共查询到20条相似文献,搜索用时 140 毫秒
1.
P Bull J Zaldivar A Venegas J Martial P Valenzuela 《Biochemical and biophysical research communications》1975,64(4):1152-1159
The inactivation of E. coli RNA polymerase (3.3 × 10?7M) by pyridoxal 5′-phosphate (1 × 10?4M to 5 × 10?4M) is a first order process with respect to the remaining active enzyme. Studies of the variation of the first order rate constant with the concentration of pyridoxal 5′-phosphate show that the inactivation reaction follows saturation kinetics. The formation of a reversible enzyme-inhibitor intermediate is postulated. Kinetic studies at different pH values indicate that the inactivation rate constant depends on the mole fraction of one conjugate base with pKa 7.9. The apparent equilibrium constant (association) for the inactivation reaction is independent of the pH and is 1.8 × 104 M?1. By electrophoretic and chromatographic analysis of enzyme hydrolyzates after pyridoxal 5′-phosphate and NaBH4 treatment only N-ε-pyridoxyllysine was found. It is postulated that a lysine ε-amino group with a low pKa is critical for the activity of the enzyme. 相似文献
2.
Shengping Hou Xiang Xiao Fuzhen Li Zhengxuan Jiang Aize Kijlstra Peizeng Yang 《Human genetics》2012,131(12):1841-1850
Previous GWAS studies from Turkey suggested a potential risk locus at CCR1/CCR3 for Beh?et’s disease. However, this locus did not reach the GWAS significance threshold and has not yet been examined in other ethnic populations. The current study aimed to explore whether this locus was associated with Beh?et’s disease in Chinese Han and the functional role of the identified variants. A two-stage association study was performed in 653 patients and 1,685 controls using the iPLEX system. Real-time PCR was performed to examine the expression level of CCR1 and CCR3 genes. Haplotype analysis was used to construct the haplotype block. Logistic regression analysis was applied to calculate the independence of multiple associations. Bonferroni correction was applied to account for multiple testing. First stage analysis showed that ten SNPs, located in 3′UTR, 5′UTR in CCR1 or 5′UTR in CCR3, were significantly associated with Beh?et’s disease (P c?=?0.018 to 1.3?×?10?3). The associations of six SNPs within this locus are independent after control for the genetic effect of rs17282391 using logistic regression analysis. Haplotype analysis identified three associated haplotypes: H3 (GTGAC), H6 (CCATTA) and H9 (CGA) (P c?=?0.04 to 7.79?×?10?4). Three SNPs rs13084057, rs13092160 and rs13075270 showed consistent association in replication and combining studies (replication P c?=?5.31?×?10?5 to 1.44?×?10?5; combining P c?=?2.76?×?10?7 to 6.50?×?10?8). Interestingly, eQTLs database reveals that SNP rs13092160 is eQTLs SNP, suggesting that this SNP is likely to be functional SNP that directly affects gene expression. The expression of CCR1 and CCR3 was increased in individuals with the CT genotype of rs13092160 (P?<?0.05). No significant difference was found for the mRNA level of CCR1 and CCR3 between Beh?et’s patients and controls. These findings strongly indicate CCR1/CCR3 as a novel locus underlying Beh?et’s disease. 相似文献
3.
Chabita Saha Rahul Kumar Asmita Das 《Journal of biomolecular structure & dynamics》2017,35(12):2531-2538
Histones are associated with DNA to form nucleosome essential for chromatin structure and major nuclear processes like gene regulation and expression. Histones consist of H1, H2A, H2B and H3, H4 type proteins. In the present study, combined histones from calf thymus were complexed with ct DNA and their binding affinities were measured fluorimetrically. All the five histones were resolved on SDS page and their binding with DNA was visualized. The values of biding affinities varied with pH and salt concentration. Highest affinity (4.0?×?105 M?1) was recorded at pH 6.5 in 50 mM phosphate buffer and 1.5?×?104 M?1 in 2 M NaCl at pH 7.0. The CD spectra support the highest binding affinity with maximum conformational changes at pH 7.0. The time-resolved fluorescence data recorded two life times for histone tyrosine residues at 300 nm emission in phosphate buffer pH 6.5. These life times did not show much change upon binding with DNA in buffer as well as in 2 M NaCl. The isothermal calorimetric studies yielded thermodynamic parameters ΔG, ΔH and ΔS as ?1.6?×?105 cal/mol, ?1.13?×?103 cal/mol and ?3.80 cal/mol/deg, respectively, evidencing a spontaneous exothermic reaction. The dominant binding forces in building the nucleosome are electrostatic interactions. 相似文献
4.
