Statistical analysis of double NOE transfer pathways in proteins as measured in 3D NOE-NOE spectroscopy

Summary The recent development of three-dimensional NMR spectroscopy has alleviated the problem of overlap of resonances. However, also for the 3D experiments resonance assignment strategies have usually relied upon knowledge about spin systems, combined with information about short (sequential) distances. For doubly (¹⁵N/¹³C)-labelled molecules, a novel assignment strategy has been developed. In this paper we address the possibilities of an assignment strategy for proteins, based solely upon the use of NOE data. For this, the 3D NOE-NOE experiment seems most suitable. Therefore, we have made a theoretical evaluation of double NOE transfer pathways in 28 protein crystal structures. We identify 95 connectivities which are most likely to be observed as cross peaks in a 3D NOE-NOE spectrum of a protein. Given the occurrence of one of these 95 connectivities, we evaluate the chances of occurrence for the others. Analysis of these conditional probabilities allowed the construction of five patterns of related, highly correlated cross peaks which resemble the conventional idea of spin systems to some extent and may provide a basis for assignment and secondary structure analysis from 3D NOE-NOE data alone.Dedicated to the memory of Professor V.F. Bystrov     

Evaluation of errors of interproton distances and correlation time determined from NMR cross-relaxation rates

Summary We have analyzed a combined use of the two-dimensional nuclear Overhauser effect in the laboratory frame (NOESY) and in the rotating frame (ROESY) to determine interproton distances and correlation time in medium-sized rigid molecules (Davis, 1987). This method can be applied in the intermediate motional regime, 0.2 < _oc, < 5, (_c, correlation time, (_o resonance frequency). Error limits depend on the motional regime and are smallest near _oc=1.14.The method was tested on six geminal proton pairs in the bicyclic octapeptide (S-deoxo--[R]-OH-Ile³ amaninamide, Mw =870) for which at 297 K in DMSO, a correlation time of 1.0 ns, with a standard deviation of 0.12 ns, and an interproton distance of 1.87 Å, with standard deviation of 0.04 Å, are obtained.     

A new method to determine DNA sugar conformation from the joint use of 2D and 3D NMR data

The use of sugar restraints has been proven essential for assessing DNAstructures through molecular modeling studies. We present a new methodcombining 2D (COSY and NOESY) and 3D (NOESY-NOESY) experiments, whereconstraints on either the phase angles or the difference between phase anglesof two residues are obtained from comparison of 2D NOE H1-H4intensities and 3D NOE intensities containing the H1-H4transfer. All experiments lead to restraints that match, proving the validityof the method.     

Pseudo-3D NMR spectroscopy: Application to oligo- and polysaccharides

Summary Several pseudo-3D NMR experiments are proposed for removal of overlaps in 1D ¹H NMR spectra. A selective pulse and a chemical-shift-selective filter are used for double selection of the magnetization during the course of the pulse sequence. Different polarization transfer mechanisms are combined into pseudo-3D COSY-RELAY, COSY-TOCSY, COSY-NOESY, COSY-ROESY, RELAY-NOESY, RELAY-ROESY, RELAY-RELAY and RELAY-TOCSY experiments. The techniques are illustrated on oligo- and polysaccharide samples.     

Gradient-enhanced 3D NOESY-HMQC spectroscopy

Summary A gradient-enhanced 3D NOESY-HMQC experiment is presented and applied to¹⁵N-labeled Mnt repressor (1–76) in¹H₂O. Both coherence selection and¹H₂O suppression are achieved using gradients. A singlescan experiment can be recorded for each time increment, which greatly reduces recording time with respect to conventional methods using phase cycling. This can be of use for kinetic studies and for relatively unstable molecules.     

Identification of spin diffusion pathways in proteins by isotope-assisted NMR cross- relaxation network editing

A new isotope-assisted cross-relaxation editing experiment, [1H-13C]DINE-NOESY[1H-15N]HSQC (DINE = Double INEPT Edited), is proposed. It is based on the selectiveinversion of CH/CH3 or CH2 protons in the middle of the mixing time. The experiment sortsout the spin diffusion paths according to the principal mediators, either the CH/CH3 or theCH2 protons. This is useful in the structure refinement process, as it enables proper alignmentof the aliphatic protons in the vicinity of NH protons.     

Protein hydration studied with homonuclear 3D1H NMR experiments

Summary Homonuclear 3D¹H NOESY-TOCSY and 3D¹H ROESY-TOCSY experiments were used to resolve and assign nuclear Overhauser effect (NOE) cross peaks between the water signal and individual polypeptide proton resonances in H₂O solutions of the basic pancreatic trypsin inhibitor. Combined with a novel, robust water-suppression technique, positive and negative intermolecular NOEs were detected at 4°C. The observation of positive NOEs between water protons and protein protons enables more precise estimates of the very short residence times of the water molecules in the hydration sites on the protein surface.     

