Exploration of a potential difluoromethyl-nucleoside substrate with the fluorinase enzyme

The investigation of a difluoromethyl-bearing nucleoside with the fluorinase enzyme is described. 5′,5′-Difluoro-5′-deoxyadenosine 7 (F₂DA) was synthesised from adenosine, and found to bind to the fluorinase enzyme by isothermal titration calorimetry with similar affinity compared to 5′-fluoro-5′-deoxyadenosine 2 (FDA), the natural product of the enzymatic reaction. F₂DA 7 was found, however, not to undergo the enzyme catalysed reaction with l-selenomethionine, unlike FDA 2, which undergoes reaction with l-selenomethionine to generate Se-adenosylselenomethionine. A co-crystal structure of the fluorinase and F₂DA 7 and tartrate was solved to 1.8 Å, and revealed that the difluoromethyl group bridges interactions known to be essential for activation of the single fluorine in FDA 2. An unusual hydrogen bonding interaction between the hydrogen of the difluoromethyl group and one of the hydroxyl oxygens of the tartrate ligand was also observed. The bridging interactions, coupled with the inherently stronger C–F bond in the difluoromethyl group, offers an explanation for why no reaction is observed.     

2,4-Diamino-8-quinazoline carboxamides as novel,potent inhibitors of the NAD hydrolyzing enzyme CD38: Exploration of the 2-position structure-activity relationships

Starting from 4-amino-8-quinoline carboxamide lead 1a and scaffold hopping to the chemically more tractable quinazoline, a systematic exploration of the 2-substituents of the quinazoline ring, utilizing structure activity relationships and conformational constraint, resulted in the identification of 39 novel CD38 inhibitors. Eight of these analogs were 10–100-fold more potent human CD38 inhibitors, including the single digit nanomolar inhibitor 1am. Several of these molecules also exhibited improved therapeutic indices relative to hERG activity. A representative analog 1r exhibited suitable pharmacokinetic parameters for in vivo animal studies, including moderate clearance and good oral bioavailability. These inhibitor compounds will aid in the exploration of the enzymatic functions of CD38, as well as furthering the study of the therapeutic implications of NAD enhancement in metabolic disease models.     

Conformational and thermodynamic properties of peptide binding to the human S100P protein

S100P is a member of the S100 subfamily of calcium-binding proteins that are believed to be associated with various diseases, and in particular deregulation of S100P expression has been documented for prostate and breast cancer. Previously, we characterized the effects of metal binding on the conformational properties of S100P and proposed that S100P could function as a Ca2+ conformational switch. In this study we used fluorescence and CD spectroscopies and isothermal titration calorimetry to characterize the target-recognition properties of S100P using a model peptide, melittin. Based on these experimental data we show that S100P and melittin can interact in a Ca2+-dependent and -independent manner. Ca2+-independent binding occurs with low affinity (Kd approximately 0.2 mM), has a stoichiometry of four melittin molecules per S100P dimer and is presumably driven by favorable electrostatic interactions between the acidic protein and the basic peptide. In contrast, Ca2+-dependent binding of melittin to S100P occurs with high affinity (Kd approximately 5 microM) has a stoichiometry of two molecules of melittin per S100P dimer, appears to have positive cooperativity, and is driven by hydrophobic interactions. Furthermore, Ca2+-dependent S100P-melittin complex formation is accompanied by significant conformational changes: Melittin, otherwise unstructured in solution, adopts a helical conformation upon interaction with Ca2+-S100P. These results support a model for the Ca2+-dependent conformational switch in S100P for functional target recognition.     

Evaluation of infrared spectroscopy as a bacterial identification method

Summary A study motivated by the recent revival of interest in the use of IR spectroscopy to identify bacteria is reported. A library of FT-IR spectra of dried bacterial films was compled using 16 different strains. A test set was complied from spectra of the same strains grown several months later. The test set was quantitatively compared with the library on the basis of spectral similarity in the region 980–1190 cm^–1. Six of the strains in the test set were not matched with the correct strain in the library despite efforts to reproduce the conditions under which cells were grown and prepared. The results suggest that reproducibility of the bacterial spectra is a potential difficulty that must be addressed by any attempts to develop FT-IR spectroscopy as a bacterial identification method.     

