Detection of single-nucleotide polymorphisms using gold nanoparticles and single-strand-specific nucleases

The current study reports an assay approach that can detect single-nucleotide polymorphisms (SNPs) and identify the position of the point mutation through a single-strand-specific nuclease reaction and a gold nanoparticle assembly. The assay can be implemented via three steps: a single-strand-specific nuclease reaction that allows the enzyme to truncate the mutant DNA; a purification step that uses capture probe-gold nanoparticles and centrifugation; and a hybridization reaction that induces detector probe-gold nanoparticles, capture probe-gold nanoparticles, and the target DNA to form large DNA-linked three-dimensional aggregates of gold nanoparticles. At high temperature (63 degrees C in the current case), the purple color of the perfect match solution would not change to red, whereas a mismatched solution becomes red as the assembled gold nanoparticles separate. Using melting analysis, the position of the point mutation could be identified. This assay provides a convenient colorimetric detection that enables point mutation identification without the need for expensive mass spectrometry. To our knowledge, this is the first report concerning SNP detection based on a single-strand-specific nuclease reaction and a gold nanoparticle assembly.     

PCR amplification on magnetic nanoparticles: application for high-throughput single nucleotide polymorphism genotyping

A novel approach for the genotyping of single nucleotide polymorphisms (SNPs) based on solidphase PCR on magnetic nanoparticles (MNPs) is described. PCR products were amplified directly on MNPs. The genotypes of a given SNP were differentiated by hybridization with a pair of allele-specific probes labeled with dual-color fluorescence (Cy3, Cy5). The results were analyzed by scanning the microarray printed with the denatured fluorescent probes on an unmodified glass slide. Electrophoresis analysis indicated that PCR could proceed successfully when MNPs-bound primers were used. Furthermore, nine different samples were genotyped and their fluorescent signals were quantified. Genotyping results showed that three genotypes for the locus were very easily discriminated. The fluorescent ratios (match probe:mismatch probe signal) of homozygous samples were over 9.3, whereas heterozygous samples had ratios near 1.0. Without any purification and concentration of PCR products, this new MNP-PCR based genotyping assay potentially provides a rapid, labor-saving method for genotyping of a large number of individuals.     

Resonance Rayleigh-scattering method for the determination of proteins with gold nanoparticle probe

Gold nanoparticles with a 12-nm diameter were used as probes for the determination of proteins by resonance Rayleigh-scattering techniques. In weak acidic solution, large amounts of citrate anions will self-assemble on the surface of positively charged gold nanoparticles to form supermolecular compounds with negative charges. Below the isoelectric point, proteins with positive charges such as human serum albumin (HSA), bovine serum albumin (BSA), and ovalbumin (Ova) can bind gold nanoparticles to form larger volume products (the diameter of the binding product of gold nanoparticles with HSA is 23 nm.) through electrostatic force, hydrogen bonds, and hydrophobic effects, which can result in a red shift of the maximum absorption wavelength, the remarkable enhancement of the resonance Rayleigh-scattering intensity (RRS), and the appearance of the RRS spectra. At the same time, the second-order-scattering (SOS) and frequency-doubling-scattering (FDS) intensities are also enhanced. The binding products of gold nanoparticles with different proteins have similar spectral characteristics and the maximum wavelengths are located near 303 nm for RRS, 540 nm for SOS, and 390 for FDS, respectively. The scattering enhancement (DeltaI) is directly proportional to the concentration of proteins. Among them, the RRS method has the highest sensitivity and the detection limits are 0.38 ng/ml for HSA, 0.45 ng/ml for BSA, and 0.56 ng/ml for Ova, separately. The methods have good selectivity. A new RRS method for the determination of trace proteins using a gold nanoparticle probe has been developed. Because gold nanoparticle probes do not need to be modified chemically in advance, the method is very simple and fast.     

A lectin-based gold nanoparticle assay for probing glycosylation of glycoproteins

We report a glycoanalysis method in which lectins are used to probe the glycans of therapeutic glycoproteins that are adsorbed on gold nanoparticles. A model mannose-presenting glycoprotein, ribonuclease B (RNase B), and the therapeutic monoclonal antibody (mAb) rituximab, were found to adsorb spontaneously and non-specifically to bare gold nanoparticles such that glycans were accessible for lectin binding. Addition of a multivalent binding lectin, such as concanavalin A (Con A), to a solution of the modified gold nanoparticles resulted in cross-linking of the nanoparticles. This phenomenon was evidenced within 1 min by a change in the hydrodynamic diameter, D(H), measured by dynamic light scattering (DLS) and a shift and increase in absorbance of the plasmon resonance band of the gold nanoparticles. By combining the sugar-binding specificity and the cross-linking capabilities of lectins, the non-specific adsorption of glycoproteins to gold surfaces, and the unique optical reporting properties of gold nanoparticles, a glycosylation pattern of rituximab could be generated. This assay provides advantages over currently used glycoanalysis methods in terms of short analysis time, simplicity of the conjugation method, convenience of simple spectroscopic detection, and feasibility of providing glycan characterization of the protein drug product by using a variety of binding lectins.     

