The longest 18S ribosomal RNA ever known. Nucleotide sequence and presumed secondary structure of the 18S rRNA of the pea aphid, Acyrthosiphon pisum.

An EMBL4 recombinant phage which encodes one of the full length of the aphid ribosomal DNA has been isolated from the aphid genomic library. Determination of the complete nucleotide sequence of the aphid 18S rRNA gene revealed that it is 2469 bp with a G + C content of 59%. The aphid 18S rRNA gene studied here is the longest and has the highest G + C content among the 18S rRNA genes examined so far. Evidence provided by the S1 nuclease assay suggests that the aphid 18S rRNA gene examined in this study is not a pseudogene containing an insertion sequence. Based on the nucleotide sequence of the 18S rRNA gene, we constructed a presumed secondary-structure model of the aphid 18S rRNA. In the aphid 18S rRNA, the eucaryote-specific E21 and 41 region are supposed to be longer and more complex than the counterparts of other 18S rRNA.     

Nucleotide sequence and presumed secondary structure of the 28S rRNA of pea aphid implication for diversification of insect rRNA

Determination of the entire nucleotide sequence of the aphid 28S ribosomal RNA gene (28S rDNA) revealed that it is 4,147 by in length with a G + C content of 60.3%. Based on the nucleotide sequence, we constructed a presumed secondary-structure model of the aphid 28S rRNA which indicated that the aphid 28S rRNA is characterized by the length and high G + C content of its variable regions. The G + C content of the aphid's variable regions was much higher than that of the entire sequence of the 28S rRNA, which formed a striking contrast to those ofDrosophila with the G + C content much lower than the entire 28S molecule. In this respect, the aphid 28S rRNA somewhat resembled those of vertebrates. This is the third report of a complete large-subunit rRNA sequence from an arthropod, and the first 28S rRNA sequence for a nondipterous insect. Correspondence to: H. Ishikawa     

Sequence and secondary structure of mouse 28S rRNA 5''terminal domain. Organisation of the 5.8S-28S rRNA complex.

We present the sequence of the 5' terminal 585 nucleotides of mouse 28S rRNA as inferred from the DNA sequence of a cloned gene fragment. The comparison of mouse 28S rRNA sequence with its yeast homolog, the only known complete sequence of eukaryotic nucleus-encoded large rRNA (see ref. 1, 2) reveals the strong conservation of two large stretches which are interspersed with completely divergent sequences. These two blocks of homology span the two segments which have been recently proposed to participate directly in the 5.8S-large rRNA complex in yeast (see ref. 1) through base-pairing with both termini of 5.8S rRNA. The validity of the proposed structural model for 5.8S-28S rRNA complex in eukaryotes is strongly supported by comparative analysis of mouse and yeast sequences: despite a number of mutations in 28S and 5.8S rRNA sequences in interacting regions, the secondary structure that can be proposed for mouse complex is perfectly identical with yeast's, with all the 41 base-pairings between the two molecules maintained through 11 pairs of compensatory base changes. The other regions of the mouse 28S rRNA 5'terminal domain, which have extensively diverged in primary sequence, can nevertheless be folded in a secondary structure pattern highly reminiscent of their yeast' homolog. A minor revision is proposed for mouse 5.8S rRNA sequence.     

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).     

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-GCGGAAAAAUAGCUCGAUGCCAGGAUAOH. This 5S rRNA shows high sequence homology with those from chloroplasts of flowering plants and from a blue-green alga, Anacystis nidulans.     

Structure, expression and products of the ribosomal RNA operons of Rhodopseudomonas palustris No. 7

Rhodopseudomonas palustris strains carry one or two ribosomal rRNA operons, and those with duplicated rrn operons grow faster. The two rrn operons in R. palustris No. 7 are virtually identical over a 54,70-bp stretch containing the genes for 16S rRNA, tRNAile, tRNAala, 23S rRNA and 5S rRNA, as well as the intergenic spacers and part of the extragenic spacer. In R. palustris, unlike most bacteria with multiple rrn operons, the putative promoter sequences of the two operons are highly diverged, suggesting possible functional differentiation. By simultaneous primer-extension analysis of both pre-rRNAs, we detected a two-fold higher level of expression from rrnA under photoautotrophic conditions. Alteration of the conditions of growth leads to changes in the relative levels of expression of the two operons. Within the 5,470-bp segment, only two sequence differences are found between the 23S rRNA genes; one is at the center of the 23S rRNA molecule and affects a site of unknown function, and the other is within or immediately adjacent to sequences involved in processing of the 5' 23S rRNA IVS. In vitro processing of 5' IVS-containing 23S rRNA precursors from each operon does not reveal any detectable difference between them. The 5' ends of the mature 16S, 23S, and 5S rRNAs were determined by primer-extension analysis, and the 3' end of 23S rRNA was determined by RNA linker ligation-mediated cDNA cloning. The 5' and 3' ends of the R. palustris 23S rRNA molecule are extensively processed, suggesting that, unlike the situation in the established eubacterial model, these ends cannot basepair.     

