Identification, purification and partial characterisation of an oligonucleotide receptor in membranes of HepG2 cells

The low and unpredictable uptake and cytosolic transfer of oligonucleotides (ODN) is a major reason for their limited benefit. Improving the ODN potential for therapy and research requires a better understanding of their receptor-mediated endocytosis. We have undertaken to identify a membrane ODN receptor on HepG2 cells by ligand blotting of cell extracts with [¹²⁵I]ODN and by photolabelling of living cells with a [¹²⁵I]ODN-benzophenone conjugate. A major band at 66 kDa was identified by the two methods. Its labelling was saturable and competed for by unlabelled ODN of various sequences and irrespective of the presence of a phosphodiester or phosphorothioate backbone. This protein remained sedimentable after carbonate extraction, indicating strong membrane association. About half of the total cell amount resisted extensive surface proteolysis, suggesting a dual localisation at the plasma membrane and cytoplasmic vesicles. The protein was purified using a biotinylated ODN-benzophenone conjugate by photocrosslinking followed by streptavidin affinity purification. A sequence obtained by Edman degradation showed no homology with known proteins. Using anti-peptide antisera, labelling by western blotting revealed at 66 kDa a band with comparable properties as found by ligand blotting. Thus, a new membrane protein acting as an ODN receptor has been demonstrated.     

Genome-Wide Association Study in BRCA1 Mutation Carriers Identifies Novel Loci Associated with Breast and Ovarian Cancer Risk

BRCA1-associated breast and ovarian cancer risks can be modified by common genetic variants. To identify further cancer risk-modifying loci, we performed a multi-stage GWAS of 11,705 BRCA1 carriers (of whom 5,920 were diagnosed with breast and 1,839 were diagnosed with ovarian cancer), with a further replication in an additional sample of 2,646 BRCA1 carriers. We identified a novel breast cancer risk modifier locus at 1q32 for BRCA1 carriers (rs2290854, P = 2.7×10⁻⁸, HR = 1.14, 95% CI: 1.09–1.20). In addition, we identified two novel ovarian cancer risk modifier loci: 17q21.31 (rs17631303, P = 1.4×10⁻⁸, HR = 1.27, 95% CI: 1.17–1.38) and 4q32.3 (rs4691139, P = 3.4×10⁻⁸, HR = 1.20, 95% CI: 1.17–1.38). The 4q32.3 locus was not associated with ovarian cancer risk in the general population or BRCA2 carriers, suggesting a BRCA1-specific association. The 17q21.31 locus was also associated with ovarian cancer risk in 8,211 BRCA2 carriers (P = 2×10⁻⁴). These loci may lead to an improved understanding of the etiology of breast and ovarian tumors in BRCA1 carriers. Based on the joint distribution of the known BRCA1 breast cancer risk-modifying loci, we estimated that the breast cancer lifetime risks for the 5% of BRCA1 carriers at lowest risk are 28%–50% compared to 81%–100% for the 5% at highest risk. Similarly, based on the known ovarian cancer risk-modifying loci, the 5% of BRCA1 carriers at lowest risk have an estimated lifetime risk of developing ovarian cancer of 28% or lower, whereas the 5% at highest risk will have a risk of 63% or higher. Such differences in risk may have important implications for risk prediction and clinical management for BRCA1 carriers.     

Gold(I)-Triphenylphosphine Complexes with Hypoxanthine-Derived Ligands: In Vitro Evaluations of Anticancer and Anti-Inflammatory Activities

