Hybrid peptide-small molecule oxytocin analogs are potent and selective agonists of the oxytocin receptor

Oxytocin (OT) is a peptide hormone agonist of the oxytocin receptor (OTR) that has been proposed as a therapeutic to treat a number of social and emotional disorders in addition to its current clinical use to induce labor and treat postpartum bleeding. OT is administered intravenously and intranasally rather than orally, in part because its low passive permeability causes low oral bioavailability. Non-peptidic OTR agonists have also been reported, but none with the exquisite potency of the peptide based agonists. In this report, we describe the OTR agonist activity and exposed polarity of a set of truncated OT analogs as well as hybrid peptide-small molecule analogs of OT. Examples of both truncated analogs and peptide-small molecule hybrid analogs are potent and selective OTR agonists. Hybrid agonist 13, which is 232?Da smaller than OT, still retains subnanomolar potency, full agonist activity, and selectivity over V1a. While these compounds were designed to address the low permeability of OT and other full length analogs, we found that reduction in molecular weight and the removal or replacement of the three amino acid tail of OT did not have a significant effect on passive permeability.     

Embryoid bodies from mouse stem cells express oxytocin receptor, Oct-4 and DAZL

Oxytocin is a nine amino acid peptide involved in a wide spectrum of physiological functions; predominantly those concerning reproduction and differentiation are of interest. Oxytocin receptors are expressed at early developmental stages of mammals, suggesting that oxytocin might be involved in the determination of the germ stem cell line, at the very early stages of mammalian development. In this respect, the proximate aim of the present study was to confirm and further analyze the existence of oxytocin receptors at a very early level of cell commitment, that is, the determination of germ cells derived from embryoid bodies. To achieve our purpose we have cultured mouse embryonic stem cells under conditions inducing formation of embryoid bodies. In this work, ES cells were allowed to aggregate in a novel medium, “Stefanidis medium” from day 0 to day 14 until formed EBs. RNA was isolated from EBs and using RT-PCR we showed that EBs expressed Oct-4, OTR, OT, and DAZL. To demonstrate simultaneous expression immunocytochemistry was preformed, in which EBs showed strong immunoreactivity for both, OTR and DAZL molecular markers. We found that 35% of the cells displayed OTR, using flow cytometry. In addition, this novel medium showed to increase OTR mRNA. We propose, that at least in murine induced embryoid bodies there is simultaneous expression of oxytocin receptors and germ cell markers (DAZL) in many cells (expressing Oct-4). We thus conclude that, the oxytocin might indeed be a molecule playing a leading role in germ cell determination.     

Effects of adipokines and obesity on uterine contractility

Obesity is a major public health problem. The prevalence of obesity has significantly increased in developed countries, particularly in France with an overall increase of 76% over the last 15 years. In pregnant women, obesity is associated with alterations in the quality of labor, such as delayed onset of labor, a higher rate of prolonged pregnancies, prolonged labor, and higher oxytocin requirements. There is also an increased prevalence of Cesarean sections, particularly during the active phase of labor, and perinatal complications (postpartum hemorrhage).It seems that some of these functional changes and their consequences can be attributed to a disruption of hormonal balance encountered in obese women and involving adipokines (apelin, ghrelin, visfatin, leptin), but also to the interactions between adipose tissue and the “oxytocin (OT) – oxytocin receptor (OTR)”.In this review, we detailed mechanisms to understand the impact of specific metabolic alterations in obesity on uterine contractility.Better knowledge of the impact of obesity on labor and delivery pathophysiology should strengthen the prevention of obesity in women of childbearing age and provide a suitable and effective management. The beneficial effect of weight loss and exercise in non-pregnant women on the correction of metabolic disorders secondary to obesity should be studied in populations of overweight women to demonstrate its effectiveness.     