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s^–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence. Correspondence to: A. N. Lane     

Investigation of exchange couplings in [Fe3S4]+ clusters by electron spin-lattice relaxation

3 S₄]⁺, S=1/2, composed of three, antiferromagnetically coupled high-spin ferric ions) by continuous wave (CW) and pulsed EPR techniques: Azotobacter vinelandii ferredoxin I, Desulfovibrio gigas ferredoxin II, and the 3Fe forms of Pyrococcus furiosus ferredoxin and aconitase. The 35 GHz (Q-band) CW EPR signals are simulated to yield experimental g tensors, which either had not been reported, or had been reported only at X-band microwave frequency. Pulsed X- and Q-band EPR techniques are used to determine electron spin-lattice (T ₁, longitudinal) relaxation times at several positions on the samples' EPR envelope over the temperature range 2–4.2 K. The T ₁ values vary sharply across the EPR envelope, a reflection of the fact that the envelope results from a distribution in cluster properties, as seen earlier as a distribution in g ₃ values and in ⁵⁷ Fe hyperfine interactions, as detected by electron nuclear double resonance spectroscopy. The temperature dependence of 1/T ₁ is analyzed in terms of the Orbach mechanism, with relaxation dominated by resonant two-phonon transitions to a doublet excited state at ∼20 cm⁻¹ above the doublet ground state for all four of these 3Fe proteins. The experimental EPR data are combined with previously reported ⁵⁷Fe hyperfine data to determine electronic spin exchange-coupling within the clusters, following the model of Kent et al. Their model defines the coupling parameters as follows: J ₁₃=J, J ₁₂=J(1+ε′), J ₂₃=J(1+ε), where J _ij is the isotropic exchange coupling between ferric ions i and j, and ε and ε′ are measures of coupling inequivalence. We have extended their theory to include the effects of ε′≠0 and thus derived an exact expression for the energy of the doublet excited state for any ε, ε′. This excited state energy corresponds roughly to ε J and is in the range 5–10 cm⁻¹ for each of these four 3Fe proteins. This magnitude of the product ε J, determined by our time-domain relaxation studies in the temperature range 2–4 K, is the same as that obtained from three other distinct types of study: CW EPR studies of spin relaxation in the range 5.5–50 K, NMR studies in the range 293–303 K, and static susceptibility measurements in the range 1.8–200 K. We suggest that an apparent disagreement as to the individual values of J and ε be resolved in favor of the values obtained by susceptibility and NMR (J≳200 cm⁻¹ and ε≳0.02 cm⁻¹ ), as opposed to a smaller J and larger ε as suggested in CW EPR studies. However, we note that this resolution casts doubt on the accepted theoretical model for describing the distribution in magnetic properties of 3Fe clusters. Received: 23 December 1999 / Accepted: 8 March 2000     

Molecular interactions in bacterial cellulose composites studied by 1D FT-IR and dynamic 2D FT-IR spectroscopy

Specific strain-induced orientation and interactions in three Acetobacter cellulose composites: cellulose (C), cellulose/pectin (CP) and cellulose/xyloglucan (CXG) were characterized by FT-IR and dynamic 2D FT-IR spectroscopies. On the molecular level, the reorientation of the cellulose fibrils occurred in the direction of the applied mechanical strain. The cellulose-network reorientation depends on the composition of the matrix, including the water content, which lubricates the motion of macromolecules in the network. At the submolecular level, dynamic 2D FT-IR data suggested that there was no interaction between cellulose and pectin in CP and that they responded independently to a small amplitude strain, while in CXG, cellulose and xyloglucan were uniformly strained along the sample length.     

Three-Dimensional (3D) cell culture monitoring: Opportunities and challenges for impedance spectroscopy

Three-dimensional (3D) cell culture has developed rapidly over the past 5–10 years with the goal of better replicating human physiology and tissue complexity in the laboratory. Quantifying cellular responses is fundamental in understanding how cells and tissues respond during their growth cycle and in response to external stimuli. There is a need to develop and validate tools that can give insight into cell number, viability, and distribution in real-time, nondestructively and without the use of stains or other labelling processes. Impedance spectroscopy can address all of these challenges and is currently used both commercially and in academic laboratories to measure cellular processes in 2D cell culture systems. However, its use in 3D cultures is not straight forward due to the complexity of the electrical circuit model of 3D tissues. In addition, there are challenges in the design and integration of electrodes within 3D cell culture systems. Researchers have used a range of strategies to implement impedance spectroscopy in 3D systems. This review examines electrode design, integration, and outcomes of a range of impedance spectroscopy studies and multiparametric systems relevant to 3D cell cultures. While these systems provide whole culture data, impedance tomography approaches have shown how this technique can be used to achieve spatial resolution. This review demonstrates how impedance spectroscopy and tomography can be used to provide real-time sensing in 3D cell cultures, but challenges remain in integrating electrodes without affecting cell culture functionality. If these challenges can be addressed and more realistic electrical models for 3D tissues developed, the implementation of impedance-based systems will be able to provide real-time, quantitative tracking of 3D cell culture systems.     

