In Vivo and In Vitro Localization of Leishmania within Macrophage Phagolysosomes: Use of Colloidal Gold as a Lysosomal Label1

The interaction of Leishmania with lysosomes within macrophages in vivo has been investigated. Lysosomes labeled with colloidal gold in vivo fused with phagocytic vacuoles containing Leishmania amastigotes within the macrophages of infected footpad tissue of BALB/c mice. This localization of Leishmania within macrophage phagolysosomes in vivo is the first confirmation for any obligate intracellulaire protozoon that parasite-lysosome interactions in vitro occur in vivo.     

The preparation of neoglycoconjugates containing inter-saccharide phosphodiester linkages as potential anti-Leishmania vaccines

The Leishmaniaexpress complex glycoconjugates containing phosphosaccharide repeat units at all stages of their life-cycle. One of these molecules, lipophosphoglycan (LPG) has been suggested to be a vaccine candidate. To assess the immunological properties of Leishmaniaphosphosaccharides, we have prepared neoglycoproteins and neoglycolipids containing synthetic Leishmaniaphosphosaccharide repeats. The coupling procedure uses the dec-9-enyl spacer of previously synthesised phosphosaccharides for linkage to protein and phospholipid. This alkene moiety is converted by ozonolysis to an aldehyde which is then attached to protein and phospholipid amino groups by reductive amination. The procedure produces neoglycoconjugates in good yield and without compromising the labile phosphodiester linkages within the phosphosaccharide chains.     

Mucosal immunity against Eimeria acervulina infection in broiler chickens following oral immunization with profilin in Montanide™ adjuvants

Leishmaniasis is a disease caused by the unicellular Leishmania parasite. World wide millions of people are affected by this vector born disease. The disease presents itself in different clinical manifestations which are caused by specific Leishmania species. The therapeutic strategy depends on the Leishmania species involved. It is important to detect Leishmania and subsequently type the infecting species in a sensitive way using PCR. Various targets have been proposed but two seem to be best suited, the ITS1 region and the mini-exon. There is, however, no consensus as to which of these two is best. The aim of this study was to compare both targets with our current method, a PCR on the 18S ribosomal RNA gene. The ITS1 PCR proved to be slightly more sensitive and more practical than the mini-exon. Nevertheless, the mini-exon is more polymorphic and is needed in subtyping Leishmania species belonging to the L. Viannia subgenus. The ITS1 method was adapted to use as a real-time PCR for diagnostic purposes. In addition, designing and testing a new primer set improved sensitivity of the PCR on the mini-exon.     

Localization and induction of the A2 virulence factor in Leishmania: evidence that A2 is a stress response protein

Leishmaniasis is a vector‐borne infectious disease with a wide range of pathologies depending on the species of Leishmania. Leishmania parasites are transmitted by the sand fly vector as promastigotes; within the mammalian host, Leishmania parasites differentiate into amastigotes and replicate in macrophages. The A2 protein from Leishmania donovani is expressed predominantly in amastigotes and therefore likely plays a role in survival in the mammalian host. In the present study, we have determined that the A2 protein colocalized with the Leishmania endoplasmic reticulum binding protein, BiP, was induced by stress and complexed with BiP following heat shock. The A2 gene in Leishmania major is a non‐expressed pseudogene, and we present evidence that ectopic expression of a transfected A2 gene in L. major enhanced its viability following heat shock. A2 may therefore play a role in protecting L. donovani from stress associated with infection in visceral organs, including the fever typically associated with visceral leishmaniasis. Interestingly, when comparing A2 protein localization, we also observed that the Leishmania secreted acid phosphatase SAcP protein was transported out of the parasite‐containing phagolysosome and was located throughout the macrophage cytoplasm in vesicles, providing the first example of a secreted Leishmania‐derived protein exiting the parasite‐containing phagolysosome.     

