Transduction of a Plasmid Carrying the Cohesive End Region from Lactococcus lactis Bacteriophage ΦLC3

Plasmids carrying the cohesive end region from temperate lactococcal bacteriophage ΦLC3 could be packaged in vivo by ΦLC3 and transduced into its host strain, Lactococcus lactis subsp. cremoris NCDO 1201. The transduction frequencies were between 10^-4 and 10^-3 transducing particles per PFU, depending on the size of the phage DNA insert. This transduction system is limited to only certain lactococcal strains. The ΦLC3 cohesive site region (cos) appears to play an important role in plasmid transduction.     

Sequencing and analysis of the cos region of the lactococcal bacteriophage c2

The cohesive termini of the DNA genome of the lactococcal bacteriophage c2 were directly sequenced and appeared to be complementary, non-symmetrical, 9-nucleotide single-stranded, 3′ extended DNAs, with the following sequence: 5′-GTTAGGCTT-3′ 3′-CAATCCGAA-5′. DNA located on either side of the cohesive ends was sequenced and several repeats and a region with the potential for a DNA bend were found. Previously sequenced cos regions of 13 other bacteriophages were also examined for similar sequence features. All of the bacteriophages from gram-positive hosts had 3′ extended DNA termini, in contrast to the bacteriophages from gram-negative hosts, which had 5′ extended DNA termini. All bacteriophages had a region of dyad symmetry close to the cohesive termini. A 7.3 kb DNA fragment of the c2 genome containing the cos sequences was cloned; transduction experiments demonstrated that these cloned sequences could act as a substrate for packaging enzymes of phage c2.     

Sequencing and analysis of the cos region of the lactococcal bacteriophage c2

The cohesive termini of the DNA genome of the lactococcal bacteriophage c2 were directly sequenced and appeared to be complementary, non-symmetrical, 9-nucleotide single-stranded, 3 extended DNAs, with the following sequence: 5-GTTAGGCTT-3 3-CAATCCGAA-5. DNA located on either side of the cohesive ends was sequenced and several repeats and a region with the potential for a DNA bend were found. Previously sequenced cos regions of 13 other bacteriophages were also examined for similar sequence features. All of the bacteriophages from gram-positive hosts had 3 extended DNA termini, in contrast to the bacteriophages from gram-negative hosts, which had 5 extended DNA termini. All bacteriophages had a region of dyad symmetry close to the cohesive termini. A 7.3 kb DNA fragment of the c2 genome containing the cos sequences was cloned; transduction experiments demonstrated that these cloned sequences could act as a substrate for packaging enzymes of phage c2.     

Detection of lactococcal 936-species bacteriophages in whey by magnetic capture hybridization PCR targeting a variable region of receptor-binding protein genes

AIMS: To develop PCR assays able to distinguish between groups within lactococcal 936-species bacteriophages, as defined by their different receptor-binding protein (RBP) genes. METHODS AND RESULTS: DNA sequences of RBP genes from 17 lactococcal bacteriophages of the 936-species were compared, and six phage groups were identified. For each phage group a specific primer pair targeting a variable region of the RBP genes was designed. In nine of 20 whey samples, from dairies with recorded phage problems, between one and six phage groups were identified by conventional PCR. The sensitivity and specificity of the method was improved by magnetic capture hybridization (MCH)-PCR using a capture probe targeting an 80-bp highly conserved region just upstream from the RBP gene in all the investigated phages. The MCH-PCR was performed on 100 microl whey samples and the detection limit of the assay was 10(2)-10(3) PFU ml(-1) as opposed to the detection limit of 10(4) PFU ml(-1) for conventional PCR performed on 1-microl whey samples. CONCLUSIONS: In this study, PCR assays have been developed to detect six different types of RBP genes in lactococcal 936-species bacteriophages. SIGNIFICANCE AND IMPACT OF THE STUDY: The PCR assays have practical applications at cheese plants for detection of 936-species phages with different RBP and thereby potentially with different host ranges. This knowledge will make it possible to improve starter culture rotation systems in the dairy industry.     

Characterization of interspecific plasmid transfer mediated by Bacillus subtilis temperate bacteriophage SP02.