A series of gold(I) complexes involving triphenylphosphine (PPh₃) and one N-donor ligand derived from deprotonated mono- or disubstituted hypoxanthine (HL_n) of the general composition [Au(L_n)(PPh₃)] (1–9) is reported. The complexes were thoroughly characterized, including multinuclear high resolution NMR spectroscopy as well as single crystal X-ray analysis (for complexes 1 and 3). The complexes were screened for their in vitro cytotoxicity against human cancer cell lines MCF7 (breast carcinoma), HOS (osteosarcoma) and THP-1 (monocytic leukaemia), which identified the complexes 4–6 as the most promising representatives, who antiproliferative activity was further tested against A549 (lung adenocarcinoma), G-361 (melanoma), HeLa (cervical cancer), A2780 (ovarian carcinoma), A2780R (ovarian carcinoma resistant to cisplatin), 22Rv1 (prostate cancer) cell lines. Complexes 4–6 showed a significantly higher in vitro anticancer effect against the employed cancer cells, except for G-361, as compared with the commercially used anticancer drug cisplatin, with IC₅₀ ≈ 1–30 µM. Anti-inflammatory activity was evaluated in vitro by the assessment of the ability of the complexes to modulate secretion of the pro-inflammatory cytokines, i.e. tumour necrosis factor-α (TNF-α) and interleukin-1β (IL-1β), in the lipopolysaccharide-activated macrophage-like THP-1 cell model. The results of this study identified the complexes as auspicious anti-inflammatory agents with similar or better activity as compared with the clinically applied gold-based antiarthritic drug Auranofin. In an effort to explore the possible mechanisms responsible for the biological effect, the products of interactions of selected complexes with sulfur-containing biomolecules (L-cysteine and reduced glutathione) were studied by means of the mass-spectrometry study.     

The activation of G protein-coupled receptor 30 (GPR30) inhibits proliferation of estrogen receptor-negative breast cancer cells in vitro and in vivo

There is an urgent clinical need for safe and effective treatment agents and therapy targets for estrogen receptor negative (ER−) breast cancer. G protein-coupled receptor 30 (GPR30), which mediates non-genomic signaling of estrogen to regulate cell growth, is highly expressed in ER− breast cancer cells. We here showed that activation of GPR30 by the receptor-specific agonist G-1 inhibited the growth of ER− breast cancer cells in vitro. Treatment of ER− breast cancer cells with G-1 resulted in G2/M-phase arrest, downregulation of G2-checkpoint regulator cyclin B, and induction of mitochondrial-related apoptosis. The G-1 treatment increased expression of p53 and its phosphorylation levels at Serine 15, promoted its nuclear translocation, and inhibited its ubiquitylation, which mediated the growth arrest effects on cell proliferation. Further, the G-1 induced sustained activation and nuclear translocation of ERK1/2, which was mediated by GPR30/epidermal growth factor receptor (EGFR) signals, also mediated its inhibition effects of G-1. With extensive use of siRNA-knockdown experiments and inhibitors, we found that upregulation of p21 by the cross-talk of GPR30/EGFR and p53 was also involved in G-1-induced cell growth arrest. In vivo experiments showed that G-1 treatment significantly suppressed the growth of SkBr3 xenograft tumors and increased the survival rate, associated with proliferation suppression and upregulation of p53, p21 while downregulation of cyclin B. The discovery of multiple signal pathways mediated the suppression effects of G-1 makes it a promising candidate drug and lays the foundation for future development of GPR30-based therapies for ER− breast cancer treatment.Breast cancer is the most frequently diagnosed cancer and the leading cause of cancer death in females worldwide.¹ Clinically, breast cancer is generally classified into estrogen receptor α positive (ER+) or ER-negative (ER−) subtypes.² ER− tumors are often intrinsically more aggressive and of higher grade than ER+ tumors.³ Since lack of the effectiveness of ER-targeted endocrine treatments (tamoxifen and aromatase inhibitors), patients with ER− breast cancer have significantly worse prognosis and greater 5-year recurrence rate than that of ER+ breast cancer.⁴ Considering that ER− breast cancer constitutes around 30% of all breast cancers,⁵ there is an urgent need to explore new targeted approaches for its treatment.A seven-transmembrane receptor G protein-coupled receptor 30 (GPR30), which is structurally unrelated to nuclear ER, has been recently shown to mediate rapid non-genomic signals of estrogens. The activation of GPR30 can stimulate adenylyl cyclase, transactivate epidermal growth factor receptors (EGFRs), induce mobilization of intracellular calcium (Ca²⁺) stores, and activate mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K) signaling pathways.^6,7 Previous studies revealed that GPR30 can modulate growth of hormonally responsive cancers such as endometrial,⁸ ovarian,⁹ and breast cancer.¹⁰ Therefore, GPR30 likely has an important role in modulating estrogen responsiveness and development and/or progression of ER− breast cancer. Studies revealed that activation of GPR30 can induce the expression of genes and activate pathways that facilitate cell proliferation of endometrial,^11,12 breast,¹³ and ovarian cancer.¹⁴ On the contrary, numerous studies demonstrated that activation of GPR30 by its specific agonist G-1 results in cell-cycle arrest and proliferation inhibition of ERα-positive breast cancer,¹⁰ endothelial cells,¹⁵ prostate,¹⁶ and ovarian⁹ cancer cells. So it requires further investigation on the function of activating GPR30 and the effect of G-1 on the cancer cells.GPR30 has been reported to be expressed in ER− breast cancer cells and suggested to be an excellent new therapeutic target for the treatment of ER− breast cancer.¹⁷ Confusedly, the only two published papers reported contradictory results: Girgert et al.¹⁸ stated that activation of GPR30 promotes growth of ER− breast cancer cells, while Weissenborn et al.¹⁹ revealed that GPR30 functions as a tumor suppressor of ER− breast cancer cells. Therefore, there is an urgent need to illustrate the effects of GPR30 on the proliferation of ER− breast cancer and its downstream signal mechanisms. In the present study, we demonstrated that activation of GPR30 by G-1 inhibits the proliferation of ER− breast cancer cells both in vitro and in vivo.     