5.
In this paper, a simple and novel method for the determination of polychlorinated biphenyls (PCBs), using silver nanoparticles (AgNPs) as a resonance light scattering (RLS) probe, is proposed. Under optimized conditions, there existed linear relationships between the enhancing RLS intensity of the system and the concentrations of PCBs in the range 8.0 × 10?8?1.0 × 10?6 g mL?1 for 2,4,4′‐trichlorbiphenyl (PCB28), 9.0 × 10?8?1.0 × 10?6 g mL?1 for 2,2′,5,5′‐tetrachlorbiphenyl (PCB52) and 4.0 × 10?8?1.0 × 10?6 g mL?1 for 3,3′,4,4′‐tetrachlorobiphenyl (PCB77). The corresponding detection limits (S/N = 3) were 2.6 × 10?8 g mL?1 for PCB28, 3.3 × 10?8 g mL?1 for PCB52 and 6.3 × 10?9 g mL?1 for PCB77, respectively. Finally, the mechanism of RLS enhancement was also studied. The results indicated that PCBs were adsorbed on the surface of AgNPs to form larger AgNP–PCB aggregates, resulting in the RLS enhancement of the system. Copyright © 2011 John Wiley & Sons, Ltd. 相似文献
6.
Two new adenosine analogs, 2′-(2-bromoethyl) adenosine monophosphate and 3′-(2-bromoethyl) adenosine monophosphate, were synthesized, purified by semipreparative high-pressure liquid chromatography, and completely characterized. A new synthesis of 5′-(2-bromoethyl) adenosine monophosphate is presented which facilitates the preparation of radioactive reagent with label either in the ethyl group or the purine ring of the nucleotide derivative. The reactive moiety of these derivatives, a bromoalkyl group, has the ability to react with the nucleophilic side chains of several amino acids. The second-order, pH-independent rate constants for reaction with the side chains of the amino acids cysteine, lysine, histidine, and tyrosine were determined as 3×10?4, 6×10?6, 3×10?7, and <1×10?7 M?1 sec?1, respectively. These data could be use in estimating the rate enhancement observed in modification of a protein by these affinity-labeling reagents. 5′-(S-(2-hydroxyethyl)cysteine) adenosine monophosphate, the derivative expected from exhaustive digestion of protein in which a cysteinyl residue is modified by 5′-(2-bromoethyl) adenosine monophosphate, and S-2-hydroxyethyl)cysteine, the derivative anticipated upon acid hydrolysis of such a modified protein, were synthesized, characterized, and their elution positions from an amino acid analyzer determined. These bromoethyl AMP derivatives are potential affinity labels for enzymes that bind 2′-, 3′-, or 5′-nucleotides such as TPN, coenzyme A, or ADP, respectively. 相似文献
7.
Urmila Saha Asma Yasmeen Khan Sutanwi Bhuiya Suman Das Gaetano Fiorillo Paolo Lombardi 《Journal of biomolecular structure & dynamics》2019,37(6):1375-1389
Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M?1, and that of BER was (0.98 ± 0.03) × 105 M?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands. 相似文献
8.
R.C. Patel R. Zupcak S.A. Narang 《Biochemical and biophysical research communications》1978,85(4):1560-1567
The nine base pairs long central region of the operator gene forms a stable double helix. A comparison of melting temperatures with other biologically useful oligonucleotides indicates the importance of specific base sequence. Binding constants measured with ethidium bromide (1.7 × 105 M?1), tyrosine (4.0 × 103 M?1), and glutamine (1.5 × 103 M?1), are interpreted in terms of the involvement of a relatively small number of amino acids in the operator-repressor interaction. 相似文献
9.