Towards discovery of new leishmanicidal scaffolds able to inhibit Leishmania GSK-3

Abstract

Previous reports have validated the glycogen synthase kinase-3 (GSK-3) as a druggable target against the human protozoan parasite Leishmania. This prompted us to search for new leishmanicidal scaffolds as inhibitors of this enzyme from our in-house library of human GSK-3β inhibitors, as well as from the Leishbox collection of leishmanicidal compounds developed by GlaxoSmithKline. As a result, new leishmanicidal inhibitors acting on Leishmania GSK-3 at micromolar concentrations were found. These inhibitors belong to six different chemical classes (thiadiazolidindione, halomethylketone, maleimide, benzoimidazole, N-phenylpyrimidine-2-amine and oxadiazole). In addition, the binding mode of the most active compounds into Leishmania GSK-3 was approached using computational tools. On the whole, we have uncovered new chemical scaffolds with an appealing prospective in the development and use of Leishmania GSK-3 inhibitors against this infectious protozoan.     

Homology modeling and atomic level binding study of Leishmania MAPK with inhibitors

The current therapy for leishmaniasis is not sufficient and it has two severe drawbacks, host-toxicity and drug resistance. The substantial knowledge of parasite biology is not yet translating into novel drugs for leishmaniasis. Based on this observation, a 3D structural model of Leishmania mitogen-activated protein kinase (MAPK) homologue has been developed, for the first time, by homology modeling and molecular dynamics simulation techniques. The model provided clear insight in its structure features, i.e. ATP binding pocket, phosphorylation lip, and common docking site. Sequence-structure homology recognition identified Leishmania CRK3 (LCRK3) as a distant member of the MAPK superfamily. Multiple sequence alignment and 3D structure model provided the putative ATP binding pocket of Leishmania with respect to human ERK2 and LCRK3. This analysis was helpful in identifying the binding sites and molecular function of the Leishmania specific MAPK homologue. Molecular docking study was performed on this 3D structural model, using different classes of competitive ATP inhibitors of LCRK3, to check whether they exhibit affinity and could be identified as Leishmania MAPK specific inhibitors. It is well known that MAP kinases are extracellular signal regulated kinases ERK1 and ERK2, which are components of the Ras-MAPK signal transduction pathway which is complexed with HDAC4 protein, and their inhibition is of significant therapeutic interest in cancer biology. In order to understand the mechanism of action, docking of indirubin class of molecules to the active site of histone deacetylase 4 (HDAC4) protein is performed, and the binding affinity of the protein-ligand interaction was computed. The new structural insights obtained from this study are all consistent with the available experimental data, suggesting that the homology model of the Leishmania MAPK and its ligand interaction modes are reasonable. Further the comparative molecular electrostatic potential and cavity depth analysis of Leishmania MAPK and human ERK2 suggested several important differences in its ATP binding pocket. Such differences could be exploited in the future for designing Leishmania specific MAPK inhibitors.     

Isolation and detection of Leishmania species among naturally infected Rhombomis opimus, a reservoir host of zoonotic cutaneous leishmaniasis in Turkemen Sahara, North East of Iran

In Iran, three species of Leishmania have been incriminated as the causative agents of human leishmaniasis, Leishmania (L.) major, Leishmania tropica, and Leishmania infantum.Rhombomis opimus have been incriminated as a principal reservoirs of the parasitic protozoan Leishmania major, the causative agent of rural zoonotic cutaneous leishmaniasis (ZCL) in Iran. Rodents captured and examined to find Leishmania species using conventional methods including direct impression smear and microscopic observation inoculation samples to Balb/c and culture in NNN medium. Also molecular method was employed to detect Leishmania in rodents by amplifying a region of the ribosomal RNA amplicon of Leishmania (ITS1-5.8S rRNA–ITS2) using Nested PCR. Leshmania species were specified by DNA sequences. 36 (38.3%) of R. opimus were Leishmania positive using at least one conventional methods. Many more ITS-rDNA fragments were amplified from R. opimus but only 65 out of 74 PCR products contained enough DNA for direct sequencing or readable sequences. The PCR assays detected in Iranian R. opimus not only Leishmania major in 59 (79.7%) rodents but also Leishmania turanica in 6 (8.1%) rodents, another parasite of the great gerbil. These parasites were found in Turkemen Sahara, North East of Iran, in a focus of rural (ZCL). L. major and L. turanica in R. opimus firmly identified from Turkemen Sahara. Nine rodents with Leishmania infections unidentified which some were unreadable sequences, these could be mixed infections of L. major, L. turanica, Leishmania gerbillisensu lato and Leishmania close to L. gerbilli or a related species reported in sandflies previously from this location. The haplotypes of L. major and L. turanica were found to be identical to that of isolates of L. major and L. turanica from Iran and in GenBank elsewhere. R. opimus is probably the key reservoir in this ZCL focus because of its abundance and its infection rates with both L. major and L. turanica.     