Automated classification of RNA 3D motifs and the RNA 3D Motif Atlas

The analysis of atomic-resolution RNA three-dimensional (3D) structures reveals that many internal and hairpin loops are modular, recurrent, and structured by conserved non-Watson–Crick base pairs. Structurally similar loops define RNA 3D motifs that are conserved in homologous RNA molecules, but can also occur at nonhomologous sites in diverse RNAs, and which often vary in sequence. To further our understanding of RNA motif structure and sequence variability and to provide a useful resource for structure modeling and prediction, we present a new method for automated classification of internal and hairpin loop RNA 3D motifs and a new online database called the RNA 3D Motif Atlas. To classify the motif instances, a representative set of internal and hairpin loops is automatically extracted from a nonredundant list of RNA-containing PDB files. Their structures are compared geometrically, all-against-all, using the FR3D program suite. The loops are clustered into motif groups, taking into account geometric similarity and structural annotations and making allowance for a variable number of bulged bases. The automated procedure that we have implemented identifies all hairpin and internal loop motifs previously described in the literature. All motif instances and motif groups are assigned unique and stable identifiers and are made available in the RNA 3D Motif Atlas (http://rna.bgsu.edu/motifs), which is automatically updated every four weeks. The RNA 3D Motif Atlas provides an interactive user interface for exploring motif diversity and tools for programmatic data access.     

3D culture increases pluripotent gene expression in mesenchymal stem cells through relaxation of cytoskeleton tension

Three‐dimensional (3D) culture has been shown to improve pluripotent gene expression in mesenchymal stem cells (MSCs), but the underlining mechanisms were poorly understood. Here, we found that the relaxation of cytoskeleton tension of MSCs in 3D culture was critically associated with the expressional up‐regulation of Nanog. Cultured in spheroids, MSCs showed decreased integrin‐based cell–matrix adhesion but increased cadherin‐based cell–cell interaction. Different from that in 2D culture, where MSCs exhibited branched and multiple‐directed F‐actin stress bundles at the cell edge and strengthened stress fibres transversing the cell body, MSCs cultured in spheroids showed compact cell body, relaxed cytoskeleton tension with very thin cortical actin filament outlining the cell, and increased expression of Nanog along with reduced levels of Suv39h1 (H3K9 methyltransferase) and H3K9me3. Notably, pharmaceutical inhibition of actin polymerization with cytochalasin D or silencing Suv39h1 expression with siRNA in 2D‐cultured MSCs elevated the expression of Nanog via H3K9 demethylation. Thus, our data suggest that 3D culture increases the expression of Nanog through the relaxation of actin cytoskeleton, which mediates reduced Suv39h1 and H3K9me3 levels.     

Determination of 3D spinal kinematics without defining a local vertebral coordinate system

In this paper a method is presented to calculate Euler's angles of rotation of a body segment during locomotion without a priori defining the location of the center of rotation, and without defining a local vertebral coordinate system. The method was applied to in vivo spinal kinematics. In this method, the orientation of each segment is identified by a set of three markers. The orientation of the axes of rotation is calculated based on the average position of the markers during one stride cycle. Some restrictions and assumptions should be made. The approach is viable only when the average orientation of the anatomical axes of rotation of each spinal segment during a stride cycle coincides with the three axes of the laboratory coordinate system. Furthermore, the rotations should be symmetrical with respect to both sides of the plane of symmetry of the spinal segment, and the subject should move parallel to one axis of the laboratory coordinate system. Since in experimental conditions these assumptions will only be met approximately, errors will be introduced in the calculated angles of rotation. The magnitude of the introduced errors was investigated in a computer simulation experiment. Since the maximal errors did not exceed 0.7° in a range of misalignments up to 10° between the two coordinate systems, the approach proved to be a valid method for the estimation of spinal kinematics.     

