The nucleotide sequence of ribosomal 5S RNA from Rhizobium meliloti: comparison with 5S rRNA of Agrobacterium

The complete nucleotide sequence of R. meliloti 5S ribosomal RNA has been determined and compared with the already known sequence of A. tumefaciens 5S rRNA (Vandenberghe et al., 1985, Eur. J. Biochem., 149, 537-542) and of other 5S rRNAs from Rodobacteria Alpha-2 (Wolters et al., 1988, Nucleic Acids Res., 16, rl-r70). The differences found at eight positions (23, 73, 83, 72 in helical fragments; 16, 40, 88 in loops; 54 in bulge), which might affect secondary structures of 5S rRNA, are small. Moreover, the sequence analysis specifies both variable and common positions in 5S rRNA secondary structure of Rodobacteria Alpha-2.     

Structural studies of 5 S ribosomal RNAs from a thermophilic fungus, Thermomyces lanuginosus. A comparison of generalized models for eukaryotic 5 S RNAs

The cytoplasmic ribosomes of the thermophilic fungus Thermomyces lanuginosus contain two types of 5 S RNA. The nucleotide sequence for approximately 80% of the molecules is (pp)pA-C-A-U-G-C-G-A-C-C-A-U-A-G-G-G-U-G-U-G-G-A-A-A-A-C-A-G-G-G-C-U-U-C-C-C-G-U-C-C-G-C-U-C-A-G-C-C-G-U-A-C-U-U-A-A-G-C-C-A-C-A-C-G-C-C-G-G-C-U-G-G-U-U-A-G-U-A-G-U-U-G-G-G-U-G-G-G-U-G-A-C-C-A-C-C-A-G-C-G-A-A-U-C-C-C-A-G-C-U-G-U-U-G-C-A-U-G-UOH. The remainder contains two nucleotide substitutions, C19 and G60, which preserve base complementarity. The secondary structure was probed using partial T1, pancreatic, and S1 nuclease digestion under a variety of ionic and temperature conditions and fragments were analyzed by rapid gel sequencing techniques. The results support the Y-shaped secondary structure model originally proposed by Nishikawa, K., and Takemura, S. (1974) FEBS Lett. 40, 106-109, for eukaryotic 5 S RNAs. When the thermal denaturation profile was compared with that of the yeast 5 S RNA, the thermophilic RNA exhibited not only a higher Tm but also an unusual decline in absorbency at moderate temperatures. This suggests that a functionally important structure may be maintained only at higher temperatures.     

Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat.     

5S RNA structure and interaction with transcription factor A. 1. Ribonuclease probe of the structure of 5S RNA from Xenopus laevis oocytes

The structure of Xenopus laevis oocyte (Xlo) 5S ribosomal RNA has been probed with single-strand-specific ribonucleases T1, T2, and A with double-strand-specific ribonuclease V1 from cobra venom. The digestion of 5'- or 3'-labeled renatured 5S RNA samples followed by gel purification of the digested samples allowed the determination of primary cleavage sites. Results of these ribonuclease digestions provide support for the generalized 5S RNA secondary structural model derived from comparative sequence analysis. However, three putative single-stranded regions of the molecule exhibited unexpected V1 cuts, found at C36, U73, U76, and U102. These V1 cuts reflect additional secondary structural features of the RNA including A.G base pairs and support the extended base pairing in the stem containing helices IV and V which was proposed by Stahl et al. [Stahl, D. A., Luehrsen, K. R., Woese, C. R., & Pace, N. R. (1981) Nucleic Acids Res. 9, 6129-6137]. A conserved structure for helix V having a common unpaired uracil residue at Xlo position 84 is proposed for all eukaryotic 5S RNAs. Our results are compared with nuclease probes of other 5S RNAs.     

Sequences of the 5S rRNAs of Azotobacter vinelandii, Pseudomonas aeruginosa and Pseudomonas fluorescens with some notes on 5S RNA secondary structure

Recently published alignments of available 5 S rRNA sequences have shown that a rigid base pairing pattern, pointing to the existence of a universal five-helix secondary structure for all 5 S RNAs, can be superimposed on such alignments. For a few species, the alignment and the base pairing pattern show distortions with respect to the large majority of sequences. Their 5 S RNAs may form exceptional secondary structures, or there may just be errors in the published sequences. We have examined such a case, Pseudomonas fluorescens, and found the sequence to be in error. The corrected sequence, as well as those of the related species Azotobacter vinelandii and Pseudomonas aeruginosa, fit perfectly in the 5 S RNA sequence alignment and in the five-helix secondary structure model. There exists comparative evidence for the frequent presence of non-standard base pairs at several points of the 5 S RNA secondary structure.     

