共查询到20条相似文献,搜索用时 0 毫秒
1.
2.
3.
Urmila Saha Asma Yasmeen Khan Sutanwi Bhuiya Suman Das Gaetano Fiorillo Paolo Lombardi 《Journal of biomolecular structure & dynamics》2019,37(6):1375-1389
Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M?1, and that of BER was (0.98 ± 0.03) × 105 M?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands. 相似文献
4.
5.
Calliste Reiling Sarah E. Johnson Hui-Ting Lee 《Journal of biomolecular structure & dynamics》2013,31(1)
Antisense, antigene, and siRNA strategies are currently used to control the expression of genes. To this end, our laboratory is mimicking the targeting of mRNA by reacting DNA stem-loop motifs with their partially complementary strands. Specifically, we used a combination of isothermal titration (ITC), differential scanning calorimetry (DSC), and temperature-dependent UV spectroscopy to investigate: (1) the unfolding of a pseudoknot and a complex containing joined triplex-duplex motifs (shown below); and (2) the reaction of these compact structures with single strands that are complementary to the bases in the loops and to a portion of their stem. 相似文献
6.
Fomenkov A Too PH Chan SH Vaisvila R Cantin BA Mazzola L Tam V Xu SY 《Analytical biochemistry》2008,381(1):135-141
Cytosine modification of the dinucleotide CpG in the DNA regulatory region is an important epigenetic marker during early embryo development, cellular differentiation, and cancer progression. In clinical settings, such as anti-cancer drug treatment, it is desirable to develop research tools to characterize DNA sequences affected by epigenetic perturbations. Here, we describe the construction and characterization of two fusion endonucleases consisting of the 5mCpG-binding domain of human MeCP2 (hMeCP2) and the cleavage domains of BmrI and FokI restriction endonucleases (REases). The chimeric (CH) endonucleases cleave M.HpaII (C5mCGG)—and M.SssI (5mCpG)-modified DNA. Unmodified DNA and M.MspI-modified DNA (5mCCGG) are poor substrates for the CH-endonucleases. Sequencing cleavage products of modified λ DNA indicates that cleavage takes place outside the 5mCpG recognition sequence, predominantly 4-17 bp upstream of the modified base (/N4-175mCpG, where / indicates the cleavage site). Such 5mCpG-specific endonucleases will be useful to study CpG island modification of the regulatory regions of tumor suppressor genes, and for the construction of cell-specific and tumor-specific modified CpG island databases. 相似文献
7.
Vera Teixeira Natacha Arede Rui Gardner Joaquín Rodríguez-León Ana T Tavares 《BMC developmental biology》2011,11(1):1-7
Background
Hemangioblasts are known as the common precursors for primitive hematopoietic and endothelial lineages. Their existence has been supported mainly by the observation that both cell types develop in close proximity and by in vitro differentiation and genetic studies. However, more compelling evidence will arise from tracking their cell fates using a lineage-specific marker.Results
We report the identification of a hemangioblast-specific enhancer (Hb) located in the cis-regulatory region of chick Cerberus gene (cCer) that is able to direct the expression of enhanced green fluorescent protein (eGFP) to the precursors of yolk sac blood and endothelial cells in electroporated chick embryos. Moreover, we present the Hb-eGFP reporter as a powerful live imaging tool for visualizing hemangioblast cell fate and blood island morphogenesis.Conclusions
We hereby introduce the Hb enhancer as a valuable resource for genetically targeting the hemangioblast population as well as for studying the dynamics of vascular and blood cell development. 相似文献8.
Oxazole-containing macrocycles, which include the natural product telomestatin, represent a promising class of anticancer agents that target G-quadruplex DNA. Two synthetic hexaoxazole-containing macrocyclic compounds (HXDV and HXLV-AC) have been characterized with regard to their cytotoxic activities versus human cancer cells, as well as the mode, thermodynamics, and specificity with which they bind to the intramolecular (3+1) G-quadruplex structural motif formed in the presence of K(+) ions by human telomeric DNA. Both compounds exhibit cytotoxic activities versus human lymphoblast (RPMI 8402) and oral carcinoma (KB3-1) cells, with associated IC(50) values ranging from 0.4 to 0.9muM. The compounds bind solely to the quadruplex nucleic acid form, but not to the duplex or triplex form. Binding to the quadruplex is associated with a stoichiometry of two ligand molecules per DNA molecule, with one ligand molecule binding to each end of the host quadruplex via a nonintercalative "terminal capping" mode of interaction. For both compounds, quadruplex binding is primarily entropy driven, while also being associated with a negative change in heat capacity. These thermodynamic properties reflect contributions from favorable ligand-induced alterations in the loop configurational entropies of the quadruplex, but not from changes in net hydration. The stoichiometry and mode of binding revealed by our studies have profound implications with regard to the number of ligand molecules that can potentially bind the 3-overhang region of human telomeric DNA. 相似文献
9.
