Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.     

Analysis of an activatable promoter: sequences in the simian virus 40 late promoter required for T-antigen-mediated trans activation.

The late promoter of simian virus 40 (SV40) is activated in trans by the viral early gene product, T antigen. We inserted the wild-type late-promoter region, and deletion mutants of it, into chloramphenicol acetyltransferase transient expression vectors to identify promoter sequences which are active in the presence of T antigen. We defined two promoter activities. One activity was mediated by a promoter element within simian virus 40 nucleotides 200 to 270. The activity of this element was detectable only in the presence of an intact, functioning origin of replication and accounted for 25 to 35% of the wild-type late-promoter activity in the presence of T antigen. The other activity was mediated by an element located within a 33-base-pair sequence (simian virus nucleotides 168 to 200) which spans the junction of the 72-base-pair repeats. This element functioned in the absence of both the origin of replication and the T-antigen-binding sites and appeared to be responsible for trans-activated gene expression. When inserted into an essentially promoterless plasmid, the 33-base-pair element functioned in an orientation-dependent manner. Under wild-type conditions in the presence of T antigen, the activity of this element accounted for 65 to 75% of the late-promoter activity. The roles of the 33-base-pair element and T antigen in trans-activation are discussed.     

Simian virus 40 T antigen activates the late promoter by modulating the activity of negative regulatory elements.

Late promoter activity measured before viral DNA replication results from a complex involvement of negative and positive cis-acting elements located both in the enhancer and in the 21-bp repeats. GC motifs located within the 21-bp repeats act in cooperation with sequences overlapping the early TATA box to down-regulate the late promoter activity. Analysis of insertion mutants indicates that the late promoter might be negatively regulated at least partially by the early promoter machinery. The GTI motif located within the enhancer as well as the GC motifs lose the ability to down-regulate the late promoter in the presence of T antigen. Results obtained with tsA58 protein indicate that two different domains of T antigen are involved in the negative autoregulation of the early promoter activity and in the release of the down-regulation of the late promoter by the GC motifs.     

Simian virus 40 deletion mutants that transform with reduced efficiency.

We have constructed two simian virus 40 (SV40) early-region deletion mutants that lack a significant portion of the sequences normally used to encode the SV40 large tumor antigen. Despite these deletions, the mutants were able to transform mouse cells in a focus assay, although with a frequency that was drastically reduced relative to wild-type SV40. Cell lines expanded from the mutant-transformed foci contained integrated mutant DNA, expressed an SV40 tumor antigen (small-t), and exhibited a range of transformed phenotypes, which included the ability to grow while suspended in soft agar. We also present evidence that these mutants are defective for abortive transformation in an assay that tested the transient loss of anchorage dependence. Their ability to stably transform, contrasted with their inability to abortively transform at detectable levels, raises the possibility that the mechanism by which these mutants transform may be different from that of wild-type SV40.     

Simian virus 40 late proteins possess lytic properties that render them capable of permeabilizing cellular membranes

Many nonenveloped viruses have evolved an infectious cycle that culminates in the lysis or permeabilization of the host to enable viral release. How these viruses initiate the lytic event is largely unknown. Here, we demonstrated that the simian virus 40 progeny accumulated at the nuclear envelope prior to the permeabilization of the nuclear, endoplasmic reticulum, and plasma membranes at a time which corresponded with the release of the progeny. The permeabilization of these cellular membranes temporally correlated with late protein expression and was not observed upon the inhibition of their synthesis. To address whether one or more of the late proteins possessed an inherent capacity to induce membrane permeabilization, we examined the permeability of Escherichia coli that separately expressed the late proteins. VP2 and VP3, but not VP1, caused the permeabilization of bacterial membranes. Additionally, VP3 expression resulted in bacterial cell lysis. These findings demonstrate that VP3 possesses an inherent lytic property that is independent of eukaryotic signaling or cell death pathways.     

Simian immunodeficiency virus is restricted to a subset of blood CD4+ lymphocytes that includes memory cells

HIV and the related simian immunodeficiency virus (SIV), which causes AIDS in macaques, infect only a small percentage of CD4+ lymphocytes at any point during the disease. We have identified three distinct cellular phenotypes within the CD4+ subpopulation in macaques, based on cell surface expression of CD44 and CD45R, which putatively represent successive stages of postthymic proliferation and functional maturation. Two of these subsets, CD44hi CD45R+, which contained virtually all circulating cells in cycle, and CD44hi CD45R-, which was noncycling and has been linked to immunologic memory, were selectively depleted in SIV-infected animals at an asymptomatic stage of disease. To test whether SIV infection was restricted to cells with this phenotype in vivo, we used the polymerase chain reaction to sensitively detect SIV DNA in purified subpopulations of CD4+ lymphocytes. We found that SIV exclusively infected blood lymphocytes expressing high levels of CD44. Within this subset infection occurred not only in the fraction containing actively proliferating cells (CD45R+), but also in resting, putative memory cells (CD45R-). These data directly demonstrate that cellular maturation stages of normal postthymic T lymphocyte differentiation are important factors in permitting lentivirus infection in vivo, and that noncycling, memory T cells may be a reservoir for SIV.     