Microtubule target for new antileishmanial drugs based on ethyl 3-haloacetamidobenzoates

A new family of antimicrotubule drugs named (3-haloacetamidobenzoyl) ureas and ethyl 3-haloacetamidobenzoates were found to be cytotoxic to the Leishmania parasite protozoa. While the benzoylureas were shown to strongly inhibit in vitro mammalian brain microtubule assembly, the ethyl ester derivatives were characterized as very poor inhibitors of this process. Ethyl 3-chloroacetamidobenzoate, MF29, was found to be the most efficient drug on the promastigote stage of three Leishmania species (IC₅₀: 0.3–1.8 μM). MF29 maintained its activity against the clinical relevant intracellular stage of L. mexicana with IC₅₀ value of 0.33 μM. It was the only compound that exhibits a high activity on all the Leishmania species tested. This compound appeared to alter parasite microtubule organisation as demonstrated by using antibodies directed against microtubule components and more precisely the class of microtubule decorated by the MAP2-like protein. It is interesting to notice that this MAP2-like protein was identified for the first time in a Leishmania parasite     

Visceral leishmaniasis with cardiac involvement in a dog: a case report

A dog presented with cutaneous nodules, enlarged lymph nodes and oedema in limbs, face and abdomen. The diagnosis of visceral leishmaniasis was established by identification of Leishmania amastigotes within macrophages from skin and popliteal lymph node biopsies. At necropsy, lesions were found in different organs, but it was particularly striking to observe large areas of pallor in the myocardium. Histological examination revealed an intense chronic inflammatory reaction in many organs, and numerous macrophages were found to contain amastigote forms of Leishmania. The inflammatory reaction was especially severe in the heart, where large areas of the myocardium appeared infiltrated with huge numbers of mononuclear immune cells, causing cardiac muscle atrophy and degeneration. Despite the severe inflammation, the number of parasitized macrophages was low in the myocardium, as revealed by immunohistochemical staining of Leishmania amastigotes. Because cardiac involvement is not usually described in this condition, this dog represents a very rare case of canine visceral leishmaniasis with affection of the myocardium.     

Gene expression modulation and the molecular mechanisms involved in Nelfinavir resistance in Leishmania donovani axenic amastigotes

Drug resistance is a major public health challenge in leishmaniasis chemotherapy, particularly in the case of emerging Leishmania/HIV‐1 co‐infections. We have delineated the mechanism of cell death induced by the HIV‐1 protease inhibitor, Nelfinavir, in the Leishmania parasite. In order to further study Nelfinavir–Leishmania interactions, we selected Nelfinavir‐resistant axenic amastigotes in vitro and characterized them. RNA expression profiling analyses and comparative genomic hybridizations of closely related Leishmania species were used as a screening tool to compare Nelfinavir‐resistant and ‐sensitive parasites in order to identify candidate genes involved in drug resistance. Microarray analyses of Nelfinavir‐resistant and ‐sensitive Leishmania amastigotes suggest that parasites regulate mRNA levels either by modulating gene copy numbers through chromosome aneuploidy, or gene deletion/duplication by homologous recombination. Interestingly, supernumerary chromosomes 6 and 11 in the resistant parasites lead to upregulation of the ABC class of transporters. Transporter assays using radiolabelled Nelfinavir suggest a greater drug accumulation in the resistant parasites and in a time‐dependent manner. Furthermore, high‐resolution electron microscopy and measurements of intracellular polyphosphate levels showed an increased number of cytoplasmic vesicular compartments known as acidocalcisomes in Nelfinavir‐resistant parasites. Together these results suggest that Nelfinavir is rapidly and dramatically sequestered in drug‐induced intracellular vesicles.     

