Messenger RNA for ribosomal proteins in dormant and developing Artemia salina embryos

Ribosomal proteins from Artemia salina have been separated in a two-dimensional acrylamide gel system and assigned to the small and large ribosomal subunits. Poly(A)-containing RNA was prepared from dormant cysts and from polysomes of 30 min, 1 h, 5 h and 12 h embryos and hatching larvae. The mRNA from different stages was translated in a wheat-germ lysate and its template activity for ribosomal proteins was analyzed. It was observed that mRNA activity for ribosomal proteins is stored in the cytoplasm of dormant cysts and that it is found associated with polysomes of 30 min and of later stages.     

Messenger RNA sequence complexity and homology in developmental stages of Drosophila

Total polysomal RNA and polyadenylated mRNA from third instar larvae, pupae, and adults of D. melanogaster were hybridized in vast excess to labeled single-copy DNA in order to measure the sequence complexity of each RNA population. Then, to measure the sequence homology between the populations, each was hybridized to DNA enriched for messenger coding sequences in third instar larvae and to DNA depleted of these sequences. Our results show that a similar number of genes, approximately 16,000, is expressed in larvae, pupae, and adults, and that only one-third of these is expressed as polyadenylated mRNA. Further, the composition of both polyadenylated and nonpolyadenylated mRNA classes is shown to change very little between these three stages of development. Finally, the head of adult Drosophila is shown to contain 11,000 RNA species, approximately 70% of the number contained in the entire adult.     

The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU _OH.     

Messenger RNA synthesis during early ascidian development.

RNA synthesis during early embryogenesis of the ascidian Ciona intestinalis was studied. Embryonic polyribosomes labeled with uridine from 5 to 7 hr after fertilization were isolated and the labeled RNA species were characterized by oligo(dT)-cellulose chromatography and sucrose gradient sedimentation analysis. Since at least 50% of the labeled RNA was polyadenylated and all of it sedimented heterogeneously, it was concluded that mRNA was synthesized during the labeling period. Further, the synthesis of heterogeneously sedimenting, polyadenylated RNA at various stages of development from midcleavage to metamorphosis indicated that gene activity and perhaps mRNA synthesis occurred at earlier and later stages of development as well. Autoradiographic studies showed that the embryonic genome was the site of this activity, since uridine incorporation was localized in embryonic cells and not in accessory cells. Finally, under the labeling conditions employed (2-hr pulses), rRNA synthesis was not detected until larvae hatched.     

Induction of multiple proteases during the early larval development of Artemia salina

Extracts from dormant and developing embryos of Artemia salina contain almost undetectable levels of protease activity. However, after hatching of the nauplii, there is a high increase in the activity of the extracts on different proteolytic substrates. The activities correspond to four different enzymes, A, B, C, and D, that have a sequential timing of induction during the early larval development. The enzymes show a different elution pattern after chromatography on DEAE-cellulose and a different sensitivity to protease inhibitors. Enzyme A is strongly inhibited by phenylmethylsulfonyl fluoride, while the other enzymes are mostly insensitive. Enzymes A, B, and C are sensitive at low concentrations of the soybean trypsin inhibitor. The temporal induction of these enzymes is an example of the expression, at the biochemical level, of the developmental program of Artemia salina.     

Messenger RNA and microRNA profiling during early mouse EB formation

Embryonic stem (ES) cells can be induced to differentiate into embryoid bodies (EBs) in a synchronised manner when plated at a fixed density in hanging drops. This differentiation procedure mimics post-implantation development in mouse embryos and also serves as the starting point of protocols used in differentiation of stem cells into various lineages. Currently, little is known about the potential influence of microRNAs (miRNAs) on mRNA expression patterns during EB formation. We have measured mRNA and miRNA expression in developing EBs plated in hanging drops until day 3, when discrete structural changes occur involving their differentiation into three germ layers. We observe significant alterations in mRNA and miRNA expression profiles during this early developmental time frame, in particular of genes involved in germ layer formation, stem cell pluripotency and nervous system development. Computational target prediction using Pictar, TargetScan and miRBase Targets reveals an enrichment of binding sites corresponding to differentially and highly expressed miRNAs in stem cell pluripotency genes and a neuroectodermal marker, Nes. We also find that members of let-7 family are significantly down-regulated at day 3 and the corresponding up-regulated genes are enriched in let-7 seed sequences. These results depict how miRNA expression changes may affect the expression of mRNAs involved in EB formation on a genome-wide scale. Understanding the regulatory effects of miRNAs during EB formation may enable more efficient derivation of different cell types in culture.     

mRNA sequence diversity during early embryogenesis in Drosophila melanogaster.