Primary and secondary structure of rat 28 S ribosomal RNA.

The primary structure of rat (Rattus norvegicus) 28 S rRNA is determined inferred from the sequence of cloned rDNA fragments. The rat 28 S rRNA contains 4802 nucleotides and has an estimated relative molecular mass (Mr, Na-salt) of 1.66 X 10(6). Several regions of high sequence homology with S. cerevisiae 25 S rRNA are present. These regions can be folded in characteristic base-paired structures homologous to those proposed for Saccharomyces and E. coli. The excess of about 1400 nucleotides in the rat 28 S rRNA (as compared to Saccharomyces 25 S rRNA) is accounted for mainly by the presence of eight distinct G+C-rich segments of different length inserted within the regions of high sequence homology. The G+C content of the four insertions, containing more than 200 nucleotides, is in the range of 78 to 85 percent. All G+C-rich segments appear to form strongly base-paired structures. The two largest G+C-rich segments (about 760 and 560 nucleotides, respectively) are located near the 5'-end and in the middle of the 28 S rRNA molecule. These two segments can be folded into long base-paired structures, corresponding to the ones observed previously by electron microscopy of partly denatured 28 S rRNA molecules.     

The nucleotide sequences of 5S rRNAs from two ribbon worms: Emplectonema gracile contains two 5S rRNA species differing considerably in their sequences.

The nucleotide sequences of 5S rRNAs from two nemerteans (ribbon worms), Lineus geniculatus and Emplectonema gracile have been determined. Emplectonema has two 5S rRNA species that are composed of 119 and 120 nucleotides, respectively. The sequences of these two 5S rRNAs differ at 22 positions. On the other hand, only a single 5S rRNA species was found in Lineus. The sequence similarity percents are 88% (Lineus/Emplectonema longer 5S rRNA), 82% (Emplectonema longer/Emplectonema shorter) and 80% (Lineus/Emplectonema shorter). The comparisons of these sequences with those of other organisms suggest that the phylum Nemertinea is most related to the Mollusca (91%) and the Rotifera (89%), but not to fresh-water planarias (72%).     

Intermolecular hybridization of 5S rRNA with 18S rRNA: identification of a 5'-terminally-located nucleotide sequence in mouse 5S rRNA which base-pairs with two specific complementary sequences in 18S rRNA.

Eukaryotic 5S rRNA hybridizes specifically with 18S rRNA in vitro to form a stable intermolecular RNA:RNA hybrid. We have used 5S rRNA/18S rRNA fragment hybridization studies coupled with ribonuclease digestion and primer extension/chain termination analysis of 5S rRNA:18S rRNA hybrids to more completely map those mouse 5S rRNA and 18S rRNA sequences responsible for duplex formation. Fragment hybridization analysis has defined a 5'-terminal region of 5S rRNA (nucleotides 6-27) which base-pairs with two independent sequences in 18S rRNA designated Regions 1 (nucleotides 1157-1180) and 2 (nucleotides 1324-1339). Ribonuclease digestion of isolated 5S rRNA:18S rRNA hybrids with both single-strand- and double-strand-specific nucleases supports the involvement of this 5'-terminal 5S rRNA sequence in 18S rRNA hybridization. Primer extension/chain termination analysis of isolated 5S rRNA:18S rRNA hybrids confirms the base-pairing of 5S rRNA to the designated Regions 1 and 2 of 18S rRNA. Using these results, 5S rRNA:18S rRNA intermolecular hybrid structures are proposed. Comparative sequence analysis revealed the conservation of these hybrid structures in higher eukaryotes and the same but smaller core hybrid structures in lower eukaryotes and prokaryotes. This suggests that the 5S rRNA:16S/18S rRNA hybrids have been conserved in evolution for ribosome function.     

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.     

Euglena gracilis chloroplast ribosomal RNA transcription units. Nucleotide sequence polymorphism in 5 S rRNA genes and 5 S rRNAs

The three tandemly repeated ribosomal RNA operons from the chloroplast genome of Euglena gracilis Klebs, Pringsheim Strain Z each contain a 5 S rRNA gene distal to the 23 S rRNA gene (Gray, P.W., and Hallick, R.B. (1979) Biochemistry 18, 1820-1825). We have cloned two distinct 5 S rRNA genes, and determined the DNA sequence of the genes, their 5'- and 3'-flanking sequences, and the 3'-end of the adjacent 23 S rRNA genes. The two genes exhibit sequence polymorphism at five bases within the "procaryotic loop" coding region, as well as internal restriction endonuclease site heterogeneity. These restriction endonuclease site polymorphisms are evident in chloroplast DNA, and not just the cloned examples of 5 S genes. Chloroplast 5 S rRNA was isolated, end labeled, and sequenced by partial enzymatic degradation. The same polymorphisms found in 5 S rDNA are present in 5 S rRNA. Therefore, both types of 5 S rRNA genes are transcribed and are present in chloroplast ribosomes.     