Sequence analysis and in vitro maturation of five precursor 5S RNAs from Bacillus Q.

Bacillus Q, which is closely related to B. subtilis, contains at least six different precursors of 5S rRNA. The complete nucleotide sequences of four of these precursors, as well as the major part of the sequence of a fifth one, have been determined. They all contain the same 5'-terminal non-conserved segment which is to a large degree homologous with the corresponding segment of the B. subtilis p5S RNAs (Sogin, M.L., Pace, N.R., Rosenberg, M., Weissman, S.M. (1976) J. Biol. Chem. 251, 3480-3488). On the other hand the 3'-terminal non-conserved sequences of the various Bacillus Q precursors show considerable differences both in length and in nucleotide sequence, while there is also little or no homology with the 3'-terminal non-conserved sequence of the B. subtilis precursors. Bacillus Q p5S RNAs do not possess tetranucleotide repeats around the sites which are cleaved during maturation, as does B. subtilis p5S RNA. Like in B. subtilis, however, the cleavage sites are contained within a double-helical region of the precursor molecules. Crude RNAse M5 isolated from various Bacillus strains can maturate the Bacillus Q p5S RNAs with high efficiency. Despite considerable differences in primary structure between the precursors from the various strains, each RNAs M5 preparation can maturate all these precursors with about the same efficiency.     

Sequences of the 5S rRNAs of the thermo-acidophilic archaebacterium Sulfolobus solfataricus (Caldariella acidophila) and the thermophilic eubacteria Bacillus acidocaldarius and Thermus aquaticus.

We have determined the nucleotide sequences of the 5 S rRNAs of three thermophilic bacteria: the archaebacterium Sulfolobus solfataricus, also named Caldariella acidophila, and the eubacteria Bacillus acidocaldarius and Thermus aquaticus. A 5 S RNA sequence for the latter species had already been published, but it looked suspect on the basis of its alignment with other 5 S RNA sequences and its base-pairing pattern. The corrected sequence aligns much better and fits in the universal five helix secondary structure model, as do the sequences for the two other examined species. The sequence found for Sulfolobus solfataricus is identical to that determined by others for Sulfolobus acidocaldarius. The secondary structure of its 5 S RNA shows a number of exceptional features which distinguish it not only from eubacterial and eukaryotic 5 S RNAs, but also from the limited number of archaebacterial 5 S RNA structures hitherto published. The free energy change of secondary structure formation is large in the three examined 5 S RNAs.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules, we were able to distinguish between primary and secondary cutting positions and also to establish the relative degree of cutting. The data reveal the predicted similarities of the higher order structure in the two RNAs but also demonstrate a few significant differences. The data also provide direct evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18.     

A unique secondary folding pattern for 5S RNA corresponds to the lowest energy homologous secondary structure in 17 different prokaryotes.

A general secondary structure is proposed for the 5S RNA of prokaryotic ribosomes, based on helical energy filtering calculations. We have considered all secondary structures that are common to 17 different prokaryotic 5S RNAs and for each 5S sequence calculated the (global) minimum energy secondary structure (300,000 common structures are possible for each sequence). The 17 different minimum energy secondary structures all correspond, with minor differences, to a single, secondary structure model. This is strong evidence that this general 5S folding pattern corresponds to the secondary structure of the functional 5S rRNA. The general 5S secondary structure is forked and in analogy with the cloverleaf of tRNA is named the "wishbone" model. It constant 8 double helical regions; one in the stem, four in the first, or constant arm, and three in the second arm. Four of these double helical regions are present in a model earlier proposed (1) and four additional regions not proposed by them are presented here. In the minimum energy general structure, the four helices in the constant arm are exactly 15 nucleotide pairs long. These helices are stacked in the sequences from gram-positive bacteria and probably stacked in gram-negative sequences as well. In sequences from gram-positive bacteria the length of the constant arm is maintained at 15 stacked pairs by an unusual minimum energy interaction involving a C26-G57 base pair intercalated between two adjacent helical regions.     

