deoxyribozyme. Although no 3'-5' linkages (相似文献   

Non-enzymatic, template-directed ligation of 2'-5' oligoribonucleotides. Joining of a template and a ligator strand.

Decauridylate containing exclusively a 2'-5' phospho-diester bond ([2'-5']U10) served as a template for the synthesis of oligoadenylates [oligo(A)s] from the 5'-phosphorimidazolide of 2'-5' diadenylate (ImpA-2'p5'A). Joining of [2'-5']U10and ImpA2'p5'A also took place in substantial amounts to yield long-chain oligoribonucleotides in the template-directed reaction. An unusual CD spectrum ascribed to helix formation between [2'-5']U10and [2'-5'](pA)2was observed under the same conditions as that of the template-directed reaction. The 3'-5' linked decauridylate ([3'-5']U10) also promoted the template-directed synthesis of oligo(A)s from ImpA2'p5'A, but more slowly compared with [2'-5']U10. The results indicate that short-chain RNA oligomers with a 2'-5' phosphodiester bond could lead to longer oligoribonucleotides by template-directed chain elongation.     

Transition state structure of 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase from Escherichia coli and its similarity to transition state analogues

Methylthioadenosine/S-adenosylhomocysteine nucleosidase (MTAN) catalyzes reactions linked to polyamine metabolism, quorum sensing pathways, methylation reactions, and adenine salvage. It is a candidate target for antimicrobial drug design. Kinetic isotope effects (KIEs) were measured on the MTAN-catalyzed hydrolysis of 5'-methylthioadenosine (MTA) to determine the transition state structure. KIEs measured at pH 7.5 were near unity due to the large forward commitment to catalysis. Intrinsic KIEs were expressed by increasing the pH to 8.5. Intrinsic KIEs from MTAs labeled at 1'-(3)H, 1'-(14)C, 2'-(3)H, 4'-(3)H, 5'-(3)H, 9-(15)N, and Me-(3)H(3) were 1.160 +/- 0.004, 1.004 +/- 0.003, 1.044 +/- 0.004, 1.015 +/- 0.002, 1.010 +/- 0.002, 1.018 +/- 0.006, and 1.051 +/- 0.002, respectively. The large 1'-(3)H and small 1'-(14)C KIEs indicate that the Escherichia coli MTAN reaction undergoes a dissociative (D(N)A(N)) (S(N)1) mechanism with little involvement of the leaving group or participation of the attacking nucleophile at the transition state, causing the transition state to have significant ribooxacarbenium ion character. A transition state constrained to match the intrinsic KIEs was located with density functional theory [B3LYP/6-31G(d,p)]. The leaving group (N9) is predicted to be 3.0 A from the anomeric carbon. The small beta-secondary 2'-(3)H KIE of 1.044 corresponds to a modest 3'-endo conformation for ribose and a H1'-C1'-C2'-H2' dihedral angle of 53 degrees at the transition state. Natural bond orbital analysis of the substrate and the transition state suggests that the 4'-(3)H KIE is due to hyperconjugation between the lone pair (n(p)) of O3' and the antibonding (sigma) orbital of the C4'-H4' group, and the methyl-(3)H(3) KIE is due to hyperconjugation between the n(p) of sulfur and the sigma of methyl C-H bonds. Transition state analogues that resemble this transition state structure are powerful inhibitors, and their molecular electrostatic potential maps closely resemble that of the transition state.     

Identification of aberrant 2'-5' RNA linkage isomers by pellicular anion exchange chromatography

During chemical RNA synthesis, many undesired products may be formed. In addition to the "n-x" sequences, depurination products, and incompletely deprotected oligonucleotides, linkage isomers may form during condensation and/or deprotection of the synthetic products. Under acidic conditions, bond migration may alter normal 3'-5' diesters to aberrant 2'-5' diesters. This results in isomers that are difficult to identify by MS and LC-MS techniques because the isomers have identical masses. HPLC methods for identification of these isomers have not advanced because the isomers are not expected to exhibit differences in hydrophobicity that allow resolution by reversed-phase columns. Neither are changes in ionic interactions anticipated for these isomers that would allow resolution by ion exchange methods. We observed that chromatography on pellicular anion exchange phases, but not on porous anion exchange phases, completely resolves oligonucleotides with very slight conformation differences (e.g., DNA vs. RNA of identical sequence). Because incorporation of 2'-5' linkages in RNA will alter solution conformation slightly, we considered that this pellicular ion exchanger might also allow resolution of identical RNA sequences harboring aberrant 2'-5' linkages from those lacking aberrant 2'-5' linkages. Using the nonporous DNAPac PA200 column, we demonstrated a chromatographic procedure for resolving synthetic RNA with aberrant linkages from their normally linked counterparts. Under certain conditions, aberrant isomers are not completely resolved from those containing only normal linkages. Therefore, we also developed an independent linkage-confirming method using a 5'-3' exonuclease. This enzyme produces incomplete digestion products during digestion of synthetic RNA containing aberrant 2'-5' linkages, and these are readily resolved by DNAPac PA200 chromatography.     