Molecules that interact with DNA in a sequence-specific manner are attractive tools for manipulating gene sequence and expression. For example, triplex-forming oligonucleotides (TFOs), which bind to oligopyrimidine.oligopurine sequences via Hoogsteen hydrogen bonds, have been used to inhibit gene expression at the DNA level as well as to induce targeted mutagenesis in model systems. Recent advances in using oligonucleotides and analogs to target DNA in a sequence-specific manner will be discussed. In particular, chemical modification of TFOs has been used to improve binding to chromosomal target sequences in living cells. Various oligonucleotide analogs have also been found to expand the range of sequences amenable to manipulation, including so-called "Zorro" locked nucleic acids (LNAs) and pseudo-complementary peptide nucleic acids (pcPNAs). Finally, we will examine the potential of TFOs for directing targeted gene sequence modification and propose that synthetic nucleases, based on conjugation of sequence-specific DNA ligands to DNA damaging molecules, are a promising alternative to protein-based endonucleases for targeted gene sequence modification. 相似文献
10.
Cell-penetrating peptides are widely used to deliver cargo molecules into cells. Here we describe the synthesis, characterization, DNA binding, and cellular uptake studies of a series of metal-peptide conjugates containing oligoarginine as a cell-penetrating peptide. d-Octaarginine units are appended onto a rhodium intercalator containing the sterically expansive chrysenequinone diimine (chrysi) ligand to form Rh(chrysi)(phen)(bpy)(3+)-tethered oligoarginine conjugates, where the peptide is attached to the ancillary bpy ligand; some conjugates also include a fluorescein or thiazole orange tag. These complexes bind and with photoactivation selectively cleave DNA neighboring single-base mismatches. The presence of the oligoarginines is found to increase the nonspecific binding affinity of the complexes for both matched and mismatched DNA, but for these conjugates, photocleavage remains selective for the mismatched site, as assayed using both gel electrophoresis and mass spectrometry experiments. Significantly, the rhodium complex does not interfere with the delivery properties of the cell-penetrating peptide. Confocal microscopy experiments show rapid nuclear localization of the metal-peptide conjugates containing the tethered fluorescein. Mass spectrometry experiments confirm the association of the rhodium with the HeLa cells. These results provide a strategy for targeting mismatch-selective metal complexes inside cell nuclei. 相似文献
11.
Woynarowski JM 《Biochimica et biophysica acta》2002,1587(2-3):300-308
Cellular DNA is not a uniform target for DNA-reactive drugs. At the nucleotide level, drugs recognize and bind short motifs of a few base pairs. The location of drug adducts at the genomic level depends on how these short motifs are distributed in larger domains. This aspect, referred to as region specificity, may be critical for the biological outcome of drug action. Recent studies demonstrated that certain minor groove binding (MGB) drugs, such as bizelesin, produce region-specific lesions in cellular DNA. Bizelesin binds mainly T(A/T)(4)A sites, which are on average scarce, but occasionally cluster in distinct minisatellite regions (200-1000 bp of approximately 85-100% AT), herein referred to as AT islands. Bizelesin-targeted AT islands are likely to function as strong matrix attachment regions (MARs), domains that organize DNA loops on the nuclear matrix. Distortion of MAR-like AT islands may be a basis for the observed inhibition of new replicon initiation and the extreme lethality of bizelesin adducts (<10 adducts/cell for cell growth inhibition). Hence, long AT-islands represent a novel class of critical targets for anticancer drugs. The AT island paradigm illustrates the potential of the concept of regional targeting as an essential component of the rational design of new sequence-specific DNA-reactive drugs. 相似文献
12.
Correct repair of damaged DNA is critical for genomic integrity. Deficiencies in DNA repair are linked with human cancer. Here we report a novel mechanism by which a virus manipulates DNA damage responses. Infection with murine polyomavirus sensitizes cells to DNA damage by UV and etoposide. Polyomavirus large T antigen (LT) alone is sufficient to sensitize cells 100 fold to UV and other kinds of DNA damage. This results in activated stress responses and apoptosis. Genetic analysis shows that LT sensitizes via the binding of its origin-binding domain (OBD) to the single-stranded DNA binding protein replication protein A (RPA). Overexpression of RPA protects cells expressing OBD from damage, and knockdown of RPA mimics the LT phenotype. LT prevents recruitment of RPA to nuclear foci after DNA damage. This leads to failure to recruit repair proteins such as Rad51 or Rad9, explaining why LT prevents repair of double strand DNA breaks by homologous recombination. A targeted intervention directed at RPA based on this viral mechanism could be useful in circumventing the resistance of cancer cells to therapy. 相似文献
13.
