The cAMP responsive element and CREB partially mediate the response of the tyrosine hydroxylase gene to phorbol ester

Tyrosine hydroxylase (TH) gene promoter activity is increased in PC12 cells that are treated with the phorbol ester, 12-O-tetradecanoylphorbol 13-acetate (TPA). Mutagenesis of either the cAMP responsive element (CRE) or the activator protein-1 element (AP1) within the TH gene proximal promoter leads to a dramatic inhibition of the TPA response. The TH CRE and TH AP1 sites are also independently responsive to TPA in minimal promoter constructs. TPA treatment results in phosphorylation of cAMP responsive element binding protein (CREB) and activation of cAMP-dependent protein kinase (PKA) in PC12 cells; hence, we tested whether CREB and/or PKA are essential for the TPA response. In CREB-deficient cells, the response of the full TH gene proximal promoter or the independent response of the TH CRE by itself to TPA is inhibited. The TPA-inducibility of TH mRNA is also blocked in CREB-deficient cells. Expression of the PKA inhibitor protein, PKI, also inhibits the independent response of the TH CRE to TPA. Our results support the hypothesis that TPA stimulates the TH gene promoter via signaling pathways that activate either the TH AP1 or TH CRE sites. Both signaling pathways are dependent on CREB and the TH CRE-mediated pathway is dependent on PKA.     

Gene expression alterations of human peripheral blood monocytes induced by medium-term treatment with the TH2-cytokines interleukin-4 and -13

The TH2-cytokines interleukins-4 and -13 severely alter gene expression of monocytic cells. We quantified the impact of interleukins-4 and -13 on the gene expression pattern of human peripheral blood monocytes applying a strategy that involved microarray hybridization, RT-PCR, immunohistochemistry and activity assays. After 3 days of continuous cytokine exposure the six most strongly upregulated gene products (15-lipoxygenase-1, fibronectin, monoamine oxidase-A, CD1c, CD23A, coagulation factor XIII) included four proteins with potential anti-inflammatory properties: (i) 15-lipoxygenase-1 (290-fold upregulation), (ii) fibronectin (180-fold upregulation), (iii) monoamine oxidase-A (56-fold upregulation) and (iv) coagulation factor XIII (35-fold upregulation). In addition, a number of other gene products, the expression of which is consistent with inflammatory resolution (annexin 1, collagen 1alpha2, laminin alpha5, TIMP3, heme oxygenase-1, CCL22, heat shock protein A8), were upregulated to a lower extent. In contrast, expression of classical pro-inflammatory gene products, such as tumor necrosis factor alpha, monocyte chemotactic protein-1, interleukins-1, -6, -8, -18, cyclooxygenase-2, as well as enzymes and receptors of the leukotriene cascade (5-lipoxygenase, 5-lipoxygenase activating protein, leukotriene B(4) receptor, cysteinyl leukotriene receptor 2) were significantly downregulated. These data suggest that medium-term treatment of human peripheral blood monocytes with interleukins-4/13 alters the gene expression pattern so that the cells might adopt a resolving phenotype.     

Phorbol ester regulation of the human gamma-glutamyltransferase gene promoter

In the present study the molecular mechanisms underlying tetradecanoylphorbol-13-acetate (TPA) mediated regulation of the human gamma-glutamyltransferase (GGT) gene were examined. TPA challenge of HeLa cells resulted in an increase of GGT mRNA and enzyme activity. Deletion analysis of the promoter revealed that the -348 to +60 fragment was able to mediate TPA induced expression. Gel shift and supershift analyses showed that TPA treatment increased nuclear protein binding to a putative AP-1 site (-225 to -214) and that c-Jun was part of the complex. This AP-1 element, when cloned either in its native arrangement or as tandem repeat 5' of the minimal thymidine kinase promoter, mediated a significant increase of luciferase activity after TPA treatment of transfected HeLa cells, while its mutated counterpart abolished the induction. The same AP-1 element was able to mediate TPA induced expression in HepG2 cells. Collectively these results indicate that like other GSH metabolising enzymes, GGT too is a target for AP-1 mediated regulation.     

Immunoregulatory effects of freeze injured whole tumour cells on human dendritic cells using an in vitro cryotherapy model

Tumour cryotherapy has been described as both immunostimulatory and immunoinhibitory in previous studies. However, previous studies have not accurately reproduced the precise conditions of current clinical cryotherapy. The objective of this study is to assess the immunological effects of cryotreated whole tumour cells on dendritic cells (DC) maturation and function using an in vitro model. Prostate cancer cells were cooled using Endocare cryo-system to mimic temperatures achieved during clinical cryotherapy. Human DC were prepared from cluster of differentiation (CD) 14 monocytes and matured with lipopolysaccharide (LPS). Cryotreated cancer cells were added to DC on day 3. On day 7, DC were harvested and phenotyped. Cytokine gene expression was assessed using real time quantitative polymerase chain reaction (RT-PCR). Functional activity of DC was assessed in allogenic mixed lymphocyte reaction (MLR) and the molecular changes using gene microarray technology. There was statistically significant upregulation of costimulatory molecules and maturation markers (CD86, CD83, CD80 and CL II) in DC loaded with cryotreated whole tumour cells compared to both control DC and DC matured with LPS (P < 0.001). There was a significant increase in stimulatory cytokines gene expression (IL-2, IL-12, IL-15, IL-18 and IFN-γ). However, IL-10 and TGF-β expression reduced significantly. The effect of different freezing temperature was equal. cDNA microarray analysis showed upregulation of interleukin 1 (IL-1) and cycline dependent kinase inhibitor 1A (CDKN1A (p21) and downregulation of Caspase 8 and BCL2. Overall, our findings suggest that the effect of cryotherapy is generally stimulatory to DC which may enhance anti-tumour effects. Therefore, the combination of cryotherapy and DC vaccine may represent a novel method to increase the efficacy of cryotherapy especially at the peripheral zones of the prostate where cells are exposed to sub-lethal temperature.     

Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.