Expected distance between terminal nucleotides of RNA secondary structures

In "The ends of a large RNA molecule are necessarily close", Yoffe et al. (Nucleic Acids Res 39(1):292-299, 2011) used the programs RNAfold [resp. RNAsubopt] from Vienna RNA Package to calculate the distance between 5' and 3' ends of the minimum free energy secondary structure [resp. thermal equilibrium structures] of viral and random RNA sequences. Here, the 5'-3' distance is defined to be the length of the shortest path from 5' node to 3' node in the undirected graph, whose edge set consists of edges {i, i + 1} corresponding to covalent backbone bonds and of edges {i, j} corresponding to canonical base pairs. From repeated simulations and using a heuristic theoretical argument, Yoffe et al. conclude that the 5'-3' distance is less than a fixed constant, independent of RNA sequence length. In this paper, we provide a rigorous, mathematical framework to study the expected distance from 5' to 3' ends of an RNA sequence. We present recurrence relations that precisely define the expected distance from 5' to 3' ends of an RNA sequence, both for the Turner nearest neighbor energy model, as well as for a simple homopolymer model first defined by Stein and Waterman. We implement dynamic programming algorithms to compute (rather than approximate by repeated application of Vienna RNA Package) the expected distance between 5' and 3' ends of a given RNA sequence, with respect to the Turner energy model. Using methods of analytical combinatorics, that depend on complex analysis, we prove that the asymptotic expected 5'-3' distance of length n homopolymers is approximately equal to the constant 5.47211, while the asymptotic distance is 6.771096 if hairpins have a minimum of 3 unpaired bases and the probability that any two positions can form a base pair is 1/4. Finally, we analyze the 5'-3' distance for secondary structures from the STRAND database, and conclude that the 5'-3' distance is correlated with RNA sequence length.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Affinity labeling of the 3'-OH terminal binding site of the ribonucleic acid chain on deoxyribonucleic acid dependent ribonucleic acid polymerase from Escherichia coli.

Nucleoside triphosphates modified at the 3'-OH are chain terminators for RNA polymerase. They form inactive ternary complexes with the enzyme, poly(dT), and oligoadenylate, the stabilities of which depend upon the length of the oligonucleotide. Employing [5'-32P]p(Ap)10A, together with the reactive analogues 3'-(bromoacetamide)-3'-deoxyadenosine triphosphate or 3'-(isothiocyanato)-2',3'-dideoxyadenosine triphosphate, as well as 3'-amino-3'-deoxyadenosine triphosphate, followed by cross-linking with glyoxal, we labeled RNA polymerase primarily at the beta' subunit. The latter therefore appears to contain at least in part the 3'-OH terminus of the nascent RNA chain when the enzyme is in the form of the ternary complex.     

Elements of thermodynamics in RNA evolution.

The paper presents some aspects correlating thermal stability of RNA folding and the occurrence of structural motifs in natural ribonucleic acids. Particularly, the thermodynamic stability of 2'-5' and 3'-5' linked RNA and the contribution of unpaired terminal nucleotides (dangling ends) in secondary (2D) and tertiary (3D) structures of RNA are discussed. Both examples suggest that during evolution nature selected sequences and structures of RNA which are the most thermally stable and efficient for their biological function.     

Anti-mitogenic function of interferon-induced (2'-5')oligo(adenylate) and growth-related variations in enzymes that synthesize and degrade this oligonucleotide

Addition of (2'5')ApApA to concanavalin-A-stimulated mouse spleen lymphocytes strongly inhibits the large increase in RNA and protein synthesis which takes place 24-48 h after stimulation. The inhibitory effect on protein synthesis precedes the effect on RNA synthesis and takes at least 6 h to be detected. Histone synthesis is preferentially inhibited at 48 h. No effect on protein synthesis was detected in unstimulated resting lymphocytes, or in stimulated lymphocytes during the first 24 h after concanavalin A treatment. The anti-mitogenic effect of the (2'-5')oligo(adenylate) seems to result, therefore, from inhibition of protein synthesis taking place before initiation of DNA replication. The mitogenic stimulus produced by the lectin enhances, in lymphocytes, the level of the 2'-phosphodiesterase which degrades (2'-5')oligo(adenylate). Enhancement of the 2'-phosphodiesterase was also observed after serum stimulation of confluent monkey kidney cells. Furthermore, the ratio of (2'-5')oligo(adenylate) synthetase to 2'-phosphodiesterase is ten-times lower in fast-growing kidney cells than in quiescent serum-starved cells. A model for the role of (2'-5')oligo(adenylate) synthesis and degradation in the regulation of cell proliferation by interferon and by mitogens is presented.     