Adolescent exposure to oxytocin,but not the selective oxytocin receptor agonist TGOT,increases social behavior and plasma oxytocin in adulthood

There are indications that exposing adolescent rodents to oxytocin (OT) may have positive “trait-changing” effects resulting in increased sociability and decreased anxiety that last well beyond acute drug exposure and into adulthood. Such findings may have relevance to the utility of OT in producing sustained beneficial effects in human psychiatric conditions. The present study further examined these effects using an intermittent regime of OT exposure in adolescence, and using Long Evans rats, that are generally more sensitive to the acute prosocial effects of OT. As OT has substantial affinity for the vasopressin V1a receptor (V1aR) in addition to the oxytocin receptor (OTR), we examined whether a more selective peptidergic OTR agonist – [Thr4, Gly7]-oxytocin (TGOT) – would have similar lasting effects on behavior. Male Long Evans rats received OT or TGOT (0.5–1 mg/kg, intraperitoneal), once every three days, for a total of 10 doses during adolescence (postnatal day (PND) 28–55). Social and anxiety-related behaviors were assessed during acute administration as well as later in adulthood (from PND 70 onwards). OT produced greater acute behavioral effects than TGOT, including an inhibition of social play and reduced rearing, most likely reflecting primary sedative effects. In adulthood, OT but not TGOT pretreated rats displayed lasting increases in social interaction, accompanied by an enduring increase in plasma OT. These findings confirm lasting behavioral and neuroendocrine effects of adolescent OT exposure. However, the absence of such effects with TGOT suggests possible involvement of the V1aR as well as the OTR in this example of developmental neuroplasticity.     

Agonist-specific, high-affinity binding epitopes are contributed by an arginine in the N-terminus of the human oxytocin receptor

The effects of the peptide hormone oxytocin (OT) are mediated by the oxytocin receptor, which is a member of the G-protein-coupled receptor family. Defining differences between the binding of agonists and antagonists to the OTR, at the molecular level, is of fundamental importance to understanding OTR activation and to rational drug design. Previous reports have indicated that the N-terminus of the OTR is required for OT binding. The aim of this study was to identify which individual residues within the N-terminal domain of the human OTR provided these OT binding epitopes. A series of truncated OTRs and mutant receptor constructs with systematic alanine substitution were characterized with respect to their pharmacological profile and intracellular signaling capability. Although a number of residues within the OTR will be required for optimal OT-OTR interaction, our data establish that Arg(34) within the N-terminal domain contributes to high-affinity OT binding. Removal of Arg(34) by truncation or substitution resulted in a 2000-fold decrease in OT affinity. In addition, we show that the arginyl at this locus is required for high-affinity binding of agonists in general. However, the importance of Arg(34) is restricted to agonist interaction with the OTR, as it was not required for binding peptide antagonist or non-peptide antagonist. It is noteworthy that the corresponding Arg in the related rat V(1a) vasopressin receptor is also required for high-affinity agonist binding. This study defines, at the molecular level, the role of the N-terminus of the OTR in high-affinity agonist binding and identifies a key residue for this function.     

Coincident increases in oxytocin receptor expression and EMG responsiveness to oxytocin in the ovine cervix at oestrus

This study has localised oxytocin receptor (OTR) mRNA expression within the cervix of non-pregnant ewes and related this to changes in the sensitivity of the cervical musculature to administered oxytocin (OT) during the oestrous cycle by recording electromyographic (EMG) activity. Cervices were collected from 34 ewes at specified time points throughout the cycle. OTR mRNA expression was localised by in situ hybridisation and results were expressed as optical density measurements from autoradiographs in each of four different cervical regions. EMG recordings were made for up to 8 h per day from four non-pregnant ewes undergoing seasonal oestrous cycles between Days −3 and +3 relative to oestrus (Day 0). The highest concentrations of OTR mRNA were detectable within the luminal epithelium (LE) of the cervix, with values increasing from Day 15 of the cycle, peaking during the follicular phase (P<0.001, compared to the mid-luteal phase) and returning to basal by Day 2. There was a small but significant increase in OTR mRNA hybridisation (above basal/luteal phase values) within the stromal cells (STR) adjacent to the lumen (P<0.05) during the same time period, but no differences from basal values were detectable in the dense collagenous annular ring or in tissue superficial to this. Analysis of pooled EMG activity recorded daily from the cervix indicated that endogenous contractile activity was higher on Day 0 than on the Days +1 (P<0.05), −2, +2 and +3 (P<0.001). The response to bolus intravenous (i.v.) injections of 25 mU OT (25 mU) varied with day of the cycle. This dose produced a measurable and significant response on Days 0 (P<0.001) and +1 (P<0.001), but not on any of the other days, indicating that the sensitivity of the cervical musculature to OT peaked on these days. These data show that the cervix is highly responsive to OT at oestrus. This coincides with an increase in OTR mRNA expression in the luminal epithelial cells, suggesting the likely production of an intermediary messenger between the epithelial and smooth muscle cells.     