Hydration effects of Ni(2+) binding to synthetic polynucleotides with regularly alternating purine-pyrimidine sequences

High precision ultrasonic and densimetric techniques have been used to study the interaction of Ni²⁺ ions with right-handed poly[d(G-C)]·poly[d(G-C)], poly-[d(A-C)]·poly[d(G-T)] and poly[d(A-T)]·poly[d(A-T)] in 5 mM CsCl, 0.2 mM HEPES, pH 7.5 at 20°C. From these measurements the changes in the apparent molar volume and the apparent molar adiabatic compressibility due to the interaction have been obtained. The volume effects of the binding, calculated per mole of Ni²⁺ ions, range from 11.7 to 23.9 cm³ mol^–1 and the compressibility effects range from 19.3 × 10^–4 to 43.1 × 10^–4 cm³ mol^–1 bar^–1. These data are interpreted in terms of dehydration of the polynucleotides and Ni²⁺ ions, i.e. the release of water molecules from the hydration shells of the molecules. An increase in G+C content gives an increase in volume and compressibility effects, indicating a rise in the extent of dehydration. The dehydration effects of Ni²⁺ binding to poly[d(G-C)]·poly[d(G-C)] are approximately twice those of poly[d(A-T)]·poly[d(A-T)]. The volume and compressibility effects of Ni²⁺–EDTA complex formation have also been measured and used as a model system for quantitative estimation. These values revealed that Ni²⁺ ions can coordinate two atomic groups of poly[d(G-C)]·poly[d(G-C)], while in the case of the Ni²⁺–poly[d(A-T)]·poly[d(A-T)] complex volume and compressibility effects correspond to one direct or two indirect (through water) contacts.     

Subcellular trafficking of antisense oligonucleotides and down-regulation of bcl-2 gene expression in human melanoma cells using a fusogenic liposome delivery system

Antisense oligonucleotides (ODN) targeted to specific genes have shown considerable potential as therapeutic agents. The polyanionic charges carried by these molecules, however, present a barrier to efficient cellular uptake and consequently their biological effects on gene regulation are compromised. To overcome this obstacle, a rationally designed carrier system is desirable for antisense delivery. This carrier should assist antisense ODN penetrate the cell membrane and, once inside the cell, then release the ODN and make them available for target binding. We have developed a carrier formulation employing programmable fusogenic vesicles (PFV) as the antisense delivery mediator. This study investigates the intracellular fate of PFV–ODN and bioavailability of antisense ODN to cells. The subcellular distribution of PFV and ODN was examined by monitoring the trafficking of FITC-labeled ODN and rhodamine/phosphatidylethanolamine (Rh-PE)-labeled PFV using confocal microscopy. Fluorescently tagged ODN were first co-localized with the liposomal carrier in the cytoplasm, presumably in endosome/lysosome compartments, shortly after incubation of PFV–ODN with HEK 293 and 518A2 cells. Between 24 and 48 h incubation, however, separation of FITC–ODN from the carrier and subsequent accumulation in the nucleus was observed. In contrast, the Rh-PE label was localized to the cell cytoplasm. The enhanced cellular uptake achieved using the PFV carrier, compared to incubation of free ODN with cells, and subsequent release of ODN from the carrier resulted in significant down-regulation of mRNA expression. Specifically, G3139, an antisense construct targeting the apoptotic antagonist gene bcl-2, was examined in the human melanoma cell line 518A2. Upon exposure to PFV-encapsulated G3139, cells displayed a time-dependent reduction in bcl-2 message levels. The bcl-2 mRNA level was reduced by 50% after 24 h treatment and by ~80% after 72 h when compared to cells treated with free G3139, empty PFV or PFV–G3622, a control ODN sequence. Our results establish that ODN can be released from PFV after intracellular uptake and can then migrate to the nucleus and selectively down-regulate target mRNA.     