Fluorescent Leishmania species: development of stable GFP expression and its application for in vitro and in vivo studies

Reporter genes have proved to be an excellent tool for studying disease progression. Recently, the green fluorescent protein (GFP) ability to quantitatively monitor gene expression has been demonstrated in different organisms. This report describes the use of Leishmania tarentolae (L. tarentolae) expression system (LEXSY) for high and stable levels of GFP production in different Leishmania species including L. tarentolae, L. major and L. infantum. The DNA expression cassette (pLEXSY-EGFP) was integrated into the chromosomal ssu locus of Leishmania strains through homologous recombination. Fluorescent microscopic image showed that GFP transgenes can be abundantly and stably expressed in promastigote and amastigote stages of parasites. Furthermore, flow cytometry analysis indicated a clear quantitative distinction between wild type and transgenic Leishmania strains at both promastigote and amastigote forms. Our data showed that the footpad lesions with GFP-transfected L. major are progressive over time by using fluorescence small-animal imaging system. Consequently, the utilization of stable GFP-transfected Leishmania species will be appropriate for in vitro and in vivo screening of anti-leishmanial drugs and vaccine development as well as understanding the biology of the host–parasite interactions at the cellular level.     

Sphingosine kinase A is a pleiotropic and essential enzyme for Leishmania survival and virulence

Sphingosine kinase is a key enzyme in sphingolipid metabolism, catalysing the conversion of sphingosine or dihydrosphingosine into sphingosine‐1‐phosphate or dihydrosphingosine‐1‐phosphate respectively. In mammals, sphingosine‐1‐phosphate is a powerful signalling molecule regulating cell growth, differentiation, apoptosis and immunity. Functions of sphingosine kinase or sphingosine‐1‐phosphate in pathogenic protozoans are virtually unknown. While most organisms possess two closely related sphingosine kinases, only one sphingosine kinase homologue (SKa) can be identified in Leishmania, which are vector‐borne protozoan parasites responsible for leishmaniasis. Leishmania SKa is a large, cytoplasmic enzyme capable of phosphorylating both sphingosine and dihydrosphingosine. Remarkably, deletion of SKa leads to catastrophic defects in both the insect stage and mammalian stage of Leishmania parasites. Genetic and biochemical analyses demonstrate that proper expression of SKa is essential for Leishmania parasites to remove toxic metabolites, to survive stressful conditions, and to cause disease in mice. Therefore, SKa is a pleiotropic enzyme with vital roles throughout the life cycle of Leishmania. The essentiality of SKa and its apparent divergence from mammalian counterparts suggests that this enzyme can be selectively targeted to reduce Leishmania infection.     

The <Emphasis Type="Italic">Leishmania amazonensis</Emphasis> TRF (TTAGGG repeat-binding factor) homologue binds and co-localizes with telomeres

Background  

Telomeres are specialized structures at the end of chromosomes essential for maintaining genome stability and cell viability. The importance of telomeric proteins for telomere maintenance has increased our interest in the identification of homologues within the genus Leishmania. The mammalian TRF1 and TRF2 proteins, for example, bind double-stranded telomeres via a Myb-like DNA-binding domain and are involved with telomere length regulation and chromosome end protection. In addition, TRF2 can modulate the activity of several enzymes and influence the conformation of telomeric DNA. In this work, we identified and characterized a Leishmania protein (LaTRF) homologous to both mammalian TRF1 and TRF2.     

Leishmania mexicana can utilize amino acids as major carbon sources in macrophages but not in animal models

Leishmania parasites target macrophages in their mammalian hosts and proliferate within the mature phagolysosome compartment of these cells. Intracellular amastigote stages are dependent on sugars as a major carbon source in vivo, but retain the capacity to utilize other carbon sources. To investigate whether amastigotes can switch to using other carbon sources, we have screened for suppressor strains of the L. mexicana Δlmxgt1‐3 mutant which lacks the major glucose transporters LmxGT1‐3. We identified a novel suppressor line (Δlmxgt1‐3^s2) that has restored growth in rich culture medium and virulence in ex vivo infected macrophages, but failed to induce lesions in mice. Δlmxgt1‐3^s2 amastigotes had lower rates of glucose utilization than the parental line and primarily catabolized non‐essential amino acids. The increased mitochondrial metabolism of this line was associated with elevated levels of intracellular reactive oxygen species, as well as increased sensitivity to inhibitors of the tricarboxylic acid (TCA) cycle, including nitric oxide. These results suggest that hardwired sugar addiction of Leishmania amastigotes contributes to the intrinsic resistance of this stage to macrophage microbicidal processes in vivo, and that these stages have limited capacity to switch to using other carbon sources.     