Sex-specific activity and function of hypothalamic nonapeptide neurons during nest-building in zebra finches

Vertebrate species from fish to humans engage in a complex set of preparatory behaviors referred to as nesting; yet despite its phylogenetic ubiquity, the physiological and neural mechanisms that underlie nesting are not well known. We here test the hypothesis that nesting behavior is influenced by the vasopressin–oxytocin (VP–OT) peptides, based upon the roles they play in parental behavior in mammals. We quantified nesting behavior in male and female zebra finches following both peripheral and central administrations of OT and V_1a receptor (OTR and V1aR, respectively) antagonists. Peripheral injections of the OTR antagonist profoundly reduce nesting behavior in females, but not males, whereas comparable injections of V1aR antagonist produce relatively modest effects in both sexes. However, central antagonist infusions produce no effects on nesting, and OTR antagonist injections into the breast produce significantly weaker effects than those into the inguinal area, suggesting that antagonist effects are mediated peripherally, likely via the oviduct. Finally, immunocytochemistry was used to quantify nesting-induced Fos activation of nonapeptide neurons in the paraventricular and supraoptic nuclei of the hypothalamus and the medial bed nucleus of the stria terminalis. Nest-building induced Fos expression within paraventricular VP neurons of females but not males. Because the avian forms of OT (Ile⁸-OT; mesotocin) and VP (Ile³-VP; vasotocin) exhibit high affinity for the avian OTR, and because both peptide forms modulate uterine contractility, we hypothesize that nesting-related stimuli induce peptide release from paraventricular vasotocin neurons, which then promote female nesting via peripheral feedback from OTR binding in the oviduct uterus.     

The effect of relaxin on the oxytocin receptor in human uterine smooth muscle cells

Experimental objectives: Activation of the oxytocin receptor (OTR) induces phospholipase C induced PIP(2) turnover in the human uterus. Relaxin (RLX), a polypeptide hormone produced in the corpus luteum of pregnancy as well as in the placenta and decidua inhibits PIP(2) turnover and subsequent signaling in human myometrium. The purpose of this study was to evaluate a possible effect of RLX on OTR regulation in human uterine smooth muscle cells. Primary cultures of myometrium from term pregnant women undergoing elective caesarean section were incubated for different time periods (0-96 h) and with different concentrations of RLX [10 pg/ml-20 microg/ml]. The effects on OTR binding, mRNA and protein expression were evaluated by means of (125)I-OVT binding assay, RT-PCR and flow cytometry. RESULTS: Prolonged RLX incubation was able to inhibit 30-40% of OTR binding while binding affinity remained unchanged. Oxytocin receptor mRNA and protein expression were down regulated by RLX about 50% and 35% respectively. CONCLUSION: We report for the first time an effect of RLX on OTR regulation in human uterine myometrial cells. The above results indicate that high local uterine RLX concentrations may be involved in uterine quiescence during human pregnancy by down regulating the OTR.     

Constitutive and ligand-induced nuclear localization of oxytocin receptor

Oxytocin receptor (OTR) is a membrane protein known to mediate oxytocin (OT) effects, in both normal and neoplastic cells. We report here that human osteosarcoma (U2OS, MG63, OS15 and SaOS2), breast cancer (MCF7), and primary human fibroblastic cells (HFF) all exhibit OTR not only on the cell membrane, but also in the various nuclear compartments including the nucleolus. Both an OTR-GFP fusion protein and the native OTR appear to be localized to the nucleus as detected by transfection and/or confocal immunofluorescence, respectively. Treatment with oxytocin causes internalization of OTR and the resulting vesicles accumulate in the vicinity of the nucleus and some of the perinuclear OTR enters the nucleus. Western blots indicate that OTR in the nucleus and on the plasma membrane are likely to be the same biochemical and immunological entities. It appears that OTR is first visible in the nucleoli and subsequently disperses within the nucleus into 4-20 spots while some of the OTR diffuses throughout the nucleoplasm.The behaviour and kinetics of OTR-GFP and OTR are different, indicating interference by GFP in both OTR entrance into the nucleus and subsequent relocalization of OTR within the nucleus. There are important differences among the tested cells, such as the requirement of a ligand for transfer of OTR in nuclei. A constitutive internalization of OTR was found only in osteosarcoma cells, while the nuclear localization in all other tested cells was dependent on ligand binding. The amount of OTR-positive material within and in the vicinity of the nucleus increased following a treatment with oxytocin in both constitutive and ligand-dependent type of cells. The evidence of OTR compartmentalization at the cell nucleus (either ligand-dependent or constitutive) in different cell types suggests still unknown biological functions of this protein or its ligand and adds this G-protein-coupled receptor to other heptahelical receptors displaying this atypical and unexpected nuclear localization.     