The critical role of phopshatidylinositol-3-kinase (PtdIns3K) signaling in the regulation of a wide range of cellular functions, including cell survival and proliferation, autophagy, metabolism and cell migration, is well recognized. Activation of PtdIns3K leads to the generation of phosphatidylinositol-3,4,5-triphosphate (PtdIns(3,4,5)P 3). PtdIns(3,4,5)P 3 activates a complex signaling network controlling these diverse cellular functions through binding to Pleckstrin Homology (PH) domains of the effector proteins. We have recently described a new structural class of nonphosphoinositide small molecule inhibitors targeting binding of PtdIns(3,4,5) P 3 to PH domain targets. Using an in vitro PtdIns(3,4,5)P 3-PH domain binding assay, we identified two distinct PtdIns(3,4,5)P 3 antagonists, PIT-1 and PIT-2. Further cellular analysis revealed that both PITs inhibit PtdIns(3,4,5) P 3-dependent signaling mediated by Akt kinase, leading to the induction of apoptosis, metabolic stress and autophagy. An improved PIT-1 analog, DM-PIT-1, displays significant anticancer activity in the mouse syngeneic 4T1 breast cancer model in vivo. Discovery of PITs as well as other PtdIns(3,4,5)P 3 antagonists recently described by other laboratories suggest the possibility of targeting a key universal PtdIns(3,4,5)P 3/PH domain binding step in the PtdIns3K pathway using heterologous small molecule modulators. 相似文献
14.
《Autophagy》2013,9(6):650-651
The critical role of phopshatidylinositol-3-kinase (PtdIns3K) signaling in the regulation of a wide range of cellular functions, including cell survival and proliferation, autophagy, metabolism and cell migration, is well recognized. Activation of PtdIns3K leads to the generation of phosphatidylinositol-3,4,5-triphosphate (PtdIns(3,4,5)P3). PtdIns(3,4,5)P3 activates a complex signaling network controlling these diverse cellular functions through binding to Pleckstrin Homology (PH) domains of the effector proteins. We have recently described a new structural class of nonphosphoinositide small molecule inhibitors targeting binding of PtdIns(3,4,5) P3 to PH domain targets. Using an in vitro PtdIns(3,4,5)P3-PH domain binding assay, we identified two distinct PtdIns(3,4,5)P3 antagonists, PIT-1 and PIT-2. Further cellular analysis revealed that both PITs inhibit PtdIns(3,4,5) P3-dependent signaling mediated by Akt kinase, leading to the induction of apoptosis, metabolic stress and autophagy. An improved PIT-1 analog, DM-PIT-1, displays significant anticancer activity in the mouse syngeneic 4T1 breast cancer model in vivo. Discovery of PITs as well as other PtdIns(3,4,5)P3 antagonists recently described by other laboratories suggest the possibility of targeting a key universal PtdIns(3,4,5)P3/PH domain binding step in the PtdIns3K pathway using heterologous small molecule modulators. 相似文献
15.
Targeting a novel Plasmodium falciparum purine recycling pathway with specific immucillins 总被引:1,自引:0,他引:1
Ting LM Shi W Lewandowicz A Singh V Mwakingwe A Birck MR Ringia EA Bench G Madrid DC Tyler PC Evans GB Furneaux RH Schramm VL Kim K 《The Journal of biological chemistry》2005,280(10):9547-9554
Plasmodium falciparum is unable to synthesize purine bases and relies upon purine salvage and purine recycling to meet its purine needs. We report that purines formed as products of polyamine synthesis are recycled in a novel pathway in which 5'-methylthioinosine is generated by adenosine deaminase. The action of P. falciparum purine nucleoside phosphorylase is a convergent step of purine salvage, converting both 5'-methylthioinosine and inosine to hypoxanthine. We used accelerator mass spectrometry to verify that 5'-methylthioinosine is an active nucleic acid precursor in P. falciparum. Prior studies have shown that inhibitors of purine salvage enzymes kill malaria, but potent malaria-specific inhibitors of these enzymes have not been described previously. 5'-Methylthio-immucillin-H, a transition state analogue inhibitor that is selective for malarial relative to human purine nucleoside phosphorylase, kills P. falciparum in culture. Immucillins are currently in clinical trials for other indications and may also have application as anti-malarials. 相似文献
16.