A simple method for enhancing hybridization efficiency in chromosome and array comparative genomic hybridization

Abstract

The accuracy of comparative genomic hybridization (CGH) analysis is affected by hybridization efficiency. We describe here a simple method for enhancing hybridization efficiency. The hybridization procedure is essentially the same as that of conventional methods. Hybridization solution containing denatured DNA probe mixture was applied to a metaphase chromosome slide or DNA chip slide and covered with a coverslip. In the new method, however, the slide was inverted by turning the coverslip downward prior to hybridization. We termed this method the inverted slide method. To estimate the efficiency of the new method, metaphase chromosome slides and DNA chip slides were treated by both the conventional and inverted slide methods and incubated in a moist chamber at 37°C for 12, 24, 48, and 72 h. Hybridization signals were approximately 1.5 to 2 times brighter on the slides using the inverted slide method than those using the conventional method after 48 and 72 h of incubation. Furthermore, topographical differences in fluorescence intensity were smaller in slides using the inverted-slide method than in those prepared by the conventional method. The inverted slide method is methodologically very simple and improves the resolution of CGH.     

A novel procedure for genotyping of single nucleotide polymorphisms in trisomy with genomic DNA and the invader assay

Individuals with trisomy 21 display complex phenotypes with differing degrees of severity. Numerous reliable methods have been established to diagnose the initial trisomy in these patients, but the identification and characterization of the genetic basis of the phenotypic variation in individuals with trisomy remains challenging. To date, methods that can accurately determine genotypes in trisomic DNA samples are expensive, require specialized equipment and complicated analyses. Here we report proof-of-concept results for an Invader® assay-based genotyping procedure that can determine SNP genotypes in trisomic genomic DNA samples in a simple and cost-effective manner. The procedure requires only two experimental steps: a real-time measurement of the fluorescent Invader® signal and analysis with a specifically designed clustering algorithm. The approach was tested using genomic DNA samples from 23 individuals with trisomy 21, and results were compared to genotypes previously determined with pyrosequencing. Additional assays for 15 SNPs were tested in a set of 21 DNA samples to assess assay performance. Our method successfully identified the correct SNP genotypes for the trisomic genomic DNA samples tested, and thus provides an alternative to determine SNP genotypes in trisomic DNA samples for subsequent association studies in patients with Down syndrome and other trisomies.     

A new multiplex SNP genotyping assay for detecting hybridization and introgression between the M and S molecular forms of Anopheles gambiae

The M and S forms of Anopheles gambiae have been the subject of intense study, but are morphologically indistinguishable and can only be identified using molecular techniques. PCR‐based assays to distinguish the two forms have been designed and applied widely. However, the application of these assays towards identifying hybrids between the two forms, and backcrossed hybrids in particular, has been problematic as the currently available diagnostic assays are based on single locus and/or are located within a multicopy gene. Here, we present an alternative genotyping method for detecting hybridization and introgression between M and S molecular forms based on a multilocus panel of single‐nucleotide polymorphisms (SNPs) fixed between the M and S forms. The panel of SNPs employed is located in so‐called islands of divergence leading us to describe this method as the ‘Divergence Island SNP’ (DIS) assay. We show this multilocus SNP genotyping approach can robustly and accurately detect F1 hybrids as well as backcrossed individuals.     

A new antibody immobilization strategy based on electro-deposition of gold nanoparticles and Prussian Blue for label-free amperometric immunosensor

A novel and sensitive immunosensor has been developed by electro-depositing gold nanoparticles on to a Prussian Blue-modified glassy carbon electrode for determination of hepatitis B surface antigen (HBsAg). After the developed immunosensor was incubated with different concentrations of HBsAg samples at 37°C for 15 min, the current response decreased with an increasing HBsAg concentration in the sample solution. The decreased percentage of the current was proportional to HBsAg concentration ranging from 2 to 300 ng HbsAg ml⁻¹ with a detection limit of 0.42 ng HbsAg ml⁻¹ (S/N = 3). Analytical results of 50 specimens using the developed immunosensor showed satisfactory agreement with those using ELISA, indicating the method to be a promising alternative for detecting HBsAg in clinical diagnosis.     