Building bridges for highly selective,potent and stable oxytocin and vasopressin analogs

Oxytocin (OT) is an exciting potential therapeutic agent, but it is highly sensitive to modification and suffers extensive degradation at elevated temperature and in vivo. Here we report studies towards OT analogs with favorable selectivity, affinity and potency towards the oxytocin receptor (OTR), in addition to improving stability of the peptide by bridging the disulfide region with substituted dibromo-xylene analogs. We found a sensitive structure-activity relationship in which meta-cyclized analogs (dOT_meta) gave highest affinity (50?nM K_i), selectivity (34-fold), and agonist potency (34?nM EC₅₀, 87-fold selectivity) towards OTR. Surprisingly, ortho-cyclized analogs demonstrated OTR and vasopressin V_1a receptor subtype affinity (220?nM and 69?nM, respectively) and pharmacological activity (294?nM and 35?nM, respectively). V_1a binding and selectivity for ortho-cyclized peptides could be improved 6-fold by substituting a neutral residue at position 8 with a basic amino acid, providing potent antagonists (14?nM IC₅₀) that displayed no activation of the OTR. Furthermore, xylene-bridged analogs demonstrated increased stability compared to OT at elevated temperature, demonstrating promising therapeutic potential for these analogs which warrants further study.     

Molecular modelling study of the role of cholesterol in the stimulation of the oxytocin receptor.

Cholesterol, an integral component of membranes in Eucaryota, is a modifier of membrane properties. In vivo studies have demonstrated that cholesterol can also modulate activities of some G protein-coupled receptors (GPCRs), which are integral membrane proteins. This can result either from an effect of cholesterol on the membrane fluidity or from specific interactions of the membrane cholesterol with the receptor, as recently demonstrated for the cholecystokinin type beta (CCKRbeta) or the oxytocin receptor (OTR). Using molecular modelling, we studied conformational preferences of cholesterol and several of its analogues. Subsequently, we simulated the distributions of their preferred conformations around the surface of OTR, CCKRbeta and a chimeric oxytocin/cholecystokinin receptor. Consequently, we suggest residues on the surface of OTR which are potentially significant in the OTR/cholesterol interaction.     

Novel in vitro system for functional assessment of oxytocin action

One of the classical biological actions mediated by the posterior pituitary hormone oxytocin (OT) is contraction of the uterus at parturition. Moreover, premature activation of the OT system is thought to contribute to preterm labor, a major clinical problem in obstetrical practice. However, the molecular mechanisms linking activation of the OT receptor (OTR) to myometrial contractions are not fully understood. Here, we describe an in vitro system that should serve as a useful tool to study this question at a cellular level. The system consists of a collagen lattice contraction assay and two different human myometrial cell lines: a cell clone from a telomerase-immortalized human myometrial cell population (hTERT-C3) as well as a cell line derived from a primary culture of human myometrial cells (M11). Using this approach, we observed that 1 nM OT promoted an almost maximal effect on cell contraction in both cell lines tested. Furthermore, this dose-dependent, OT-induced contraction was antagonized by the specific OTR antagonist d(CH(2))(5)[Tyr(Me)(2),Thr(4),Tyr-NH(2)(9)]OVT as well as the clinically used antagonist atosiban. This cell line-based contraction assay enables the application of molecular tools aimed at suppressing or overexpressing specific genes. It is also amenable to high-throughput testing approaches. Therefore, this system represents a powerful and improved experimental model that should facilitate the study of the molecular signal transduction pathways involved in the uterotonic actions of OT.     