Incidence of Cancer in ANCA-Associated Vasculitis: A Meta-Analysis of Observational Studies

ObjectiveThe purpose of this paper is to examine cancer incidence in patients with ANCA-associated vasculitis (AASV) derived from population-based cohort studies by means of meta-analysis.MethodsRelevant electronic databases were searched for studies characterizing the associated risk of overall malignancy in patients with AASV. Standardized incidence rates (SIRs) with 95% confidence intervals (CIs) were used to evaluate the strength of association. We tested for publication bias and heterogeneity and stratified for site-specific cancers.ResultsSix studies (n = 2,578) were eventually identified, of which six provided the SIR for overall malignancy, five reported the SIR for non-melanoma skin cancer (NMSC), four for leukemia, five for bladder cancer, three for lymphoma, three for liver cancer, four for lung cancer, three for kidney cancer, four for prostate cancer, four for colon cancer and four for breast cancer. Overall, the pooled SIR of cancer in AASV patients was 1.74 (95%CI = 1.37–2.21), with moderate heterogeneity among these studies (I² = 65.8%, P = 0.012). In sub-analyses for site-specific cancers, NMSC, leukemia and bladder cancer were more frequently observed in patients with AASV with SIR of 5.18 (95%CI = 3.47–7.73), 4.89 (95%CI = 2.93–8.16) and 3.84 (95%CI = 2.72–5.42) respectively. There was no significant increase in the risk of kidney cancer (SIR = 2.12, 95%CI = 0.66–6.85), prostate cancer (SIR = 1.45, 95%CI = 0.87–2.42), colon cancer (SIR = 1.26, 95%CI = 0.70–2.27), and breast cancer (SIR = 0.95, 95%CI = 0.50–1.79). Among these site-specific cancers, only NMSC showed moderate heterogeneity (I² = 55.8%, P = 0.06). No publication bias was found by using the Begg’s test and Egger''s test.ConclusionsThis meta-analysis shows that AASV patients treatment with cyclophosphamide (CYC) are at increased risk of late-occurring malignancies, particularly of the NMSC, leukemia and bladder cancer. However, there is no significant association between AASV and kidney cancer, prostate cancer, colon cancer and breast cancer. These findings emphasize monitoring and preventative management in AASV patients after cessation of CYC therapy is momentous.     

Risk Prediction for Breast,Endometrial, and Ovarian Cancer in White Women Aged 50 y or Older: Derivation and Validation from Population-Based Cohort Studies

Background

Breast, endometrial, and ovarian cancers share some hormonal and epidemiologic risk factors. While several models predict absolute risk of breast cancer, there are few models for ovarian cancer in the general population, and none for endometrial cancer.

Methods and Findings

Using data on white, non-Hispanic women aged 50+ y from two large population-based cohorts (the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial [PLCO] and the National Institutes of Health–AARP Diet and Health Study [NIH-AARP]), we estimated relative and attributable risks and combined them with age-specific US-population incidence and competing mortality rates. All models included parity. The breast cancer model additionally included estrogen and progestin menopausal hormone therapy (MHT) use, other MHT use, age at first live birth, menopausal status, age at menopause, family history of breast or ovarian cancer, benign breast disease/biopsies, alcohol consumption, and body mass index (BMI); the endometrial model included menopausal status, age at menopause, BMI, smoking, oral contraceptive use, MHT use, and an interaction term between BMI and MHT use; the ovarian model included oral contraceptive use, MHT use, and family history or breast or ovarian cancer. In independent validation data (Nurses'' Health Study cohort) the breast and ovarian cancer models were well calibrated; expected to observed cancer ratios were 1.00 (95% confidence interval [CI]: 0.96–1.04) for breast cancer and 1.08 (95% CI: 0.97–1.19) for ovarian cancer. The number of endometrial cancers was significantly overestimated, expected/observed = 1.20 (95% CI: 1.11–1.29). The areas under the receiver operating characteristic curves (AUCs; discriminatory power) were 0.58 (95% CI: 0.57–0.59), 0.59 (95% CI: 0.56–0.63), and 0.68 (95% CI: 0.66–0.70) for the breast, ovarian, and endometrial models, respectively.