The structure and metabolism of membrane glycoprotein carbohydrate units were studied in three clonal strains of contact-deficient mouse L cells as compared with several contact-competent rodent fibroblasts. The L cells appeared deficient in the formation of stable adhesive and communicating contacts. Formation of these contacts could not be induced by artificial adhesion induced by Sendai virus. The absence of functional contacts in L cells was associated with synthesis of incomplete, dialysable fucosyl glycopeptides exposed at the cell surface. Somatic cell hybrids between communication incompetent L cells and mouse leukemia cells synthesized membrane carbohydrates of near-normal size distribution, but these cells remained deficient in functional contacts. However, in hybrids of L cells and normal human fibroblasts or lymphocytes, glycoprotein synthesis and formation of functional contacts were concomitantly restored.     

Rice bicoid－related cDNA sequence and its expression during early embryogenesis

INTRODUCTIONThe establishment of embryonic polarity is oneof the critical events in embryogenesis. The polar distribution of maternal mRNA can be tracedto the unfertilized egg cell. After fertilization, itstranslational products trigger the zygotic targetgenes which define the embryonic region and fUIther direct the pattern formation and body planduring embryogenesis. In Drosophila, Bicoid is oneof the important maternal genes involved in thecontrol of embryo polarity and larvae segmen…     

Rates of RNA synthesis during early embryogenesis in Drosophila melanogaster

We determined the absolute rates of RNA synthesis during embryogenesis in Drosophila melanogaster by measuring the incorporation of ³H-5-orotic acid into RNA, and the specific activity of the UTP pool. Initially (preblastoderm) the rate of RNA synthesis is relatively high, but declines to a lower level by gastrulation. The data suggest that RNA synthesis is initiated during very early embryogenesis.     

Characteristics and intracellular distribution of messengerlike RNA in encysted embryos of Artemia salina

Homogenates of dormant cysts of Artemia salina were fractionated by differential centrifugation. RNA was prepared from the various fractions and tested for stimulatory activity in a [¹⁴C]leucine incorporating Escherichia coli system. The highest specific activity was found in the RNA extracted from a cytoplasmic fraction sedimenting at 15,000 g. Some activity was associated with the soluble and crude ribosomal fractions, while the RNA extracted from the crude nuclear fraction was less active.The 15,000 g sediment was purified by centrifugation in a sucrose density gradient. The active material formed a characteristic, colored band at a buoyant density of about 1.17 g/ml. The banding fraction was mainly composed of endoplasmic vesicles and mitochondria. The specific activity of the extracted RNA was further increased when the 15,000 g sediment was treated with buffered 20–100 mM EDTA (with or without 0.1% Triton X-100) before banding.Sedimentation analysis of the active RNA from the purified 15,000 g fractions revealed three distinct absorption peaks at 28 S, 18 S, and 16 S, apparently representing cytoplasmic and mitochondrial rRNA. The 28 S and 18 S peaks were reduced by EDTA treatment, but only to a certain limit. By gel electrophoresis a number of additional components were resolved, including 4 S and 5 S RNA. The template activity showed a heterodisperse distribution with a maximum at 17–20 S, not correlated with the 16 S peak. Isolated 18 S and 28 S rRNA had very low activity.The experiments suggest that in Artemia cysts an appreciable amount of messengerlike RNA is associated with mitochondria and/or endoplasmic vesicles carrying ribosomal monomers.     

Evidence of a store of informational RNA in encysted embryos of Artemia salina

RNA prepared from dormant cysts and developmental stages of the brine shrimp Artemia salina stimulated the incorporation of ¹⁴C-leucine into polypeptide by a cell-free Escherichia coli system. Preparations from cysts were about as active as those from hatching embryos or nauplii. When analysed by density gradient centrifugation the activity of cyst RNA showed a heterodisperse distribution, not quantitatively related to the absorbance profile. These results and evidence from similar experiments with crude ribosome preparations indicated that the contribution of 18S and 28S ribosomal RNA to the template-like activity was fairly limited. The experiments suggest that RNA with latent messenger activity is present in Artemia cysts during the resting stage.