Oxytocin receptor density is associated with male mating tactics and social monogamy

Despite its well-described role in female affiliation, the influence of oxytocin on male pairbonding is largely unknown. However, recent human studies indicate that this nonapeptide has a potent influence on male behaviors commonly associated with monogamy. Here we investigated the distribution of oxytocin receptors (OTR) throughout the forebrain of the socially monogamous male prairie vole (Microtus ochrogaster). Because males vary in both sexual and spatial fidelity, we explored the extent to which OTR predicted monogamous or non-monogamous patterns of space use, mating success and sexual fidelity in free-living males. We found that monogamous males expressed higher OTR density in the nucleus accumbens than non-monogamous males, a result that mirrors species differences in voles with different mating systems. OTR density in the posterior portion of the insula predicted mating success. Finally, OTR in the hippocampus and septohippocampal nucleus, which are nuclei associated with spatial memory, predicted patterns of space use and reproductive success within mating tactics. Our data highlight the importance of oxytocin receptor in neural structures associated with pairbonding and socio-spatial memory in male mating tactics. The role of memory in mating systems is often neglected, despite the fact that mating tactics impose an inherently spatial challenge for animals. Identifying mechanisms responsible for relating information about the social world with mechanisms mediating pairbonding and mating tactics is crucial to fully appreciate the suite of factors driving mating systems. This article is part of a Special Issue entitled Oxytocin, Vasopressin, and Social Behavior.     

Hormonal regulation of vasotocin receptor mRNA in a seasonally breeding songbird

Behaviors associated with breeding are seasonally modulated in a variety of species. These changes in behavior are mediated by sex steroids, levels of which likewise vary with season. The effects of androgens on behaviors associated with breeding may in turn be partly mediated by the nonapeptides vasopressin (VP) and oxytocin (OT) in mammals, and vasotocin (VT) in birds. The effects of testosterone (T) on production of these neuropeptides have been well-studied; however, the regulation of VT receptors by T is not well understood. In this study, we investigated steroid-dependent regulation of VT receptor (VTR) mRNA in a seasonally breeding songbird, the white-throated sparrow (Zonotrichia albicollis). We focused on VTR subtypes that have been most strongly implicated in social behavior: V1a and oxytocin-like receptor (OTR). Using in situ hybridization, we show that T-treatment of non-breeding males altered V1a and OTR mRNA expression in several regions associated with seasonal reproductive behaviors. For example, T-treatment increased V1a mRNA expression in the medial preoptic area, bed nucleus of the stria terminalis, and ventromedial hypothalamus. T-treatment also affected both V1a and OTR mRNA expression in nuclei of the song system; some of these effects depended on the presence or absence of a chromosomal rearrangement that affects singing behavior, plasma T, and VT immunolabeling in this species. Overall, our results strengthen evidence that VT helps mediate the behavioral effects of T in songbirds, and suggest that the chromosomal rearrangement in this species may affect the sensitivity of the VT system to seasonal changes in T.     

Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.     

Parathyroid hormone-related protein treatment of pregnant rats delays the increase in connexin 43 and oxytocin receptor expression in the myometrium

Myometrial quiescence during pregnancy is maintained by progesterone, which suppresses the expression of labor-associated genes such as connexin 43 (Cx43) and the oxytocin receptor (OTR). Parathyroid hormone-related protein (PTHrP) is a smooth muscle relaxant that inhibits myometrial contractions and therefore may act in synergy with progesterone to maintain myometrial quiescence during late pregnancy. We investigated the possibility that PTHrP, like progesterone, could act to suppress the expression of labor-associated genes. Pregnant rats were treated starting on Day 19 with daily i.p. injections of 100 microg/kg PTHrP (human synthetic fragment 1-34). On Day 22 of gestation, there was a significant reduction in the expression of Cx43 (mRNA and protein) and OTR (mRNA) in the myometrium of PTHrP-treated animals, whereas on Day 23 (labor) the expression of both Cx43 and OTR was unchanged by PTHrP treatment. Treatment of pregnant rats with PTHrP did not affect the time of delivery, concentrations of progesterone in maternal plasma, or levels of c-fos, fra-2, or parathyroid hormone/PTHrP receptor mRNA on any gestational day. Because PTHrP treatment delayed the dramatic increase in the expression of Cx43 and OTR, it may be an important factor in the maintenance of the quiescent state of the myometrium at a time when the concentrations of progesterone in maternal circulation decrease. PTHrP treatment did not prevent the increase in Cx43 and OTR gene expression on Day 23 or the timing of labor, suggesting that the effects of PTHrP signaling are overridden with the onset of labor.     