The putative histone H4 (F2a1) mRNA has been isolated from early blastula Strongylocentrotus purpuratus sea urchin embryos. Nucleotide sequences of oligonucleotides obtained by digestion of this RNA with T1 ribonuclease have been obtained and many are found to be colinear with the amino acid sequence of histone H4 protein. The sequences obtained from the H4 mRNAs of S. pnrpuratus have been compared with those obtained from Lytechinus pictus (Grunstein & Schedl, 1976). The two mRNAs for this highly conserved protein have undergone considerable divergence of the sort that would be predicted from the degeneracy of the genetic code. 11.5% of the bases have undergone substitution at a rate calculated to be 3 × 10?9 base changes · codon?1 · year?1. 相似文献
10.
Joseph P. Ramos Balaji Babu Sameer Chavda Yang Liu Adam Plaunt Amanda Ferguson Mia Savagian Megan Lee Samuel Tzou Shicai Lin Konstantinos Kiakos Shuo Wang Moses Lee John A. Hartley W. David Wilson 《Biopolymers》2013,99(8):497-507
Synthetic N‐methyl imidazole and N‐pyrrole containing polyamides (PAs) that can form “stacked” dimers can be programmed to target and bind to specific DNA sequences and control gene expression. To accomplish this goal, the development of PAs with lower molecular mass which allows for the molecules to rapidly penetrate cells and localize in the nucleus, along with increased water solubility, while maintaining DNA binding sequence specificity and high binding affinity is key. To meet these challenges, six novel f‐ImPy*Im PA derivatives that contain different orthogonally positioned moieties were designed to target 5′‐ACGCGT‐3′. The synthesis and biophysical characterization of six f‐ImPy*Im were determined by CD, ΔTM, DNase I footprinting, SPR, and ITC studies, and were compared with those of their parent compound, f‐ImPyIm. The results gave evidence for the minor groove binding and selectivity of PAs 1 and 6 for the cognate sequence 5′‐ACGCGT‐3′, and with strong affinity, Keq = 2.8 × 108 M?1 and Keq = 6.2 × 107 M?1, respectively. The six novel PAs presented in this study demonstrated increased water solubility, while maintaining low molecular mass, sequence specificity, and binding affinity, addressing key issues in therapeutic development. © 2013 Wiley Periodicals, Inc. Biopolymers 99: 497–507, 2013. 相似文献
11.
T. B. Kazakova S. G. Babich M. P. Mel'nikova N. V. Tzimbalenko E. A. Braga V. V. Nosikov 《Molecular and cellular biochemistry》1981,35(1):39-47
Summary Rat-liver mitochondrial DNA (mtDNA) contains 2 cleavage sites of the restriction endonuclease XbaI. The molecular sizes of
restriction fragments are 6.6×106 and 3.7×106 D.
The results of partial cleavage of mtDNA with EcoRI allow the fragment F (0.32×106 D) to be localized in the sequence ABCEGFHDA. The functional map of mtDNA is constructed for two genes of the ATP-ase mRNAs
from rat-liver mitochondria.
Molecular hybridization shows that the ATPase genes are located in fragment B and in the GEHD area of mtDNA EcoRI cleavage. 相似文献
12.
The existence of a soluble complex formed by polyuridylic acid (poly (U)) and 3′,5′-cyclic AMP (cAMP) is demonstrated by u.v. extinction vs. temperature curves, optical rotation, equilibrium dialysis, and reaction calorimetry. The complex hasthe stoichiometry of 2 poly (U)-cAMP and its formation is accompanied by an enthalpy change of ?13.0 kcal/mole of base triplet. The introuction of an empirical factor α in the equations given by Damle2 and Crothers2 leads to the evolution of a ΔH value of ?13.4 keal/mole. The parameter α is considered as a correction factor for the concentration dependence of the binding process. There is no relation between α and the reduction of monomer activity due to self-association of monomers. The study of the binding process at several temperatures showed that the cooperativity parameter, σ, is independent of temperature and its value of 6.5 × 10?3 is in good agreement with σ = 5 × 10?3 for the poly (U)·poly(A) system.3 相似文献
13.