3D Modelling of Biological Systems for Biomimetics

1　IntroductionBasedonthereviewofthepreviousworkof 3Dgeometricalmodellingtechniquesandsystemsdevelopedforindustrial,medicalandanimationapplications,thispaperdiscussestheproblemsassociatedwiththeexist ingtechniquesandsystems ,especiallywhenappliedto3Dmodellingof plants ,insectsandanimalsforbiomimeticsresearchanddevelopment .Then ,paperproposessomeareasofresearchinterestsin 3Dmod ellingofplants ,insectsandanimalsforBiomimetics .Toavoidtherepeating ,inthispaper ,biologicalobjectswillbeusedtorep…     

BAFF induces spleen CD4(+) T cell proliferation by down-regulating phosphorylation of FOXO3A and activates cyclin D2 and D3 expression

The TNF ligand family member "B cell-activating factor belonging to the TNF family" (BAFF, also called BLyS, TALL-1, zTNF-4, and THANK) is an important survival factor for B and T cells. In this study, we show that BAFF is able to induce CD4(+) spleen T cell proliferation when co-stimulated with anti-CD3. Expression of phosphorylated FOXO3A was notably down-regulated and cyclins D2 and D3 were up-regulated and higher in the CD4(+) T cells when treated with BAFF and anti-CD3, as assessed by Western blotting. Furthermore, after FOXO3A was knocked down, expression of cyclin D1 was unchanged, compared with control group levels, but the expression of cyclins D2 and D3 increased, compared with the control group. In conclusion, our results suggest that BAFF induced CD4(+) spleen T cell proliferation by down-regulating the phosphorylation of FOXO3A and then activating cyclin D2 and D3 expression, leading to CD4(+) T cell proliferation.     

Determination of solid-state fungal growth by Fourier transform infrared-photoacoustic spectroscopy

Abstract Photoacoustic spectroscopy (PAS) does not require optically transparent samples and is, therefore, well suited for analysis of solid-state samples. Fourier transform infrared (FTIR)-PAS of solid materials containing protein exhibited strong absorption in the amide I and amide II regions of the IR spectrum. Growth of a filamentous fungus, Phanerochaete chrysosporium , on cellulose discs was quantitatively determined by monitoring amide I absorption with FTIR-PAS.     

Structural analysis of some soluble elastins by means of FT‐IR and 2D IR correlation spectroscopy

Fourier transform infrared (FT‐IR) spectroscopy combined with 2D correlation spectroscopy has been used to offer some information about stability and structure of some soluble elastins. Temperature has been chosen as the perturbation to monitor the infrared behavior of various soluble elastins, namely, α‐elastin p, α‐elastin, and k‐elastin. In the 3800–2700 cm^?1 region, the H‐containing groups were analyzed. The bonded hydroxyls are found to decrease prior to the NH‐related hydrogen bonds and also to the conformational reorganization of hydrocarbon chains. The transition temperatures were evaluated and they were found to agree with those obtained from DSC data. The FTIR spectra and their 2nd derivatives denote that α‐ elastins exhibited amide‐I, ‐II and ‐III bands at 1656, 1539 and 1236 cm^?1, respectively, while in k‐elastin these bands were found at 1652 cm^?1 for amide I, 1540 cm^?1 for amide II and 1248 cm^?1 for amide III. The macroscopic IR finger‐print method, which combines: general IR spectra, secondary derivative spectra, and 2D‐IR correlation spectra, is useful to discriminate different elastins. Thus using the differences of the position and intensity of the bands from “fingerprint region” of studied elastins, which include the peaks assigned to C?O, C? C groups from α‐helix, β‐turn, and the peaks assigned to the amide groups, it is possible to identify and discriminate elastins from each others. Furthermore, the pattern of 2D‐IR correlation spectra under thermal perturbation, allow their direct identification and discrimination. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 1072–1084, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

3D representation and analysis of enthesis morphology

This comparison of methods for assessing the development of muscle insertion sites, or entheses, suggests that three‐dimensional (3D) quantification of enthesis morphology can produce a picture of habitual muscle use patterns in a past population that is similar to one produced by ordinal scores for describing enthesis morphology. Upper limb skeletal elements (humeri, radii, and ulnae) from a sample of 24 middle‐aged adult males from the Pottery Mound site in New Mexico were analyzed for both fibrous and fibrocartilaginous enthesis development with three different methods: ordinal scores, two‐dimensional (2D) area measurements, and 3D surface areas. The methods were compared using tests for asymmetry and correlations among variables in each quantitative data set. 2D representations of enthesis area did not agree as closely as ordinal scores and 3D surface areas did regarding which entheses were significantly asymmetrical. There was significant correlation between 3D and 2D data, but correlation coefficients were not consistently high. Intraobserver error was also assessed for the 3D method. Cronbach's alpha values fell between 0.68 and 0.73, and error rates for all entheses fell between 10% and 15%. Marginally acceptable intraobserver error and the analytic versatility of 3D images encourage further investigation of using 3D scanning technology for quantifying enthesis development. Am J Phys Anthropol 152:417–424, 2013. © 2013 Wiley Periodicals, Inc.