Conclusions

These models predict absolute risks for breast, endometrial, and ovarian cancers from easily obtainable risk factors and may assist in clinical decision-making. Limitations are the modest discriminatory ability of the breast and ovarian models and that these models may not generalize to women of other races. Please see later in the article for the Editors'' Summary     

Anti-IL-20 Monoclonal Antibody Suppresses Prostate Cancer Growth and Bone Osteolysis in Murine Models

Interleukin (IL)-20 is a proinflammatory cytokine in the IL–10 family. IL–20 is associated with tumor promotion in the pathogenesis of oral, bladder, and breast cancer. However, little is known about the role of IL–20 in prostate cancer. We hypothesize that IL–20 promotes the growth of prostate cancer cells. Immunohistochemical staining showed that IL–20 and its receptors were expressed in human PC–3 and LNCaP prostate cancer cell lines and in prostate tumor tissue from 40 patients. In vitro, IL–20 upregulated N-cadherin, STAT3, vimentin, fibronectin, RANKL, cathepsin G, and cathepsin K, and increased the migration and colony formation of prostate cancer cells via activated p38, ERK1/2, AKT, and NF-κB signals in PC–3 cells. We investigated the effects of anti-IL–20 monoclonal antibody 7E on prostate tumor growth in vivo using SCID mouse subcutaneous and intratibial xenograft tumor models. In vivo, 7E reduced tumor growth, suppressed tumor-mediated osteolysis, and protected bone mineral density after intratibial injection of prostate cancer cells. We conclude that IL–20 is involved in the cell migration, colony formation, and tumor-induced osteolysis of prostate cancer. Therefore, IL–20 might be a novel target for treating prostate cancer.     

In vitro and in vivo modulations of benzo[c]phenanthrene-DNA adducts by DNA mismatch repair system

Benzo[c]phenanthrene dihydrodiol epoxide (B[c] PhDE) is well known as an important environmental chemical carcinogen that preferentially modifies DNA in adenine residues. However, the molecular mechanism by which B[c]PhDE induces tumorigenesis is not fully understood. In this report, we demonstrate that DNA mismatch repair (MMR), a genome maintenance system, plays an important role in B[c]PhDE-induced carcinogensis by promoting apoptosis in cells treated with B[c]PhDE. We show that purified human MMR recognition proteins, MutSα and MutSβ, specifically recognized B[c]PhDE-DNA adducts. Cell lines proficient in MMR exhibited several-fold more sensitivity to killing than cell lines defective in either MutSα or MutLα by B[c]PhDE; the nature of this sensitivity was shown to be due to increased apoptosis. Additionally, wild-type mice exposed to B[c]PhDE had intestinal crypt cells that underwent apoptosis significantly more often than intestinal crypt cells found in B[c]PhDE-treated Msh2^–/– or Mlh1^–/– mice. These findings, combined with previous studies, suggest that the MMR system may serve as a general sensor for chemical-caused DNA damage to prevent damaged cells from mutagenesis and carcinogenesis by promoting apoptosis.     

Mg2+-induced triplex formation of an equimolar mixture of poly(rA) and poly(rU)

Magnesium ions strongly influence the structure and biochemical activity of RNA. The interaction of Mg²⁺ with an equimolar mixture of poly(rA) and poly(rU) has been investigated by UV spectroscopy, isothermal titration calorimetry, ultrasound velocimetry and densimetry. Measurements in dilute aqueous solutions at 20°C revealed two differ ent processes: (i) Mg²⁺ binding to unfolded poly(rA)·poly(rU) up to [Mg²⁺]/[phosphate] = 0.25; and (ii) poly(rA)·2poly(rU) triplex formation at [Mg²⁺]/[phosphate] between 0.25 and 0.5. The enthalpies of these two different processes are favorable and similar to each other, ~–1.6 kcal mol^–1 of base pairs. Volume and compressibility effects of the first process are positive, 8 cm³ mol^–1 and 24 × 10^–4 cm³ mol^–1 bar^–1, respectively, and correspond to the release of water molecules from the hydration shells of Mg²⁺ and the polynucleotides. The triplex formation is also accompanied by a positive change in compressibility, 14 × 10^–4 cm³ mol^–1 bar^–1, but only a small change in volume, 1 cm³ mol^–1. A phase diagram has been constructed from the melting experiments of poly(rA)·poly(rU) at a constant K⁺ concentration, 140 mM, and various amounts of Mg²⁺. Three discrete regions were observed, corresponding to single-, double- and triple-stranded complexes. The phase boundary corresponding to the transition between double and triple helical conformations lies near physiological salt concentrations and temperature.     