Results from this study indicate that adult rat brain posesses guanylate cyclase activity sensitive to serotonin (5-HT) and localized in the synaptic plasma membrane. The enzyme appears to have multiple activation sites for 5-HT with specific activity maxima at the 5-HT concentrations of 5 × 10?10M and 7 × 10?8M respectively. The rates of guanosine-3′:5′-monophosphate (cyclic GMP) formation at these concentrations of 5-HT are, respectively, 170% and 307% above the endogenous or basal production rate of 2.7±0.3picomoles/minute/milligram of synaptosomal membrane protein. We have also been able to identify distinct types (Type #1, #2, #3, and #4) of high affinity, specific binding sites for 5-HT on isolated synaptosomal membranes from rat brain. Dissociation constants of 2.6 × 10?10M, 2.5 × 10?9M, 7.0 × 10?9M, and 4.6 × 10?8M, characterize the binding of 5-HT to our sites of Type #1 through Type #4 respectively. The specific, high affinity binding was saturated at 5-HT concentrations of 5 × 10?10M for the Type #1 sites, 5 × 10?9M for our Type #2 sites, 1 × 10?8M for our Type #3 sites, and 7 × 10?8M for our Type #4 sites. The 5-HT concentrations producing saturation of our specific binding sites of Type #1 and Type #4 are virtually identical to those that elicit the two maxima of 5-HT stimulated cyclic GMP production, indicating that a membrane-bound guanylase cyclase may be closely associated with certain 5-HT receptors and/or re-uptake sites. 相似文献
14.
The rate of [3H]dopamine binding to crude synaptic membranes from canine caudate nucleus was considerably increased by 2 mM ATP, 5′-adenylylimidodiphosphate and GTP or by 1 mM 5′-guanylyl-imidodiphosphate, while strongly inhibited by 2 mM ADP and GDP. Half maximal concentrations of [3H]dopamine to bind to the membranes were 1.11 × 10?7M and 8.75 × 10?6M in the absence of 4 mM ATP, indicating a negative cooperativity of the dopamine receptor, and 9.25 × 10?7 M in its presence. Hill coefficient was increased from 0.70 to 1.04 by addition of 4 mM ATP. The optimal concentration of ATP for [3H]dopamine binding was in the range of 0.5 to 5 mM. 相似文献
15.
N V Beaudette N Langerman R L Kisliuk Y Gaumont 《Archives of biochemistry and biophysics》1977,179(1):272-278
The thermodynamic parameters, ΔH′, ΔG′, and ΔS′, and the stoichiometry for the binding of the substrate 2′-deoxyuridine-5′-phosphate (dUMP) and the inhibitor 5-fluoro-2′-deoxyuridine-5′-phosphate (FdUMP) to Lactobacillus casei thymidylate synthetase (TSase) have been investigated using both direct calorimetric methods and gel filtration methods. The data obtained show that two ligand binding sites are available but that the binding of the second mole of dUMP is extremely weak. Binding of the first mole of dUMP can best be illustrated by dUMP + TSase + H+?(dUMP-TSase-H+). [1] The enthalpy, ΔH1′, for reaction [1] was measured directly on a flow modification of a Beckman Model 190B microcalorimeter. Experiments in two different buffers (I = 0.10 m) show that ΔH1′ = ?28 kJ mol?1 and that 0.87 mol of protons enters into the reaction. Analysis of thermal titrations for reaction [1] indicates a free energy change of ΔG1′ = ?30 kJ mol?1 (K1 = 1.7 × 105 m?1). From these parameters, ΔS1′ was calculated to be +5 J mol?1 degree?1, showing that the reaction is almost totally driven by enthalpy changes. Gel filtration experiments show that at very high substrate concentrations, binding to a second site can be observed. Gel filtration experiments performed at low ionic strength (I = 0.05 m) reveal a stronger binding, with ΔG1′ = ?35 kJ mol?1 (K1 = 1.2 × 106 m?1), suggesting that the forces driving the interaction are, in part, electrostatic. Addition of 2-mercaptoethanol (0.10 m) had the effect of slightly increasing the dUMP binding constant. Binding of FdUMP to TSase is best illustrated by 2FdUMP + TSase + nHH+?FdUMP2 ? TSase ? (H+)nH. [2] The enthalpy for this reaction, ΔH2, was also measured calorimetrically and found to be ?30 kJ mol?1 with nH = 1.24 at pH 7.4 Assuming two FdUMP binding sites per dimer as established by Galivan et al. [Biochemistry15, 356–362 (1976)] our calorimetric results indicate different binding energies for each site. Based on the binding data, a thermodynamic model is presented which serves to rationalize much of the confusing physical and chemical data characterizing thymidylate synthetase. 相似文献
16.