Plasmid pPL1010 is a 7.0-kilobase derivative of plasmid pUB110 that harbors the cohesive end site of the bacteriophage SP02 genome. Plasmid pPL1017 is a 6.8-kilobase derivative of plasmid pC194 that contains the immunity region of bacteriophage phi 105 and the cohesive end site of bacteriophage SP02. These plasmids are transducible by bacteriophage SP02 at a frequency of 10(-2) transductants per PFU among mutant derivatives of Bacillus subtilis 168 and have been transferred to other strains of B. subtilis and B. amyloliquefaciens by means of bacteriophage SP02-mediated transduction, with frequencies ranging from 10(-5) to 10(-7) transductants per PFU. The introduced plasmids were stably maintained in nearly all new hosts in the absence of selective pressure. An exception was found in B. subtilis DSM704, which also harbored three cryptic plasmids. Plasmids pPL1010 and pPL1017 were incompatible with a 7.9-kilobase replicon native to strain DSM704. Furthermore, plasmid pPL1017 was processed by strain DSM704 into a approximately 5.3-kilobase replicon that was compatible with the resident plasmid content of strain DSM704. The use of bacteriophage SP02-mediated plasmid transduction has allowed the identification of Bacillus strains that are susceptible to bacteriophage SP02-mediated genetic transfer but cannot support bacteriophage SP02 lytic infection.     

The nucleotide sequence for the replication region of pVS40, a lactococcal food grade cloning vector

The replication region of a limited host range lactococcal vector, pVS40, was located within a 2359 bp Eco RI- Cla I fragment. Within this fragment a sequence for a 1197 bp reading frame coding for a 46 826 Da protein together with a putative ribosomal binding site and the -10 and -35 promoter regions could be detected. Immediately upstream from the promoter were three complete and one nearly complete successive direct repeats (TATAGCGTATGAAAAAACTGTG), suggesting an origin of replication. The protein has considerable homologies to certain lactococcal plasmid replication proteins.     

Lactococcal 949 Group Phages Recognize a Carbohydrate Receptor on the Host Cell Surface

Lactococcal bacteriophages represent one of the leading causes of dairy fermentation failure and product inconsistencies. A new member of the lactococcal 949 phage group, named WRP3, was isolated from cheese whey from a Sicilian factory in 2011. The genome sequence of this phage was determined, and it constitutes the largest lactococcal phage genome currently known, at 130,008 bp. Detailed bioinformatic analysis of the genomic region encoding the presumed initiator complex and baseplate of WRP3 has aided in the functional assignment of several open reading frames (ORFs), particularly that for the receptor binding protein required for host recognition. Furthermore, we demonstrate that the 949 phages target cell wall phospho-polysaccharides as their receptors, accounting for the specificity of the interactions of these phages with their lactococcal hosts. Such information may ultimately aid in the identification of strains/strain blends that do not present the necessary saccharidic target for infection by these problematic phages.     

Surface display of the receptor-binding region of the Lactobacillus brevis S-layer protein in Lactococcus lactis provides nonadhesive lactococci with the ability to adhere to intestinal epithelial cells

Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactococcus lactis NZ9000. Western blot assay of lactococcal cell wall extracts with anti-SlpA antibodies confirmed that the SlpA adhesion domain of the fusion protein was expressed and located within the cell wall layer. Whole-cell enzyme-linked immunosorbent assay and immunofluorescence microscopy verified that the SlpA adhesion-mediating region was accessible on the lactococcal cell surface. In vitro adhesion assays with the human intestinal epithelial cell line Intestine 407 indicated that the recombinant lactococcal cells had gained an ability to adhere to Intestine 407 cells significantly greater than that of wild-type L. lactis NZ9000. Serum inhibition assay further confirmed that adhesion of recombinant lactococci to Intestine 407 cells was indeed mediated by the N terminus-encoding part of the slpA gene. The ability of the receptor-binding region of SlpA to adhere to fibronectin was also confirmed with this lactococcal surface display system. These results show that, with the aid of the receptor-binding region of the L. brevis SlpA protein, the ability to adhere to gut epithelial cells can indeed be transferred to another, nonadhesive, lactic acid bacterium.     