Peptide and glycopeptide dendrimers and analogous dendrimeric structures and their biomedical applications

The size of information that can be stored in nucleic acids, proteins, and carbohydrates was calculated. The number of hexamers for peptides is 64,000,000 (20⁶) and seems to be impressive in comparison with 4,096 (4⁶) hexanucleotides, but the number of isomers of hexasaccharides is 1.44 × 10¹⁵. Carbohydrates are therefore the best high-density coding system. This language has been named glycocode resp. sugar code. In comparison with peptide dendrimers, the amount of information carried by glycopeptide dendrimers or glycodendrimers is therefore much higher. This is reflected by the variability of structures and functions (activities). This review is about the broad area of peptide and glycopeptide dendrimers. The dendrimeric state and physicochemical properties and general consequences are described, together with a cluster effect. The impact of cluster effect to biological, chemical, and physical properties is discussed. Synthesis of dendrimers by convergent and divergent approaches, “Lego” chemistry, ligation strategies, and click chemistry is given with many examples. Purification and characterization of dendrimers by chromatographic methods, electromigration methods, and mass spectrometry are briefly mentioned. Different types of dendrimers with cyclic core, i.e. RAFTs, TASPs and analogous cyclic structures, carbopeptides, carboproteins, octopus glycosides, inositol-based dendrimers, cyclodextrins, calix[4]arenes, resorcarenes, cavitands, and porphyrins are given. Dendrimers can be used for creation of libraries, catalysts, and solubilizing agents. Biocompatibility and toxicity of dendrimers is discussed, as well as their applications in nanoscience, nanotechnology, drug delivery, and gene delivery. Carbohydrate interactions of glycopeptide dendrimers (bacteria, viruses, and cancer) are described. Examples of dendrimers as anti-prion agents are given. Dendrimers represent a fast developing area which partly overlaps with nanoparticles and nanotechnologies.     

Trends in Cancer Incidence in Maputo,Mozambique, 1991–2008

Background

Very limited information is available regarding the incidence of cancer in sub-Saharan Africa. We analyzed changes in cancer patterns from 1991 to 2008 in Maputo (Mozambique).

Methods

We calculated the rates of incidence of different cancer sites by sex in the 5-year age-group of the population of Maputo city as well as age-standardized rates (ASRs) and average annual percentage changes (AAPC).

Results

Over the 18-year study period a total of 12,674 cases of cancer (56.9% females) were registered with an overall increase in the risk of cancer in both sexes. In males, the most common cancers were those of the prostate, Kaposi sarcoma (KS) and the liver. Prostate cancer showed the most dramatic increase over the whole study period (AAPC +11.3%; 95% CI: 9.7–13.0), with an ASR of 61.7 per 10⁵ in 2003–2008. In females, the most frequent cancers were of the uterine cervix, the breast and KS, with the former increasing along the whole study period (AAPC + 4.7%; 95% CI: 3.4–6) with an ASR of 62.0 per 10⁵ in 2003–2008 as well as breast cancer (AAPC +6.5%; 95%CI: 4.3–8.7).

Conclusions

Overall, the risk of cancer rose in both sexes during the study period, particularly among cancers associated with westernization of lifestyles (prostate, breast), combined with increasingly rising incidences or limited changes in cancers associated with infection and poverty (uterine cervix, liver). Moreover, the burden of AIDS-associated cancers has shown a marked increase.     

