The primary structure of cytoplasmic initiator transfer ribonucleic acid from Torulopsis utilis

Cytoplasmic initiator transfer ribonucleic acid (tRNAinit) was purified from bulk Torulopsis (Candida) utilis tRNA by a series of column chromatography procedures. Sequence analysis of the products of complete and partial digestion of this tRNA with ribonuclease A [EC 3.1.4.22] and ribonuclease T1 [EC 3.1.4.8] enabled us to determine the complete primary structure of the molecule. The chain length of this tRNA was 76, including 11 modified nucleotides. The structure of the tRNA was arranged into a cloverleaf model and compared with those of other initiator tRNA species. As in the cytoplasmic initiator tRNA's of most other eukaryotic cells, the sequence -A-U-C-G- is contained in this tRNA in place of the usual -T-psi-C-G (or A)- found in other tRNA's.     

Nucleotide sequence of phenylalanine transfer RNA from Schizosaccharomyces pombe: implications for transfer RNA recognition by yeast phenylalanyl-tRNA synthetase.

The nucleotide sequence of Schizosaccharomyces pombe tRNAPhe was determined to be pG-U-C-G-C-A-A-U-G**-G*-U-G-psi-A-G-D-D-G-G-G-A-G-C-A-psi-G*-A-C-A-G-A-Cm-U-Gm-A-A-Y-A-psi-m5C-U-G-U-U-G-m7G-U*-C-A-U-C-G-G-T-psi-C-G-A-U-C-C-C-G-G-U-U-U-G-U-G-A-C-A-C-C-AOH. This sequence differs from that of S. cerevisiae tRNAPhe in 27 nucleotides. Saccharomyces cerevisiae phenylalanyl-tRNA synthetase aminoacylates both the homologous tRNAPhe and S. pombe t-NAPhe; the reactions have similar Km and Vmax values. However, the nucleotide sequence in the D stem is different in the two tRNAs. This region was proposed by Roe, B., et al. [(1973) Biochemistry 12, 4146--4154] to be the major recognition site for yeast phenylalanyl-tRNA synthetase, but the present results cast doubt on the validity of this hypothesis.     

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA)

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.     

The complete mitochondrial genome sequence of the pathogenic yeast Candida (Torulopsis) glabrata

We report here the complete sequence of the mitochondrial (mt) genome of the pathogenic yeast Candida glabrata. This 20 kb mt genome is the smallest among sequenced hemiascomycetous yeasts. Despite its compaction, the mt genome contains the genes encoding the apocytochrome b (COB), three subunits of ATP synthetase (ATP6, 8 and 9), three subunits of cytochrome oxidase (COX1, 2 and 3), the ribosomal protein VAR1, 23 tRNAs, small and large ribosomal RNAs and the RNA subunit of RNase P. Three group I introns each with an intronic open reading frame are present in the COX1 gene. This sequence is available under accession number AJ511533.     

RNA removal from Candida utilis by chemical and thermal treatments

The removal of the content of nucleic acids of fodder yeast (Candida utilis) by treatment with HCl or heat shock was investigated Acid concentrations between 5 and 15% (on dried matter basis) were used. A maximal removal of the content of nucleic acids of 88% was realized wheńn was worked with 15% HCl, 90 °C during 30 minutes. But under this conditions were observed high demanges of protein and also of some essential amino acids Good results for diminishing the content of nucleic acids were reached with the highest concentration of acid and a treatment during 20 minutes The experiments with heat shock were carried out at 68 °C, different times for heating and different contents of yeast In this way better results than for treatment with acid according to diminishing the content of nucleic acids and yield of protein and essential amino acids were reached A removal of over 80% of the content of nucleic acids was achieved in all cases.