Structural energetics of protein-carbohydrate interactions: Insights derived from the study of lysozyme binding to its natural saccharide inhibitors

High-sensitivity isothermal titration calorimetry was used to characterize the binding of the glycohydrolitic enzyme hen egg-white lysozyme to its natural saccharide inhibitors, chitobiose and chitrotriose. Measurements were done at a pH of 4.7, in the 15 degrees C -45 degrees C temperature range. Using a structural-energetic parameterization derived previously for lectin-carbohydrate associations, both binding enthalpies and entropies for the present systems and for the complex of chitobiose with turkey egg-white lysozyme from the literature were correctly accounted for. These observations suggest that both lysozymes and lectins follow the same structural-energetic behavior in the binding to their ligands. From the analysis of lysozyme data in conjunction with other binding data reported in the literature, an ad hoc parameterization of DeltaCp for protein-carbohydrate complexes was derived for the first time. The novel parameters for both polar and apolar surface areas differed significantly from correlations obtained previously from model compounds and protein-folding data. As DeltaCp is extremely sensitive to changes in solvent structure, this finding indicates that protein-carbohydrate complexes have distinctive hydration properties. According to our analysis, the dehydration of polar groups is the major cause for the observed decrease in DeltaCp, which implies that these groups behave hydrophobically. The contribution of apolar surface areas was found of the expected sign, but their specific weight is much smaller than those obtained in other correlations. This small contribution to DeltaCp is consistent with Lemieux's hypothesis of a low degree of hydration of apolar surfaces on carbohydrates.     

Binding of ferredoxin to algal photosystem I involves a single binding site and is composed of two thermodynamically distinct events

Despite the impressive progress made in recent years in understanding the early steps in charge separation within the photosynthetic reaction centers, our knowledge of how ferredoxin (Fd) interacts with the acceptor side of photosystem I (PSI) is not as well developed. Fd accepts electrons after transiently docking to a binding site on the acceptor side of PSI. However, the exact location, as well as the stoichiometry, of this binding have been a matter of debate for more than two decades. Here, using Isothermal Titration Calorimetry (ITC) and purified components from wild type and mutant strains of the green algae Chlamydomonas reinhardtii we show that PSI has a single binding site for Fd, and that the association consists of two distinct binding events, each with a specific association constant.     

Binding properties of human telomeric quadruplex multimers: a new route for drug design

Human telomeric G-quadruplex structures are known to be promising targets for an anticancer therapy. In the past decade, several research groups have been focused on the design of new ligands trying to optimize the interactions between these small molecules and the G-quadruplex motif. In most of these studies, the target structures were the single quadruplex units formed by short human DNA telomeric sequences (typically 21-26 nt). However, the 3′-terminal single-stranded human telomeric DNA is actually 100-200 bases long and can form higher-order structures by clustering several consecutive quadruplex units (multimers). Despite the increasing number of structural information on longer DNA telomeric sequences, very few data are available on the binding properties of these sequences compared with the shorter DNA telomeric sequences.In this paper we use a combination of spectroscopic (CD, UV and fluorescence) and calorimetric techniques (ITC) to compare the binding properties of the (TTAGGG)₈TT structure formed by two adjacent quadruplex units with the binding properties of the (AG₃TT)₄ single quadruplex structure. The three side-chained triazatruxene derivative azatrux and TMPyP4 cationic porphyrin were used as quadruplex ligands. We found that, depending on the drug, the number of binding sites per quadruplex unit available in the multimer structure was smaller or greater than the one expected on the basis of the results obtained from individual quadruplex binding studies. This work suggests that the quadruplex units along a multimer structure do not behave as completely independent. The presence of adjacent quadruplexes results in a diverse binding ability not predictable from single quadruplex binding studies. The existence of quadruplex-quadruplex interfaces in the full length telomeric overhang may provide an advantageous factor in drug design to enhance both affinity and selectivity for DNA telomeric quadruplexes.     