Body size and composition and risk of site-specific cancers in the UK Biobank and large international consortia: A mendelian randomisation study

BackgroundEvidence for the impact of body size and composition on cancer risk is limited. This mendelian randomisation (MR) study investigates evidence supporting causal relationships of body mass index (BMI), fat mass index (FMI), fat-free mass index (FFMI), and height with cancer risk.Methods and findingsSingle nucleotide polymorphisms (SNPs) were used as instrumental variables for BMI (312 SNPs), FMI (577 SNPs), FFMI (577 SNPs), and height (293 SNPs). Associations of the genetic variants with 22 site-specific cancers and overall cancer were estimated in 367,561 individuals from the UK Biobank (UKBB) and with lung, breast, ovarian, uterine, and prostate cancer in large international consortia. In the UKBB, genetically predicted BMI was positively associated with overall cancer (odds ratio [OR] per 1 kg/m² increase 1.01, 95% confidence interval [CI] 1.00–1.02; p = 0.043); several digestive system cancers: stomach (OR 1.13, 95% CI 1.06–1.21; p < 0.001), esophagus (OR 1.10, 95% CI 1.03, 1.17; p = 0.003), liver (OR 1.13, 95% CI 1.03–1.25; p = 0.012), and pancreas (OR 1.06, 95% CI 1.01–1.12; p = 0.016); and lung cancer (OR 1.08, 95% CI 1.04–1.12; p < 0.001). For sex-specific cancers, genetically predicted elevated BMI was associated with an increased risk of uterine cancer (OR 1.10, 95% CI 1.05–1.15; p < 0.001) and with a lower risk of prostate cancer (OR 0.97, 95% CI 0.94–0.99; p = 0.009). When dividing cancers into digestive system versus non-digestive system, genetically predicted BMI was positively associated with digestive system cancers (OR 1.04, 95% CI 1.02–1.06; p < 0.001) but not with non-digestive system cancers (OR 1.01, 95% CI 0.99–1.02; p = 0.369). Genetically predicted FMI was positively associated with liver, pancreatic, and lung cancer and inversely associated with melanoma and prostate cancer. Genetically predicted FFMI was positively associated with non-Hodgkin lymphoma and melanoma. Genetically predicted height was associated with increased risk of overall cancer (OR per 1 standard deviation increase 1.09; 95% CI 1.05–1.12; p < 0.001) and multiple site-specific cancers. Similar results were observed in analyses using the weighted median and MR–Egger methods. Results based on consortium data confirmed the positive associations between BMI and lung and uterine cancer risk as well as the inverse association between BMI and prostate cancer, and, additionally, showed an inverse association between genetically predicted BMI and breast cancer. The main limitations are the assumption that genetic associations with cancer outcomes are mediated via the proposed risk factors and that estimates for some lower frequency cancer types are subject to low precision.ConclusionsOur results show that the evidence for BMI as a causal risk factor for cancer is mixed. We find that BMI has a consistent causal role in increasing risk of digestive system cancers and a role for sex-specific cancers with inconsistent directions of effect. In contrast, increased height appears to have a consistent risk-increasing effect on overall and site-specific cancers.

Mathew Vithayathil and colleagues study associations of body mass index and other measures with incidence of specific cancers.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

Activated α2-Macroglobulin Binding to Human Prostate Cancer Cells Triggers Insulin-like Responses

Ligation of cell surface GRP78 by activated α₂-macroglobulin (α₂M*) promotes cell proliferation and suppresses apoptosis. α₂M*-treated human prostate cancer cells exhibit a 2–3-fold increase in glucose uptake and lactate secretion, an effect similar to insulin treatment. In both α₂M* and insulin-treated cells, the mRNA levels of SREBP1-c, SREBP2, fatty-acid synthase, acetyl-CoA carboxylase, ATP citrate lyase, and Glut-1 were significantly increased together with their protein levels, except for SREBP2. Pretreatment of cells with α₂M* antagonist antibody directed against the carboxyl-terminal domain of GRP78 blocks these α₂M*-mediated effects, and silencing GRP78 expression by RNAi inhibits up-regulation of ATP citrate lyase and fatty-acid synthase. α₂M* induces a 2–3-fold increase in lipogenesis as determined by 6-[¹⁴C]glucose or 1-[¹⁴C]acetate incorporation into free cholesterol, cholesterol esters, triglycerides, free fatty acids, and phosphatidylcholine, which is blocked by inhibitors of fatty-acid synthase, PI 3-kinase, mTORC, or an antibody against the carboxyl-terminal domain of GRP78. We also assessed the incorporation of [¹⁴CH₃]choline into phosphatidylcholine and observed similar effects. Lipogenesis is significantly affected by pretreatment of prostate cancer cells with fatostatin A, which blocks sterol regulatory element-binding protein proteolytic cleavage and activation. This study demonstrates that α₂M* functions as a growth factor, leading to proliferation of prostate cancer cells by promoting insulin-like responses. An antibody against the carboxyl-terminal domain of GRP78 may have important applications in prostate cancer therapy.     