Prenatal diagnosis of ring chromosome 2 with lissencephaly and 2p25.3 and 2q37.3 microdeletions detected using array comparative genomic hybridization

We present rapid aneuploidy diagnosis of ring chromosome 2 with 2p25.3 and 2q37.3 microdeletions by aCGH using uncultured amniocytes in a fetus with IUGR, microcephaly, lissencephaly and ambiguous external genitalia. Our case adds lissencephaly to the list of CNS abnormalities in ring chromosome 2 with 2p25.3 and 2q37.3 microdeletions. We discuss the consequence of haploinsufficiency of HDAC4, KIF1A, PASK, HDLBP, FRAP2 and D2HGDH on 2q37.3, and haploinsufficiency of MYT1L, SNTG2 and TPO on 2p25.3 in this case.     

Cytotoxic and apoptotic properties of a novel nano-toxin formulation based on biologically synthesized silver nanoparticle loaded with recombinant truncated pseudomonas exotoxin A

Bacterial toxins have received a great deal of attention in the development of antitumor agents. Currently, these protein toxins were used in the immunotoxins as a cancer therapy strategy. Despite the successful use of immunotoxins, immunotherapy strategies are still expensive and limited to hematologic malignancies. In the current study, for the first time, a nano-toxin comprised of truncated pseudomonas exotoxin (PE38) loaded silver nanoparticles (AgNPs) were prepared and their cytotoxicity effect was investigated on human breast cancer cells. The PE38 protein was cloned into pET28a and expressed in Escherichia coli, BL21 (DE3), and purified using metal affinity chromatography and was analyzed by 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. AgNPs were biologically prepared using cell-free supernatant of E. Coli K12 strain. Nanoparticle formation was characterized by energy dispersive spectroscopy, transmission electron microscopy, and dynamic light scattering. The PE38 protein was loaded on AgNPs and prepared the PE38-AgNPs nano-toxin. Additionally, in vitro release indicated a partial slow release of toxin in about 100 hr. The nano-toxin exhibited dose-dependent cytotoxicity on MCF-7 cells. Also, real-time polymerase chain reaction results demonstrated the ability of nano-toxin to upregulate Bax/Bcl-2 ratio and caspase-3, -8, -9, and P53 apoptotic genes in the MCF-7 tumor cells. Apoptosis induction was determined by Annexin-V/propidium flow cytometry and caspases activity assay after treatment of cancer cells with the nano-toxin. In general, in the current study, the nano-toxin exhibit an inhibitory effect on the viability of breast cancer cells through apoptosis, which suggests that AgNPs could be used as a delivery system for targeting of toxins to cancer cells.     

A novel high-resolution 2D silicon array detector for small field dosimetry with FFF photon beams

PurposeFlattening filter free (FFF) beams are increasingly being considered for stereotactic radiotherapy (SRT). For the first time, the performance of a monolithic silicon array detector under 6 and 10 MV FFF beams was evaluated. The dosimeter, named “Octa” and designed by the Centre for Medical Radiation Physics (CMRP), was tested also under flattened beams for comparison.MethodsOutput factors (OFs), percentage depth-dose (PDD), dose profiles (DPs) and dose per pulse (DPP) dependence were investigated. Results were benchmarked against commercially available detectors for small field dosimetry.ResultsThe dosimeter was shown to be a ‘correction-free’ silicon array detector for OFs and PDD measurements for all the beam qualities investigated. Measured OFs were accurate within 3% and PDD values within 2% compared against the benchmarks. Cross-plane, in-plane and diagonal DPs were measured simultaneously with high spatial resolution (0.3 mm) and real time read-out. A DPP dependence (24% at 0.021 mGy/pulse relative to 0.278 mGy/pulse) was found and could be easily corrected for in the case of machine specific quality assurance applications.ConclusionsResults were consistent with those for monolithic silicon array detectors designed by the CMRP and previously characterized under flattened beams only, supporting the robustness of this technology for relative dosimetry for a wide range of beam qualities and dose per pulses. In contrast to its predecessors, the design of the Octa offers an exhaustive high-resolution 2D dose map characterization, making it a unique real-time radiation detector for small field dosimetry for field sizes up to 3 cm side.     

A novel electrochemical biosensor for selective determination of mercury ions based on DNA hybridization

An electrochemical biosensor was developed for Hg²⁺ determination based on DNA hybridization. In the presence of Hg²⁺, the target and probe DNAs with thymine–thymine (T–T) mismatches could hybridize by forming T–Hg²⁺–T complex. This induced DNA hybridization led to the decrease in reduction peak currents of ethyl green (EG) as electroactive label, which could be used for determination of Hg²⁺. The difference in the value of the peak currents of EG before and after DNA hybridization (ΔI) was linear with the concentration of Hg²⁺ in the range of 9.0 × 10⁻¹¹–1.0 × 10⁻⁹ M. The detection limit was 3.08 × 10⁻¹¹ M.     

A methacrylate embedding procedure developed for immunolocalization on plant tissues is also compatible with in situ hybridization.