Characterization of the C-terminal half of human juvenile myoclonic epilepsy protein EFHC1: dimer formation blocks Ca2+ and Mg2+ binding to its functional EF-hand

Human EFHC1 is a member of the EF-hand superfamily of Ca²⁺-binding proteins with three DM10 domains of unclear function. Point mutations in the EFHC1 gene are related to juvenile myoclonic epilepsy, a fairly common idiopathic generalized epilepsy. Here, we report the first structural and thermodynamic analyses of the EFHC1C-terminus (residues 403-640; named EFHC1C), comprising the last DM10 domain and the EF-hand motif. Circular dichroism spectroscopy revealed that the secondary structure of EFHC1C is composed by 34% of α-helices and 17% of β-strands. Size exclusion chromatography and mass spectrometry showed that under oxidizing condition EFHC1C dimerizes through the formation of disulfide bond. Tandem mass spectrometry (MS/MS) analysis of peptides generated by trypsin digestion suggests that the Cys575 is involved in intermolecular S-S bond. In addition, DTNB assay showed that each reduced EFHC1C molecule has one accessible free thiol. Isothermal titration calorimetry (ITC) showed that while the interaction between Ca²⁺ and EFHC1C is enthalpically driven (ΔH = −58.6 to −67 kJ/mol and TΔS = −22.5 to −31 kJ/mol) the interaction between Mg²⁺ and EFHC1C involves an entropic gain, and is ∼5 times less enthalpically favorable (ΔH = −11.7 to −14 kJ/mol and TΔS = 21.9 to 19 kJ/mol) than for Ca²⁺ binding. It was also found that under reducing condition Ca²⁺ or Mg²⁺ ions bind to EFHC1C in a 1/1 molar ratio, while under oxidizing condition this ratio is reduced, showing that EFHC1C dimerization blocks Ca²⁺ and Mg²⁺ binding.     

Energetic differences between the specific binding of a 40 bp DNA duplex and the lac promoter to lac repressor protein

The energetics of LRP binding to a 104 bp lac promoter determined from ITC measurements were compared to the energetics of binding to a shorter 40 bp DNA duplex with the 21 bp promoter binding site sequence. The promoter binding affinity of 2.47 +/- 0.0 1x 10(7) M(-1) was higher than the DNA binding affinity of 1.81 +/- 0.67 x 10(7) M(-1) while the binding enthalpy of -804 +/- 41 kJ mol(-1) was lower than that of the DNA binding enthalpy of -145 +/- 16 kJ mol(-1) at 298.15 K. Both the promoter and DNA binding reactions were exothermic in phosphate buffer but endothermic in Tris buffer that showed the transfer of four protons to LRP in the former reaction but only two in the latter. A more complicated dependence of these parameters on temperature was observed for promoter binding. These energetic differences are attributable to additional LRP-promoter interactions from wrapping of the promoter around the LRP.     

Vibrational frequency shifts as a probe of hydrogen bonds: thermal expansion and glass transition of myoglobin in mixed solvents

The contribution of hydrogen bonds to protein-solvent interactions and their impact on structural flexibility and dynamics of myoglobin are discussed. The shift of vibrational peak frequencies with the temperature of myoglobin in sucrose/water and glycerol/water solutions is used to probe the expansion of the hydrogen bond network. We observe a characteristic change in the temperature slope of the O–H stretching frequency at the glass transition which correlates with the discontinuity of the thermal expansion coefficient. The temperature-difference spectra of the amide bands show the same tendency, indicating that stronger hydrogen bonding in the bulk affects the main-chain solvent interactions in parallel. However, the hydrogen bond strength decreases relative to the bulk solvent with increasing cosolvent concentration near the protein surface, which suggests preferential hydration. Weaker and/or fewer hydrogen bonds are observed at low degrees of hydration. The central O–H stretching frequency of protein hydration water is red-shifted by 40 cm^–1 relative to the bulk. The shift increases towards lower temperatures, consistent with contraction and increasing strength of the protein-water bonds. The temperature slope shows a discontinuity near 180 K. The contraction of the network has reached a critical limit which leads to frozen-in structures. This effect may represent the molecular mechanism underlying the dynamic transition observed for the mean square displacements of the protein atoms and the heme iron of myoglobin. Received: 10 July 1996 / Accepted: 10 April 1997     