Combined Treatment with Exendin-4 and Metformin Attenuates Prostate Cancer Growth

Introduction

Recently, the pleiotropic benefits of incretin-based therapy have been reported. We have previously reported that Exendin–4, a glucagon-like peptide–1 (GLP–1) receptor agonist, attenuates prostate cancer growth. Metformin is known for its anti-cancer effect. Here, we examined the anti-cancer effect of Exendin–4 and metformin using a prostate cancer model.

Methods

Prostate cancer cells were treated with Exendin–4 and/or metformin. Cell proliferation was quantified by growth curves and 5-bromo–2′-deoxyuridine (BrdU) assay. TUNEL assay and AMP-activated protein kinase (AMPK) phosphorylation were examined in LNCaP cells. For in vivo experiments, LNCaP cells were transplanted subcutaneously into the flank region of athymic mice, which were then treated with Exendin–4 and/or metformin. TUNEL assay and immunohistochemistry were performed on tumors.

Results

Exendin–4 and metformin additively decreased the growth curve, but not the migration, of prostate cancer cells. The BrdU assay revealed that both Exendin–4 and metformin significantly decreased prostate cancer cell proliferation. Furthermore, metformin, but not Exendin–4, activated AMPK and induced apoptosis in LNCaP cells. The anti-proliferative effect of metformin was abolished by inhibition or knock down of AMPK. In vivo, Exendin–4 and metformin significantly decreased tumor size, and further significant tumor size reduction was observed after combined treatment. Immunohistochemistry on tumors revealed that the P504S and Ki67 expression decreased by Exendin–4 and/or metformin, and that metformin increased phospho-AMPK expression and the apoptotic cell number.

Conclusion

These data suggest that Exendin–4 and metformin attenuated prostate cancer growth by inhibiting proliferation, and that metformin inhibited proliferation by inducing apoptosis. Combined treatment with Exendin–4 and metformin attenuated prostate cancer growth more than separate treatments.     

Hexamminecobalt(III)-induced condensation of calf thymus DNA: circular dichroism and hydration measurements

The interaction of hexamminecobalt(III), Co(NH₃)₆³⁺, with 160 and 3000–8000 bp length calf thymus DNA has been investigated by circular dichroism, acoustic and densimetric techniques. The acoustic titration curves of 160 bp DNA revealed three stages of interaction: (i) Co(NH₃)₆³⁺ binding up to the molar ratio [Co(NH₃)₆³⁺]/[P] = 0.25, prior to DNA condensation; (ii) a condensation process between [Co(NH₃)₆³⁺]/[P] = 0.25 and 0.30; and (iii) precipitation after [Co(NH₃)₆³⁺]/[P] = 0.3. In the case of 3000–8000 bp DNA only two processes were observed: (i) binding up to [Co(NH₃)₆³⁺]/[P] = 0.3; and (ii) precipitation after this point. In agreement with earlier observations, long DNA aggregates without changes in its B-form circular dichroism spectrum, while short DNA demonstrates a positive B→Ψ transition after [Co(NH₃)₆³⁺]/[P] = 0.25. From ultrasonic and densimetric measurements the effects of Co(NH₃)₆³⁺ binding on volume and compressibility have been obtained. The binding of Co(NH₃)₆³⁺ to both short and long DNA is characterized by similar changes in volume and compressibility calculated per mole Co(NH₃)₆³⁺: ΔV = 9 cm³ mol^–1 and Δκ = 33 × 10^–4 cm³ mol^–1 bar^–1. The positive sign of the parameters indicates dehydration, i.e. water release from Co(NH₃)₆³⁺ and the atomic groups of DNA. This extent of water displacement would be consistent with the formation of two direct, hydrogen bonded contacts between the cation and the phosphates of DNA.