A recently described method that uses methacrylate embedding of aldehyde fixed plant tissues allows the immunolabelling of a range of antigens (Baskin et al. 1992). We have tested whether the same embedding procedure is also compatible with in situ hybridization. For this purpose we have used 2- 5 μm sections of methacrylate embedded plantlets of Arabidopsis thaliana. After removal of the resin the sections were prepared for in situ hybridization following standard procedures. Three different digoxygenin (dig)-labelled probes were used, recognizing RNAs coding for the chlorophyll a/b binding protein cab-140, the β-tubulin tub5 and meri a member of the meri-5 family. Each of the probes shows the labelling pattern expected from the literature. Moreover, the method allows a good structural preservation of very fragile tissues, in contrast to paraffin embedding. We conclude that methacrylate embedding, allowing both immunolabelling and in situ hybridization with high resolution and structural preservation, offers a high potential for the functional analysis of genes and proteins in plant development. This is especially true for Arabidopsis thaliana, a widely used model species where it seems to be the method of choice.     

A new synthesis method for complex electric field patterning using a multichannel dense array system with applications in low-intensity noninvasive neuromodulation

Multichannel coil array systems offer precise spatiotemporal electronic steering and patterning of electric and magnetic fields without the physical movement of coils or magnets. This capability could potentially benefit a wide range of biomagnetic applications such as low-intensity noninvasive neuromodulation or magnetic drug delivery. In this regard, the objective of this work is to develop a unique synthesis method, that enabled by a multichannel dense array system, generates complex current pattern distributions not previously reported in the literature. Simulations and experimental results verify that highly curved or irregular (e.g., zig–zag) patterns at singular and multiple sites can be efficiently formed using this method. The synthesis method is composed of three primary components; a pixel cell (basic unit of pattern formation), a template array (“virtual array”: code that disseminates the coil current weights to the “physical” dense array), and a hexagonal coordinate system. Low-intensity or low-field magnetic stimulation is identified as a potential application that could benefit from this work in the future and as such is used as an example to frame the research.     

Binding of Leishmania spp with gold nanoparticles supported polyethylene glycol and its application for the sensitive detection of infectious photogenes in human plasma samples: A novel biosensor

The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmania spp. Despite several routine and old method for sensitive and specificity detection of Leishmania spp, there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmania spp. For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH₂]₆ ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10^?6 to 10^?21 M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors.     

A novel electroconductive interface based on Fe3O4 magnetic nanoparticle and cysteamine functionalized AuNPs: Preparation and application as signal amplification element to minoring of antigen‐antibody immunocomplex and biosensing of prostate cancer

In this study, a novel electroconductive interface was prepared based on Fe₃O₄ magnetic nanoparticle and cysteamine functionalized gold nanoparticle. The engineered interface was used as signal amplification substrate in the electrochemical analysis of antibody‐antigen binding. For this purpose, biotinilated‐anti‐prostate‐specific antigen (PSA) antibody was bioconjugated with iron oxide magnetic nanoparticles (Fe₃O₄) and drop‐casted on the surface of glassy carbon electrode (GCE). Also, secondary antibody (HRP‐Ab2) encapsulated on gold nanoparticles caped by cysteamine was immobilized on the surface of GCE modified electrode. A transmission electron microscopy images shows that a sandwich immunoreaction was done and binding of Ab1 and Ab2 performed successfully. Various parameters of immunoassay, including the loading of magnetic nanoparticles, the amount of gold nanoparticle conjugate, and the immunoreaction time, were optimized. The detection limit of 0.001 μg. L^?1 of PSA was obtained under optimum experimental conditions. It is found that such magneto‐bioassay could be readily used for simultaneous parallel detection of multiple proteins by using multiple inorganic metal nanoparticle tracers and are expected to open new opportunities for early stage diagnosis of cancer in near future.     

Magnetic separation of CD14+ cells using antibody binding with protein A expressed on bacterial magnetic particles for generating dendritic cells

Herein the potential of a highly efficient cell separation system using bacterial magnetic particles expressing protein A (protein A-BacMPs) was demonstrated. Protein A was expressed on BacMPs using the transmembrane proteins Mms13 and MagA as anchor molecules. The evaluations of the numbers of bound antibody molecules and binding capabilities of the protein A-BacMPs using Mms13 indicated that the antibodies were efficiently introduced into protein A-BacMPs using Mms13 in comparison to MagA. In addition, the recovery ratio of the target cells on the magnetic cell separation system was enhanced by using protein A-BacMPs with Mms13. Using positive selection against peripheral blood mononuclear cells, the CD14(+) cells were separated at a purity of more than 99% by protein A-BacMPs using Mms13. Furthermore, in the evaluation of the influence of protein A-BacMPs on the separated cells, the CD14(+) cells separated using protein A-BacMPs and were successfully differentiated into dendritic cells.