Cloning of genomic DNA of Lactococcus lactis that restores phage sensitivity to an unusual bacteriophage sk1-resistant mutant

An unusual, spontaneous, phage sk1-resistant mutant (RMSK1/1) of Lactococcus lactis C2 apparently blocks phage DNA entry into the host. Although no visible plaques formed on RMSK1/1, this host propagated phage at a reduced efficiency. This was evident from center-of-infection experiments, which showed that 21% of infected RMSK1/1 formed plaques when plated on its phage-sensitive parental strain, C2. Moreover, viable cell counts 0 and 4 h after infection were not significantly different from those of an uninfected culture. Further characterization showed that phage adsorption was normal, but burst size was reduced fivefold and the latent period was increased from 28.5 to 36 min. RMSK1/1 was resistant to other, but not all, similar phages. Phage sensitivity was restored to RMSK1/1 by transformation with a cloned DNA fragment from a genomic library of a phage-sensitive strain. Characterization of the DNA that restored phage sensitivity revealed an open reading frame with similarity to sequences encoding lysozymes (beta-1,4-N-acetylmuramidase) and lysins from various bacteria, a fungus, and phages of Lactobacillus and Streptococcus and also revealed DNA homologous to noncoding sequences of temperate phage of L. lactis, DNA similar to a region of phage sk1, a gene with similarity to tRNA genes, a prophage attachment site, and open reading frames with similarities to sun and to sequences encoding phosphoprotein phosphatases and protein kinases. Mutational analyses of the cloned DNA showed that the region of homology with lactococcal temperate phage was responsible for restoring the phage-sensitive phenotype. The region of homology with DNA of lactococcal temperate phage was similar to DNA from a previously characterized lactococcal phage that suppresses an abortive infection mechanism of phage resistance. The region of homology with lactococcal temperate phage was deleted from a phage-sensitive strain, but the strain was not phage resistant. The results suggest that the cloned DNA with homology to lactococcal temperate phage was not mutated in the phage-resistant strain. The cloned DNA apparently suppressed the mechanism of resistance, and it may do so by mimicking a region of phage DNA that interacts with components of the resistance mechanism.     

Nucleotide sequence and distribution of the pTR2030 resistance determinant (hsp) which aborts bacteriophage infection in lactococci

The lactococcal plasmid pTR2030 encodes resistance to bacteriophage attack via two mechanisms, an abortive-infection mechanism, designated Hsp, and a restriction and modification system. We present the complete sequence of the hsp structural gene. The gene is 1,887 base pairs in length and encodes a protein with a predicted molecular mass of 73.8 kilodaltons. The upstream region was cloned in a promoter-screening vector and shown to direct the constitutive expression of the cat-86 gene. An internal probe was used to determine the distribution of the hsp sequence in industrially significant lactococcal strains and to evaluate its relatedness to another lactococcal plasmid implicated in an abortive-infection-type mechanism, pNP40. No homology was detected, suggesting that this gene is not widely distributed in lactococci. Therefore, there are at least two independent abortive-infection genotypes in lactococci.     

Effect of Temperature on the Activities of Cytochrome c Oxidase and Respiration in Cassava Root Mitochondria

Cosmid pR4Cl is a derivative of multicopy plasmid pIJ365 which has an insertion of the cos (cohesive end site) region of actinophage R4 [T. Morino, H. Takahashi and H. Saito, Mol. Gen. Genet., 198, 228 (1985)]. When the donor R4 phage was propagated in S. lividans carrying the plasmid, the phage lysate contained transducing particles which encapsulated head-to-tail concatemers of the plasmid DNA. These particles could mediate transfer of the plasmid at a high frequency. We examined conditions that gave a maximum transduction frequency of cosmid pR4Cl. Conditions which depress R4 phage propagation, such as incubation of recipient S. parvulus at a high temperature, improved the frequency. Obviously such conditions minimized the lethal effect of viable phage propogation. The highest transduction frequency obtained so far was around 3 × 10^-3 transductants per infected phage when S. lividans was used as the recipient. This was about 30 per cent of the cosmid transducing particles estimated from the cosmid DNA content in the transducing lysate. The significance of cosmid transduction for gene manipulation in Streptomyces strains is also discussed.     