Crystal structures of the conserved tRNA-modifying enzyme GidA: implications for its interaction with MnmE and substrate

GidA is a flavin-adenine-dinucleotide (FAD)-binding protein that is conserved among bacteria and eucarya. Together with MnmE, it is involved in the addition of a carboxymethylaminomethyl group to the uridine base in the wobble position (nucleotide 34) of tRNAs that read split codon boxes. Here, we report the crystal structures of the GidA proteins from both Escherichia coli and Chlorobium tepidum. The structures show that the protein can be divided into three domains: a first FAD-binding domain showing the classical Rossmann fold, a second α/β domain inserted between two strands of the Rossmann fold, and an α-helical C-terminal domain. The domain inserted into the Rossmann fold displays structural similarity to the nicotinamide-adenine-dinucleotide-(phosphate)-binding domains of phenol hydroxylase and 3-hydroxy-3-methylglutaryl-CoA reductase, and, correspondingly, we show that GidA binds NADH with high specificity as an initial donor of electrons. GidA behaves as a homodimer in solution. As revealed by the crystal structures, homodimerization is mediated via both the FAD-binding domain and the NADH-binding domain. Finally, a large patch of highly conserved, positively charged residues on the surface of GidA leading to the FAD-binding site suggests a tRNA-binding surface. We propose a model for the interaction between GidA and MnmE, which is supported by site-directed mutagenesis. Our data suggest that this interaction is modulated and potentially regulated by the switch function of the G domain of MnmE.     

NMR binding and crystal structure reveal that intrinsically-unstructured regulatory domain auto-inhibits PAK4 by a mechanism different from that of PAK1

Six human PAK members are classified into groups I (PAKs 1–3) and II (PAK4–6). Previously, only group I PAKs were thought to be auto-inhibited but very recently PAK4, the prototype of group II PAKs, has also been shown to be auto-inhibited by its N-terminal regulatory domain. However, the complete auto-inhibitory domain (AID) sequence remains undefined and the mechanism underlying its auto-inhibition is largely elusive. Here, the N-terminal regulatory domain of PAK4 sufficient for auto-inhibiting and binding Cdc42/Rac was characterized to be intrinsically unstructured, but nevertheless we identified the entire AID sequence by NMR. Strikingly, an AID peptide was derived by deleting the binding-unnecessary residues, which has a Kd of 320 nM to the PAK4 catalytic domain. Consequently, the PAK4 crystal structure complexed with the entire AID has been determined, which reveals that the complete kinase cleft is occupied by 20 AID residuescomposed of an N-terminal α-helix and a previously-identified pseudosubstrate motif, thus achieving auto-inhibition. Our study reveals that PAK4 is auto-inhibited by a novel mechanism which is completely different from that for PAK1, thus bearing critical implications for design of inhibitors specific for group II PAKs.     

The utilization of bathocuproinedisulfonic acid as a reagent for determining D-glucose and D-galactose levels in glycoconjugates

A sensitive, rapid, and reliable method for measuring d-glucose and d-galactose levels in glycoconjugates has been developed. In this method, the NAD(P)H produced from the enzymatic oxidation of the monosaccharides is reacted with a CuSO₄-bathocuproinedisulfonic acid reagent (Cu-BCS) to produce a color complex absorbing maximally at 486 nm. With galactose dehydrogenase and glucose dehydrogenase serving as the model enzymes, graphs of absorbance versus varying d-glucose or d-galactose concentrations yielded a linear plot from 2.5 to 250 nmol of sugar. Using this procedure, sugar released by acid hydrolysis from lactose, porcine submaxillary mucin and raffinose was quantified. When p-nitrophenyl-α-d-glucopyranoside and p-nitrophenyl-β-d-galactopyranoside were acid hydrolyzed and assayed with the Cu-BCS reagent, the amount of sugar released from each of the p-nitrophenyl compounds was found to be equal to the levels of p-nitrophenol in solution. This method is easy to use and with minor modifications can be employed for the quantification of d-glucose and d-galactose in other glycoconjugates.     