4′-Iodo-, 4′-bromo-, 4′-chloro- and 4′-fluoro-2,3,4,5-tetrachlorobiphenyl were administered to immature male Wistar rats and the effects of this homologous series of 4′-halo-2,3,4,5-tetrachlorobiphenyls on the microsomal drug-metabolizing enzymes were determined. All the halogenated biphenyls increased microsomal benzo[a]pyrene hydroxylase (or aryl hydrocarbon hydroxylase, AHH), ethoxyresorufin (ER) O-deethylase and dimethylaminoantipyrine (DMAP) N-demethylase. The effects of the 4′-halo-2,3,4,5-tetrachlorobiphenyls on the microsomal enzyme activities and on the relative peak intensities and spectral shifts of the reduced cytochrome P-450:CO and ethylisocyanide (EIC) binding difference spectra were similar to those observed after coadministration of phenobarbitone (PB) and 3-methylcholanthrene (MC). The relative activities of the halogenated biphenyls were determined using two assays; namely cytochrome P-448 associated induction in rat hepatoma H-4-II E cells in culture and competitive binding to the hepatic cytosolic receptor protein from male Wistar rats. Dose-response experiments for the iodo, bromo, chloro and fluoro analogs gave EC50(M) values of 8.5×10?9, 6.6×10?8, 5.7×10?7, and 3.3×10?5, and 1.5×10?6, 2.5×10?6, 4.1×10?6 and 2.5×10?5 for the ER O-deethylase induction and receptor binding assays respectively. The relative potencies of the 4′-halo-2,3,4,5-tetrachlorobiphenyls followed the order I>Br>Cl>F for both assays and differences in the EC50 values for the iodo and fluoro analogs were greater than three orders of magnitude for ER O-deethylase induction in rat hepatoma cells in culture. One possible explanation for these effects may be associated with differences in the polarizability of the laterally substituted halogen groups. However, other differences in the physico-chemical properties of the halogen atoms may also be important. 相似文献
17.
Bhupander Kumar V. K. Verma Meenu Mishra Richa Gaur Sanjay Kumar C. S. Sharma 《人类与生态风险评估》2014,20(6):1538-1549
Dichlorodiphenyltrichloroethane (DDT), hexachlorocyclohexane (HCH), and their isomers’ levels in residential soils were determined for the assessment of health risk in Korba, India. Observed concentrations of total HCH and total DDT in soils were more or less comparable with other parts of India and the world. ΣHCH and ΣDDT concentrations ranged between 0.9–20 μg kg?1 and 2–315 μg kg?1, respectively, which were lower than recommended soil quality guidelines indicating low ecotoxicological risk. Carcinogenic and non-carcinogenic impacts of HCH and DDT on human populations through soil ingestion were evaluated and presented. The incremental lifetime cancer risk (ILCR) for adults and children ranged between 7.8 × 10?10–1.6 × 10?7 and 4.1 × 10?9–8.2 × 10?7, respectively. Non-cancer health hazard quotient (HQ) ranged between 5.9 × 10?7–1.8 × 10?3 and 3.1 × 10?6–9.4 × 10?3, respectively, for adults and children. The estimated ILCR and HQ were within the safe acceptable limits of 10?6–10?4 and ≤1.0, respectively, indicating low risk to human populations from exposure to organochlorine pesticides (HCH and DDT) in the study area. 相似文献
18.