Anna Maria Colangelo Giovanni Cirillo Maria Luisa Lavitrano Lilia Alberghina Michele Papa 《Biotechnology advances》2012
Neuroglial cells are fundamental for control of brain homeostasis and synaptic plasticity. Decades of pathological and physiological studies have focused on neurons in neurodegenerative disorders, but it is becoming increasingly evident that glial cells play an irreplaceable part in brain homeostasis and synaptic plasticity. Animal models of brain injury and neurodegenerative diseases have largely contributed to current understanding of astrocyte-specific mechanisms participating in brain function and neurodegeneration. Specifically, gliotransmission (presence of glial neurotransmitters, and their receptors and active transporters), trophic support (release, maturation and degradation of neurotrophins) and metabolism (production of lactate and GSH components) are relevant aspects of astrocyte function in neuronal metabolism, synaptic plasticity and neuroprotection. Morpho-functional changes of astrocytes and microglial cells after traumatic or toxic insults to the central nervous system (namely, reactive gliosis) disrupt the complex neuro-glial networks underlying homeostasis and connectivity within brain circuits. Thus, neurodegenerative diseases might be primarily regarded as gliodegenerative processes, in which profound alterations of glial activation have a clear impact on progression and outcomes of neuropathological processes. This review provides an overview of current knowledge of astrocyte functions in the brain and how targeting glial-specific pathways might ultimately impact the development of therapies for clinical management of neurodegenerative disorders. 相似文献
17.
18.
《中国科学:生命科学英文版》2017,(1)
正Renal cell carcinoma(RCC),accounting for 4%of all cancers,is the second most common cancer in urology.The most common form of RCC is clear cell RCC(ccRCC),with a ratio over 70%.Early-phase kidney diseases usually show rare symptoms in clinic;unfortunately,most patients are diagnosed with kidney cancer at the end stage,at which point the cancer is both resistant to chemotherapy and metastatic,thus leading to high mortality.Understanding cancer biology enables manipulation of disease targets by using small-molecule modulators,which eventually drive the development of 相似文献
19.
Human tumors frequently have defects in the maintenance of genomic integrity, which involve a loss of the appropriate response to DNA damage. These pathways of genome integrity include key proteins involved in cell cycle checkpoints, histone modifications, and DNA repair. In this review, we discuss opportunities for therapeutic intervention by exploiting these defects, with an emphasis on those processes which are primarily associated with the repair of double-strand breaks. As these defects are specific to tumor cells, the development of new anti-cancer agents targeting these pathways may have an enhanced therapeutic window, with limited normal tissue toxicity. 相似文献
20.
Tobin LA Robert C Nagaria P Chumsri S Twaddell W Ioffe OB Greco GE Brodie AH Tomkinson AE Rassool FV 《Molecular cancer research : MCR》2012,10(1):96-107
Although hereditary breast cancers have defects in the DNA damage response that result in genomic instability, DNA repair abnormalities in sporadic breast cancers have not been extensively characterized. Recently, we showed that, relative to nontumorigenic breast epithelial MCF10A cells, estrogen receptor-positive (ER+) MCF7 breast cancer cells and progesterone receptor-positive (PR+) MCF7 breast cancer cells have reduced steady-state levels of DNA ligase IV, a component of the major DNA-protein kinase (PK)-dependent nonhomologous end joining (NHEJ) pathway, whereas the steady-state level of DNA ligase IIIα, a component of the highly error-prone alternative NHEJ (ALT NHEJ) pathway, is increased. Here, we show that tamoxifen- and aromatase-resistant derivatives of MCF7 cells and ER(-)/PR(-) cells have even higher steady-state levels of DNA ligase IIIα and increased levels of PARP1, another ALT NHEJ component. This results in increased dependence upon microhomology-mediated ALT NHEJ to repair DNA double-strand breaks (DSB) and the accumulation of chromosomal deletions. Notably, therapy-resistant derivatives of MCF7 cells and ER(-)/PR(-) cells exhibited significantly increased sensitivity to a combination of PARP and DNA ligase III inhibitors that increased the number of DSBs. Biopsies from ER(-)/PR(-) tumors had elevated levels of ALT NHEJ and reduced levels of DNA-PK-dependent NHEJ factors. Thus, our results show that ALT NHEJ is a novel therapeutic target in breast cancers that are resistant to frontline therapies and suggest that changes in NHEJ protein levels may serve as biomarkers to identify tumors that are candidates for this therapeutic approach. 相似文献