Sequence analysis and molecular characterization of the temperate lactococcal bacteriophage r1t

The temperate lactococcal bacteriophage r1t was isolated from its lysogenic host and its genome was subjected to nucleotide sequence analysis. The linear r1t genome is composed of 33 350 bp and was shown to possess 3′ staggered cohesive ends. Fifty open reading frames (ORFs) were identified which are, probably, organized in a life-cycle-specific manner. Nucleotide sequence comparisons, N-terminal amino acid sequencing and functional analyses enabled the assignment of possible functions to a number of DNA sequences and ORFs. In this way, ORFs specifying regulatory proteins, proteins involved in DNA replication, structural proteins, a holin, a lysin, an integrase, and a dUTPase were putatively identified. One ORF seems to be contained within a self-splicing group I intron. In addition, the bacteriophage att site required for site-specific integration into the host chromosome was determined.     

Nucleotide sequence and distribution of the pTR2030 resistance determinant (hsp) which aborts bacteriophage infection in lactococci.

The lactococcal plasmid pTR2030 encodes resistance to bacteriophage attack via two mechanisms, an abortive-infection mechanism, designated Hsp, and a restriction and modification system. We present the complete sequence of the hsp structural gene. The gene is 1,887 base pairs in length and encodes a protein with a predicted molecular mass of 73.8 kilodaltons. The upstream region was cloned in a promoter-screening vector and shown to direct the constitutive expression of the cat-86 gene. An internal probe was used to determine the distribution of the hsp sequence in industrially significant lactococcal strains and to evaluate its relatedness to another lactococcal plasmid implicated in an abortive-infection-type mechanism, pNP40. No homology was detected, suggesting that this gene is not widely distributed in lactococci. Therefore, there are at least two independent abortive-infection genotypes in lactococci.     

Processing of the lactococcal extracellular serine proteinase

Activity of the lactococcal cell envelope-located serine proteinase depends on the presence of membrane-associated lipoprotein PrtM. To differentiate between the action of the proteinase and the action of PrtM in the process of proteinase maturation, an inactive form of the lactococcal proteinase was constructed. This was done by mutating one of the three amino acids thought to constitute the active site of the enzyme. The secreted form of this inactivated proteinase was the same size as the inactive secreted form of the proteinase produced in the absence of PrtM. Both inactive proteinases are larger than the active proteinase. Isolation of proteinase by washing lactococcal cells carrying the complete proteinase gene in a Ca(2+)-free buffer was prevented by the absence of prtM or the absence of a functional active site. We propose that PrtM, during or after membrane translocation of the proteinase, effects the autoproteolytic removal of the N-terminal pro region of the proteinase. Subsequent C-terminal autodigestion results in the release of the enzyme from the lactococcal cells.     

Processing of the lactococcal extracellular serine proteinase.

Activity of the lactococcal cell envelope-located serine proteinase depends on the presence of membrane-associated lipoprotein PrtM. To differentiate between the action of the proteinase and the action of PrtM in the process of proteinase maturation, an inactive form of the lactococcal proteinase was constructed. This was done by mutating one of the three amino acids thought to constitute the active site of the enzyme. The secreted form of this inactivated proteinase was the same size as the inactive secreted form of the proteinase produced in the absence of PrtM. Both inactive proteinases are larger than the active proteinase. Isolation of proteinase by washing lactococcal cells carrying the complete proteinase gene in a Ca(2+)-free buffer was prevented by the absence of prtM or the absence of a functional active site. We propose that PrtM, during or after membrane translocation of the proteinase, effects the autoproteolytic removal of the N-terminal pro region of the proteinase. Subsequent C-terminal autodigestion results in the release of the enzyme from the lactococcal cells.     