Richard G. Barr Thomas J. Pinnavaia 《Journal of biomolecular structure & dynamics》2013,31(3):681-694
Abstract Proton NMR line broadening methods were used to determine the rates of amino proton exchange for disordered 2′ - and 5′ - GMP dianions in aqueous solutions containing tetramethylammonium (TMA+) cations. Replacing TMA+ with Na+ does not substantially alter the exchange rates, provided that H-bonded, Na+-directed tetramer structures are absent. Activation enthalpies (kcal/mol) and entropies (eu) for 2′ - GMP are: ΔH# = 18.5 ± 1.3, ΔS# = 9.6 ± 4.2 for theTMA+ salt atpH 8.10, and ΔH# = 14.7 ± 2.6, ΔS# = -3.7 ± 8.0 for the Na+ salt at pH 8.11. Extrapolated values of pseudo first-order rate constants at 25° Care in the range of k = 1–10 sec?1. At suitable concentrations and temperatures, the Na+ salts of both 2′ - and 5′ - GMP formed stacked and unstacked tetramer units. Relative to the exchange kinetics observed for the disordered nucleotide, the exchange process in the tetramer units was catalyzed in half the amino protons and inhibited in the other half. The catalytic process (k < 103 sec?3) has been attributed to amino protons not involved in interbase H-bonding, where as the inhibited process (k > 10?1 sec?1) was assigned to those protons which do form such bonds. The structure-catalyzed process in both the stacked and unstacked tetramers was manifested by a loss of NMR amino proton intensity due to weighted time-averaging with the resonance for bulk water. A bridging water molecule between an amino proton and a phosphate on an adjacent nucleotide in the tetramer unit may provide a mechanistic pathway for the structure-catalyzed process. 相似文献
19.
Cooperative lengths of DNA during melting 总被引:1,自引:0,他引:1
R D Blake 《Biopolymers》1987,26(7):1063-1074
The mean cooperative length of domains of DNA, determined from the variance in (G + C) content in derivative melting curves of large bacterial DNAs, varies from 230 base pairs (bp) for (A ? T)-rich domains to 580 bp for (G ? C) domains. These values correspond to values for the cooperativity parameter of 2(±2) × 10?5 and 3(±2) × 10?6, respectively, and to +7.2 and +9.6 kcal for the free energy of helix interruption in those regions. 相似文献
20.
S. Arif Kazmi A. Lee Shorter James V. McArdle Uzma Ashiq Rifat Ara Jamal 《化学与生物多样性》2010,7(3):656-665
Thermodynamic parameters for the reduction of ferrioxamine E as calculated from redox potentials determined at four different temperatures were found to be ΔH ≠ =7.1±3.4 kJ mol?1 and ΔS≠=?146 J mol?1 K?1. The negative entropy value is large, because the decrease in the charge at the metal center and an increase in its ionic radius force the structure of the complex to become less rigid and resemble the desferrisiderophore. The hydrophilic groups of the system are now (relatively more) available for solvent interaction. Thus, a large negative entropy change accompanies the reduction of the complex. Kinetics of reduction of ferrioxamine by VII, CrII, EuII, and dithionite were measured at different temperatures and by dithionite at different pH values. The CrII and EuII reactions proceed by an inner‐sphere mechanism and have second‐order rate constants at 25° of 1.37×104 and 1.23×105 M ?1 s?1, respectively. For the VII reduction, the corresponding rate constant was 1.89×103 M ?1 s?1. The activation parameters for the VII reduction were ΔH≠ = 8.3 kJ mol?1; ΔS≠ = ?154 J mol?1 K?1. These values are indicative of an outer‐sphere mechanism for VII reduction. The reduction by dithionite is half order in dithionite concentration indicating that SO . is the sole reducing species. log of reduction rate constants of different trihydroxamates by this reductant were correlated with their respective redox potentials, and the variation was found to be in approximate correspondence with the expectations of Marcus relationship. 相似文献