Studies of lysozyme binding to histamine as a ligand for hydrophobic charge induction chromatography

Histamine was immobilized on Sepharose CL‐6B (Sepharose) for use as a ligand of hydrophobic charge induction chromatography (HCIC) of proteins. Lysozyme adsorption onto Histamine‐Sepharose (HA‐S) was studied by adsorption equilibrium and calorimetry to uncover the thermodynamic mechanism of the protein binding. In both the experiments, the influence of salt (ammonium sulfate and sodium sulfate) was examined. Adsorption isotherms showed that HA‐S exhibited a high salt tolerance in lysozyme adsorption. This property was well explained by the combined contributions of hydrophobic interaction and aromatic stacking. The isotherms were well fitted to the Langmuir equation, and the equilibrium parameters for lysozyme adsorption were obtained. In addition, thermodynamic parameters (ΔH_ads, ΔS_ads, and ΔG_ads) for the adsorption were obtained by isothermal titration calorimetry by titrating lysozyme solutions into the adsorbent suspension. Furthermore, free histamine was titrated into lysozyme solution in the same salt‐buffers. Compared with the binding of lysozyme to free histamine, lysozyme adsorption onto HA‐S was characterized by a less favorable ΔG_ads and an unfavorable ΔS_ads because histamine was covalently attached to Sepharose via a three‐carbon‐chain spacer. Consequently, the immobilized histamine could only associate with the residues on the protein surface rather than those in the hydrophobic pocket, causing a less favorable orientation between histamine and lysozyme. Further comparison of thermodynamic parameters indicated that the unfavorable ΔS_ads was offset by a favorable ΔH_ads, thus exhibiting typical enthalpy‐entropy compensation. Moreover, thermodynamic analyses indicated the importance of the dehydration of lysozyme molecule and HA‐S during the adsorption and a substantial conformational change of the protein during adsorption. The results have provided clear insights into the adsorption mechanisms of lysozyme onto the new HCIC material. © 2009 American Institute of Chemical Engineers Biotechnol. Prog., 2010     

Temperature dependent 2nd derivative absorbance spectroscopy of aromatic amino acids as a probe of protein dynamics

Proteins display a broad peak in 250–300 nm region of their UV spectrum containing multiple overlapping bands arising from the aromatic rings of phenylalanine, tyrosine, and tryptophan residues. Employing high resolution 2^nd derivative absorbance spectroscopy, these overlapping absorption bands can be highly resolved and therefore provide a very sensitive measure of changes in the local microenvironment of the aromatic side chains. This has traditionally been used to detect both subtle and dramatic (i.e., unfolding) conformational alterations of proteins. Herein, we show that plots of the temperature dependent 2^nd derivative peak positions of aromatic residues have measurable slopes before protein unfolding and that these slopes are sensitive to the dielectric properties of the surrounding microenvironment. We further demonstrate that these slopes correlate with hydration of the buried aromatic residues in protein cores and can therefore be used as qualitative probes of protein dynamics.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Intercalation activating fluorescence DNA probe and its application to homogeneous quantification of a target sequence by isothermal sequence amplification in a closed vessel

We developed a completely homogeneous and isothermal method of detecting RNA sequences and demonstrated ultrarapid and direct quantification of pathogenic gene expression with high sensitivity. The assay is based on performing isothermal RNA sequence amplification in the presence of our novel DNA probe, an intercalation activating fluorescence DNA probe, and measuring the fluorescence intensity of the reaction mixture. When detecting mecA gene expression of methicillin-resistant Staphylococcus aureus, we quantified starting copies ranging from 10 to 10(7) copies within 10min. The primer sequences were designed to bind to secondary structure-free sites of the target RNA, which enabled a totally isothermal protocol to quantify mRNA specifically in a sample of existing genomic DNA. When we applied this to quantifying the expression of marker genes of Vibrio parahaemolyticus and Mycobacterium bovis BCG strain, the results correlated well with the viability of each bacterium. We also demonstrated monitoring Pab gene expression of M. bovis BCG during cultivation with antibiotics. The present method can potentially realize rapid antimicrobial susceptibility testing of slowly growing organisms, such as tuberculosis.