Surface Display of the Receptor-Binding Region of the Lactobacillusbrevis S-Layer Protein in Lactococcuslactis Provides Nonadhesive Lactococci with the Ability To Adhere to Intestinal Epithelial Cells

Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactococcus lactis NZ9000. Western blot assay of lactococcal cell wall extracts with anti-SlpA antibodies confirmed that the SlpA adhesion domain of the fusion protein was expressed and located within the cell wall layer. Whole-cell enzyme-linked immunosorbent assay and immunofluorescence microscopy verified that the SlpA adhesion-mediating region was accessible on the lactococcal cell surface. In vitro adhesion assays with the human intestinal epithelial cell line Intestine 407 indicated that the recombinant lactococcal cells had gained an ability to adhere to Intestine 407 cells significantly greater than that of wild-type L. lactis NZ9000. Serum inhibition assay further confirmed that adhesion of recombinant lactococci to Intestine 407 cells was indeed mediated by the N terminus-encoding part of the slpA gene. The ability of the receptor-binding region of SlpA to adhere to fibronectin was also confirmed with this lactococcal surface display system. These results show that, with the aid of the receptor-binding region of the L. brevis SlpA protein, the ability to adhere to gut epithelial cells can indeed be transferred to another, nonadhesive, lactic acid bacterium.     

Exploitation of plasmid pMRC01 to direct transfer of mobilizable plasmids into commercial lactococcal starter strains

Genetic analysis of the 60.2-kb lactococcal plasmid pMRC01 revealed a 19.6-kb region which includes putative genes for conjugal transfer of the plasmid and a sequence resembling an origin of transfer (oriT). This oriT-like sequence was amplified and cloned on a 312-bp segment into pCI372, allowing the resultant plasmid, pRH001, to be mobilized at a frequency of 3.4 x 10(-4) transconjugants/donor cell from an MG1363 (recA mutant) host containing pMRC01. All of the resultant chloramphenicol-resistant transconjugants contained both pRH001 and genetic determinants responsible for bacteriocin production and immunity of pMRC01. This result is expected, given that transconjugants lacking the lacticin 3147 immunity determinants (on pMRC01) would be killed by bacteriocin produced by the donor cells. Indeed, incorporation of proteinase K in the mating mixture resulted in the isolation of transformants, of which 47% were bacteriocin deficient. Using such an approach, the oriT-containing fragment was exploited to mobilize pRH001 alone to a number of lactococcal hosts. These results demonstrate that oriT of pMRC01 has the potential to be used in the development of mobilizable food-grade vectors for the genetic enhancement of lactococcal starter strains, some of which may be difficult to transform.     

Cloning of Genomic DNA of Lactococcus lactis That Restores Phage Sensitivity to an Unusual Bacteriophage sk1-Resistant Mutant

An unusual, spontaneous, phage sk1-resistant mutant (RMSK1/1) of Lactococcus lactis C2 apparently blocks phage DNA entry into the host. Although no visible plaques formed on RMSK1/1, this host propagated phage at a reduced efficiency. This was evident from center-of-infection experiments, which showed that 21% of infected RMSK1/1 formed plaques when plated on its phage-sensitive parental strain, C2. Moreover, viable cell counts 0 and 4 h after infection were not significantly different from those of an uninfected culture. Further characterization showed that phage adsorption was normal, but burst size was reduced fivefold and the latent period was increased from 28.5 to 36 min. RMSK1/1 was resistant to other, but not all, similar phages. Phage sensitivity was restored to RMSK1/1 by transformation with a cloned DNA fragment from a genomic library of a phage-sensitive strain. Characterization of the DNA that restored phage sensitivity revealed an open reading frame with similarity to sequences encoding lysozymes (β-1,4-N-acetylmuramidase) and lysins from various bacteria, a fungus, and phages of Lactobacillus and Streptococcus and also revealed DNA homologous to noncoding sequences of temperate phage of L. lactis, DNA similar to a region of phage sk1, a gene with similarity to tRNA genes, a prophage attachment site, and open reading frames with similarities to sun and to sequences encoding phosphoprotein phosphatases and protein kinases. Mutational analyses of the cloned DNA showed that the region of homology with lactococcal temperate phage was responsible for restoring the phage-sensitive phenotype. The region of homology with DNA of lactococcal temperate phage was similar to DNA from a previously characterized lactococcal phage that suppresses an abortive infection mechanism of phage resistance. The region of homology with lactococcal temperate phage was deleted from a phage-sensitive strain, but the strain was not phage resistant. The results suggest that the cloned DNA with homology to lactococcal temperate phage was not mutated in the phage-resistant strain. The cloned DNA apparently suppressed the mechanism of resistance, and it may do so by mimicking a region of phage DNA that interacts with components of the resistance mechanism.