The nucleotide sequence of 5.8S rRNA from the posterior silk gland of the silkworm Philosamia cynthia ricini.

The nucleotide sequence of 5.8S rRNA from the Chinese silkworm Philosamia cynthia ricini has been determined by gel sequencing and mobility shift methods. The complete primary structure is (sequence in text). This is one of the largest known 5.8S rRNAs. As compared to Bombyx 5.8S rRNA, it is two nucleotides longer; two nucleotides near the 5'end and two nucleotides near the 3'end are different, and psi 61 of the Bombyx RNA sequence is an unmodified U in Philosamia RNA. The secondary structure of Philosamia 5.8S rRNA may differ from the Bombyx RNA structure by three additional base pairs at the 5'/3' ends.     

The structure of rat 28S ribosomal ribonucleic acid inferred from the sequence of nucleotides in a gene.

The nucleotide sequence of a rat 28S rRNA gene was determined. The 28S rRNA encoded in the gene contains 4718 nucleotides and the molecular weight estimated from the sequence is 1.53 x 10(6). The guanine and cytosine content is 67%. The sequence of rat 28S rRNA diverges appreciably from that of Saccharomyces carlsbergensis 26S rRNA (about 50% identity), but more closely approximates that of Xenopus laevis 28S rRNA (about 75% identity). Rat 28S rRNA is larger than the analogous nucleic acids from yeast (3393 nucleotides) and X, laevis (4110 nucleotides) ribosomes. The additional bases are inserted in specific regions and tend to be rich in guanine and cytosine. 5.8S rRNA can interact with 28S rRNA by extensive hydrogen bonding at two sites near the 5' end of the latter.     

Primary and secondary structures of Tetrahymena and aphid 5.8S rRNAs: structural features of 5.8S rRNA which interacts with the 28S rRNA containing the hidden break

The Tetrahymena 5.8S rRNA is 154 nucleotides long, the shortest so far reported except for the split 5.8S rRNAs of Diptera (m5.8S plus 2S rRNA). In this molecule several nucleotides are deleted in the helix e (GC-rich stem) region. Upon constructing the secondary structure in accordance with "burp-gun" model, the Tetrahymena 5.8S rRNA forms a wide-open "muzzle" of the terminal regions due to both extra nucleotides and several unpaired bases. The aphid 5.8S rRNA consists of 161 nucleotides and can form stable helices in both terminal and helix e regions. As a whole, the secondary structure of Tetrahymena 5.8S rRNA resembles that of Bombyx 5.8S molecule while the aphid 5.8S rRNA shares several structural features with the HeLa 5.8S molecule. Likely, the 5.8S rRNA attached to the 28S rRNA with the hidden break differs in structure from those interacting with the 28S partners without the break. Nucleotide sequences of 5.8S rRNA in insects as well as in protozoans are not so conservative evolutionarily as in vertebrates.     

The nucleotide sequence of 5S rRNA from bovine liver.

We have determined the nucleotide sequence of ribosomal 5S RNA from bovine liver. The comparison of this sequence with those from other eukaryotic sources shows that a common secondary structure model for all eukaryotic 5S rRNAs may exist. Analysis of the evolutionary conserved nucleotides in metazoan 5S rRNAs suggests that the tertiary interactions, proposed earlier for plant 5S rRNA, are also possible.     

Molecular characterization of the 5S ribosomal gene of the <Emphasis Type="Italic">Bradysia hygida</Emphasis>(Diptera:Sciaridae)

The rRNA genes are amongst the most extensively studied eukaryotic genes. They contain both highly conserved and rapidly evolving regions. The aim of this work was to clone and to sequence the Bradysia hygida 5S rDNA gene. A positive clone was sequenced and its 346 bp sequence was analyzed against the GenBank database. Sequence analysis revealed that the B. hygida 5S (Bh5S) rDNA gene is 120 bp long and is 87% identical to the aphid Acyrthosiphon magnoliae 5S rDNA gene. The Bh5S rDNA gene presents two unusual features: a GG pair at the 5' end of the gene sequence and the localization of the polyT signal immediately after the 3' end of the gene. In situ5S hybridization experiments revealed that the Bh5S rDNA gene is localized in the autosomal A chromosome