Neonatal paternal deprivation impairs social recognition and alters levels of oxytocin and estrogen receptor α mRNA expression in the MeA and NAcc,and serum oxytocin in mandarin voles

Paternal care is necessary for the healthy development of social behavior in monogamous rodents and social recognition underpins social behavior in these animals. The effects of paternal care on the development of social recognition and underlying neuroendocrine mechanisms, especially the involvement of oxytocin and estrogen pathways, remain poorly understood. We investigated the effects of paternal deprivation (PD: father was removed from neonatal pups and mother alone raised the offspring) on social recognition in mandarin voles (Microtus mandarinus), a socially monogamous rodent. Paternal deprivation was found to inhibit the development of social recognition in female and male offspring according to a habituation–dishabituation paradigm. Paternal deprivation resulted in increased inactivity and reduced investigation during new encounters with other animals. Paternal deprivation reduced oxytocin receptor (OTR) and estrogen receptor α (ERα) mRNA expression in the medial amygdala and nucleus accumbens. Paternal deprivation reduced serum oxytocin (OT) concentration in females, but had no effect on males. Our results provide substantial evidence that paternal deprivation inhibits the development of social recognition in female and male mandarin voles and alters social behavior later in life. This is possibly the result of altered expression of central OTR and ERα and serum OT levels caused by paternal deprivation.     

Systematic N-methylation of oxytocin: Impact on pharmacology and intramolecular hydrogen bonding network

Oxytocin (OT) is a peptide hormone agonist of the OT receptor (OTR) that plays an important role in social behaviors such as pair bonding, maternal bonding and trust. The pharmaceutical development of OT as an oral peptide therapeutic has been hindered historically by its unfavorable physicochemical properties, including molecular weight, polarity and number of hydrogen bond donors, which determines poor cell permeability. Here we describe the first systematic study of single and multiple N-methylations of OT and their effect on physicochemical properties as well as potency at the OT receptor. The agonist EC₅₀ and percent effect for OTR are reported and show that most N-methylations are tolerated but with some loss in potency compared to OT. The effect of N-methylation on exposed polarity is assessed through the EPSA chromatographic method and the results validated against NMR temperature coefficient experiments and the determination of NMR solution structures. We found that backbone methylation of residues not involved in IMHB and removal of the N-terminal amine can significantly reduce the exposed polarity of peptides, and yet retain a significant OTR agonist activity. The results of this study also expose the potential challenge of using the N-methylation strategy for the OT system; while exposed polarity is reduced, in some cases backbone methylation produces a significant conformational change that compromises agonist activity. The data presented provides useful insights on the SAR of OT and suggests future design strategies that can be used to develop more permeable OTR agonists based on the OT framework.     

Oxytocin receptor binding in the hypothalamus during gestation in rats

Central oxytocin receptors (OTR) may be involved in adaptations of the brain oxytocin (OT) system during gestation, which are critical for systemic release of OT during parturition and lactation. We used quantitative autoradiography to determine changes in OTR binding in numerous brain sites during the course of gestation in the rat. Furthermore, to evaluate the importance of ovarian steroids in mediating pregnancy-related changes in OTR binding, we measured binding in ovariectomized animals treated with progesterone and/or estrogen, and in pregnant animals treated with exogenous progesterone during late gestation. We found that OTR binding was significantly increased in the paraventricular nucleus (PVN) and supraoptic nucleus (SON) by midgestation (day 15) compared with control. In addition, there was a further significant increase in OTR binding in these nuclei by late gestation (day 20). The bed nucleus of the stria terminalis (BNST) and the medial preoptic area (MPOA) also showed significant gestation-associated increases in OTR binding, which were similar during mid- and late pregnancy. Treatment with exogenous progesterone throughout pregnancy did not alter the increase in OTR binding characteristic of late gestation in any of these brain sites. Finally, estrogen treatment in ovariectomized animals resulted in increased OTR binding in the SON, BNST, and MPOA, but not the PVN. These data demonstrate that OTR binding in the hypothalamus is increased during mid- and late-gestation, compared with ovariectomized control animals, which may be mediated by increased estradiol.