Leishmania cell surface prohibitin: role in host–parasite interaction

Proteins selectively upregulated in infective parasitic forms could be critical for disease pathogenesis. A mammalian prohibitin orthologue is upregulated in infective metacyclic promastigotes of Leishmania donovani, a parasite that causes visceral leishmaniasis. Leishmania donovani prohibitin shares 41% similarity with mammalian prohibitin and 95–100% within the genus. Prohibitin is concentrated at the surface of the flagellar and the aflagellar pole, the aflagellar pole being a region through which host–parasite interactions occur. Prohibitin is attached to the membrane through a GPI anchor. Overexpression of wild‐type prohibitin increases protein surface density resulting in parasites with higher infectivity. However, parasites overexpressing a mutant prohibitin with an amino acid substitution at the GPI anchor site to prevent surface expression through GPI‐link show lesser surface expression and lower infective abilities. Furthermore, the presence of anti‐prohibitin antibodies during macrophage–Leishmania interaction in vitro reduces infection. The cognate binding partner for Leishmania prohibitin on the host cell appears to be macrophage surface HSP70, siRNA mediated downregulation of which abrogates the capability of the macrophage to bind to parasites. Leishmania prohibitin is able to generate a strong humoral response in visceral leishmaniasis patients. The above observations suggest that prohibitin plays an important role in events leading to Leishmania–host interaction.     

Binding of Leishmania spp with gold nanoparticles supported polyethylene glycol and its application for the sensitive detection of infectious photogenes in human plasma samples: A novel biosensor

The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmania spp. Despite several routine and old method for sensitive and specificity detection of Leishmania spp, there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmania spp. For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH₂]₆ ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10^?6 to 10^?21 M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors.     

Experimental study of the function of the excreted/secreted <Emphasis Type="Italic">Leishmania</Emphasis>LmSIR2 protein by heterologous expression in eukaryotic cell line

Background  

In yeast and Caenorhabditis elegans, Silent Information Regulator (SIR2) proteins have been shown to be involved in ageing regulation. In Leishmania, the LmSIR2rp was originally isolated from the excreted/secreted material of the Leishmania parasites. Among the function(s) of this protein in Leishmania biology, we have documented its implication in parasite survival, and in particular in Leishmania amastigotes. In this paper we question the role of the excreted/secreted form of the protein. In particular we wonder if the Leishmania Sir2 homologue is involved in some aspect of its biological function(s), in various components and pathways, which could promote the host cell survival. To test this hypothesis we have mimicked an intracellular release of the protein through constitutive expression in mouse L929 fibrosarcoma cells.     

Leishmania amazonensis META2 protein confers protection against heat shock and oxidative stress

The META cluster of Leishmania amazonensis contains both META1 and META2 genes, which are upregulated in metacyclic promastigotes and encode proteins containing the META domain. Previous studies defined META2 as a 48.0-kDa protein, which is conserved in other Leishmania species and in Trypanosoma brucei. In this work, we demonstrate that META2 protein expression is regulated during the Leishmania life cycle but constitutive in T. brucei. META2 protein is present in the cytoplasm and flagellum of L. amazonensis promastigotes. Leishmania META2-null replacement mutants are more sensitive to oxidative stress and, upon heat shock, assume rounded morphology with shortened flagella. The increased susceptibility of null parasites to heat shock is reversed by extra-chromosomal expression of the META2 gene. Defective Leishmania promastigotes exhibit decreased ability to survive in macrophages. By contrast, META2 expression is decreased by 80% in RNAi-induced T. brucei bloodstream forms with no measurable effect on survival or resistance to heat shock.