Simian immunodeficiency virus promoter exchange results in a highly attenuated strain that protects against uncloned challenge virus

Among the many simian immunodeficiency virus (SIV) immunogens, only live attenuated viral vaccines have afforded strong protection to a natural pathogenic isolate. Since the promoter is crucial to the tempo of viral replication in general, it was reasoned that promoter exchange might confer a novel means of attenuating SIV. The core enhancer and promoter sequences of the SIV macaque 239nefstop strain (NF-κB/Sp1 region from −114 bp to mRNA start) have been exchanged for those of the human cytomegalovirus immediate-early promoter (CMV-IE; from −525 bp to mRNA start). During culture of the resulting virus, referred to as SIVmegalo, on CEMx174 or rhesus macaque peripheral blood mononuclear cells, deletions arose in distal regions of the CMV-IE sequences that stabilized after 1 or 2 months of culture. However, when the undeleted form of SIVmegalo was inoculated into rhesus macaques, animals showed highly controlled viremia during primary and persistent infection. Compared to parental virus infection in macaques, primary viremia was reduced by >1,000-fold to undetectable levels, with little sign of an increase of cycling cells in lymph nodes, CD4⁺ depletion, or altered T-cell activation markers in peripheral blood. Moreover, in contrast to wild-type infection in most infected animals, the nef stop mutation did not revert to the wild-type codon, indicating yet again that replication was dramatically curtailed. Despite such drastic attenuation, antibody titers and enzyme-linked immunospot reactivity to SIV peptides, although slower to appear, were comparable to those seen in a parental virus infection. When animals were challenged intravenously at 4 or 6 months with the uncloned pathogenic SIVmac251 strain, viremia was curtailed by ~1,000-fold at peak height without any sign of hyperactivation in CD4⁺- or CD8⁺-T-cell compartment or increase in lymph node cell cycling. To date, there has been a general inverse correlation between attenuation and protection; however, these findings show that promoter exchange constitutes a novel means to highly attenuate SIV while retaining the capacity to protect against challenge virus.     

Simian virus 40 origin auxiliary sequences weakly facilitate T-antigen binding but strongly facilitate DNA unwinding.

The complete simian virus 40 (SV40) origin of DNA replication (ori) consists of a required core sequence flanked by two auxiliary sequences that together increase the rate of DNA replication in monkey cells about 25-fold. Using an extract of SV40-infected monkey cells that reproduced the effects of ori-auxiliary sequences on DNA replication, we examined the ability of ori-auxiliary sequences to facilitate binding of replication factors and to promote DNA unwinding. Although the replicationally active form of T antigen in these extracts had a strong affinity for ori-core, it had only a weak but specific affinity for ori-auxiliary sequences. Deletion of ori-auxiliary sequences reduced the affinity of ori-core for active T antigen by only 1.6-fold, consistent with the fact that saturating concentrations of T antigen in the cell extract did not reduce the stimulatory role of ori-auxiliary sequences in replication. In contrast, deletion of ori-auxiliary sequences reduced the efficiency of ori-specific, T-antigen-dependent DNA unwinding in cell extracts at least 15-fold. With only purified T antigen in the presence of topoisomerase I to unwind purified DNA, ori-auxiliary sequences strongly facilitated T-antigen-dependent DNA conformational changes consistent with melting the first 50 base pairs. Under these conditions, ori-auxiliary sequences had little effect on the binding of T antigen to DNA. Therefore, a primary role of ori-auxiliary sequences in DNA replication is to facilitate T-antigen-dependent DNA unwinding after the T-antigen preinitiation complex is bound to ori-core.     

Simian virus 40-permissive cell interactions: selection and characterization of spontaneously arising monkey cells that are resistant to simian virus 40 infection.

A fraction of permissive cells survive simian virus 40 (SV40) infection. The frequency of such surviving cells depends only upon the concentration of infecting virus, both parental and progeny, to which the cells are exposed during the course of selection. Surviving clones, which can be freed of virus by cloning in the presence of SV40 antiserum, are indistinguishable from parental cells in their growth of characteristics and display no SV40 antigen; thus they are not transformed. Most surviving clones are less than 10% as susceptible as parental cells to SV40 infection; 5 to 10% are less than 1% as susceptible. None of these SV40-resistant clones is absolutely resistant to SV40 infection. Analysis of 16 independently arising resistant clones indicates that they all block SV40 infection at an early stage after adsorption and eclipse but before full uncoating. Viral mutants have been isolated that partially overcome the block to infection in these cells; these host range viruses plaque on resistant lines fivefold more efficiently than wild-type SV40 and have a characteristic plaque morphology. Fluctuation analysis indicates that resistant cells arise spontaneously during the growth of normally susceptible permissive cells. Thus, SV40-resistant cells are selected for, not induced by, SV40 infection.