A chloroplastic RNA ligase activity analogous to the bacterial and archaeal 2´-5' RNA ligase

Bacteria and archaea contain a 2'-5' RNA ligase that seals in vitro 2',3'-cyclic phosphodiester and 5'-hydroxyl RNA termini, generating a 2',5'-phosphodiester bond. In our search for an RNA ligase able to circularize the monomeric linear replication intermediates of viroids belonging to the family Avsunviroidae, which replicate in the chloroplast, we have identified in spinach (Spinacea oleracea L.) chloroplasts a new RNA ligase activity whose properties resemble those of the bacterial and archaeal 2'-5' RNA ligase. The spinach chloroplastic RNA ligase recognizes the 5'-hydroxyl and 2',3'-cyclic phosphodiester termini of Avocado sunblotch viroid and Eggplant latent viroid RNAs produced by hammerhead-mediated self-cleavage, yielding circular products linked through an atypical, most likely 2',5'-phosphodiester, bond. The enzyme neither requires divalent cations as cofactors, nor NTPs as substrate. The reaction apparently reaches equilibrium at a low ratio between the final circular product and the linear initial substrate. Even if its involvement in viroid replication seems unlikely, the identification of a 2'-5' RNA ligase activity in higher plant chloroplasts, with properties very similar to an analogous enzyme widely distributed in bacterial and archaeal proteomes, is intriguing and suggests an important biological role so far unknown.     

Isolation of ΦX174 Specific Messenger Ribonucleic Acids In Vivo and Identification of Their 5′ Terminal Nucleotides

Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) hybridization in formamide at low temperature was applied to hybridization of PhiX174 replicative form DNA and in vivo PhiX174 specific messenger RNA (mRNA) with some modification. We found that PhiX174 mRNA up to molecular weight 1.2 x 10(6) could be hybridized to and eluted from DNA without apparent breakage of phosphodiester bonds and the 5' terminal guanosine triphosphate and adenosine triphosphate of the RNA. By alkali hydrolysis of the purified in vivo PhiX174 mRNA and subsequent thin-layer chromatography of the digest, we isolated the 5' terminal nucleotides and identified them as 2'- or 3'-monophosphate guanosine 5'-triphosphate (pppGp) and 2'- or 3'-monophosphate adenosine 5'-triphosphate (pppAp). By comparing the in vitro and in vivo synthesized PhiX174 mRNA, a difference in the pppAp-pppGp ratio was observed. In the in vitro RNA, this ratio was 1.5, whereas in the in vivo RNA it was 5.5.     

Solid-phase synthesis of branched oligoribonucleotides related to messenger RNA splicing intermediates.

The chemical synthesis of oligoribonucleotides containing vicinal (2'-5')- and (3'-5')-phosphodiester linkages is described. The solid-phase method, based on silyl-phosphoramidite chemistry, was applied to the synthesis of a series of branched RNA [(Xp)nA2' (pN)n3'(pN)n] related to the splicing intermediates derived from Saccharomyces cerevisiae rp51a pre-messenger RNA. The branched oligonucleotides have been thoroughly characterized by nucleoside and branched nucleotide composition analysis. Branched oligoribonucleotides will be useful in the study of messenger RNA splicing and in determining the biological role of RNA 'lariats' and 'forks' in vivo.     

The enzymatic conversion of 3'-phosphate terminated RNA chains to 2',3'-cyclic phosphate derivatives

The enzyme, RNA cyclase, has been purified from cell-free extracts of HeLa cells approximately 6000-fold. The enzyme catalyzes the conversion of 3'-phosphate ends of RNA chains to the 2',3'-cyclic phosphate derivative in the presence of ATP or adenosine 5'-(gamma-thio)triphosphate (ATP gamma S) and Mg2+. The formation of 1 mol of 2',3'-cyclic phosphate ends is associated with the disappearance of 1 mol of 3'-phosphate termini and the hydrolysis of 1 mol of ATP gamma S to AMP and thiopyrophosphate. No other nucleotides could substitute for ATP or ATP gamma S in the reaction. The reaction catalyzed by RNA cyclase was not reversible and exchange reactions between [32P]pyrophosphate and ATP were not detected. However, an enzyme-AMP intermediate could be identified that was hydrolyzed by the addition of inorganic pyrophosphate or 3'-phosphate terminated RNA chains but not by 3'-OH terminated chains or inorganic phosphate. 3'-[32P](Up)10Gp* could be converted to a form that yielded, (Formula: see text) after degradation with nuclease P1, by the addition of wheat germ RNA ligase, 5'-hydroxylpolynucleotide kinase, RNA cyclase, and ATP. This indicates that the RNA cyclase had catalyzed the formation of the 2',3'-cyclic phosphate derivative, the kinase had phosphorylated the 5'-hydroxyl end of the RNA, and the wheat germ RNA ligase had catalyzed the formation of a 3',5'-phosphodiester linkage concomitant with the conversion of the 2',3'-cyclic end to a 2'-phosphate terminated residue.