Structure-function relationship of Rous sarcoma virus leader RNA.

Cells infected by RSV synthesize viral 35S RNA as well as subgenomic 28S and 22S RNAs coding for the Env and Src genes respectively. In addition, at least the 5' 101 nucleotides of the leader are also conserved and we have shown previously that this sequence contains a strong ribosome binding site (J.-L. Darlix et al., J. Virol. 29, 597). We now report the RNA sequence of Rous Sarcoma virus (RSV) leader RNA and propose a folding of this 5' untranslated region which brings the Cap, the initiation codon for Gag and the strong ribosome binding site close to each other. We also show that ribosomes protect a sequence just upstream from initiator Aug of Gag in vitro, and believed to interact with part of the strong ribosome binding site according to the folding proposed for the leader RNA.     

The structure of the 5 S ribosomal RNA of a member of the phylum of green non-sulfur bacteria and relatives

The 5 S rRNA sequence was determined for the bacterium Herpetosiphon strain Senghas Wie 2. It is the first 5 S RNA sequence reported for a member of the eubacterial phylum defined by green non-sulfur bacteria. The sequence fits into a consensus secondary structure model for eubacterial 5 S RNA. At four positions, the sequence shows substitutions with respect to strongly conserved nucleotides found in other hitherto examined eubacterial 5 S RNAs.     

Nucleotide sequences of Acanthamoeba castellanii 5S and 5.8S ribosomal ribonucleic acids: phylogenetic and comparative structural analyses.

Sequences of 5S and 5.8S rRNAs of the amoeboid protist Acanthamoeba castellanii have been determined by gel sequencing of terminally-labeled RNAs which were partially degraded with chemical reagents or ribonucleases. The sequence of the 5S rRNA is (formula, see text). This sequence is compared to eukaryotic 5S rRNA sequences previously published and fitted to a secondary structure model which incorporates features of several previously proposed models. All reported eukaryotic 5S rRNAs fit this model. The sequence of the 5.8S rRNA is (formula, see text). This sequence does not fit parts of existing secondary structure models for 5.8S rRNA, and we question the significance of such models.     

Functional characterization of eukaryotic mRNA cap binding protein complex: effects on translation of capped and naturally uncapped RNAs

We examined the effects of a eukaryotic mRNA cap binding protein (CBP) complex purified by cap analogue affinity chromatography [Edery, I., Humebelin, M., Darveau, A., Lee, K.A. W., Milburn, S., Hershey, J.W.B., Trachsel, H., & Sonenberg, N. (1983) J. Biol. Chem. 258, 11398 11403], on translation of several capped and naturally uncapped mRNAs in extracts prepared from poliovirus-infected or mock-infected HeLa cells. The CBP complex has activity that restores capped mRNA (globin, tobacco mosaic virus, and others) function in extracts from poliovirus-infected HeLa cells. Translation of two naturally uncapped RNAs (poliovirus and mengovirus RNAs), the translation of which is not restricted in extracts from poliovirus-infected cells, is also not stimulated by the CBP complex. Translation of several capped eukaryotic mRNAs (vesicular stomatitis virus, reovirus, and tobacco mosaic virus) in extracts from mock-infected cells is inhibited when the potassium ion concentration is increased. However, translation of capped AMV-4 RNA, which has negligible secondary structure at its 5' end, is resistant to this inhibition. Furthermore, the CBP complex reverses the high salt induced inhibition of translation of the former mRNAs. Since mRNA secondary structure is more stable at elevated salt concentrations, these data are consistent with a model in which the CBP complex has a role in melting mRNA secondary structure involving 5'-proximal sequences, to facilitate ribosome binding.     

The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum

The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated. A combination of in vitro and in vivo labelling techniques was used. The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified. The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions). The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs. The invariable GAAC sequence is found starting at position 45. When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R. rubrum 5S RNA. However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure. The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria.     

Two 5S genes are expressed in chicken somatic cells.

Two 5S RNA species were detected in chicken cells. 5S I RNA has the nucleotide sequence of chicken 5S RNA previously published by Brownlee et al. (1) and 5S II RNA differs from it by 10 mutations. The secondary structure of both species is compatible with that proposed for other eukaryotic 5S RNAs. 5S II RNA represents 50-60% of 5S I RNA. Both species were found in total chicken liver and brain and were present in polysomes in the same relative proportions. Only one 5S RNA species could be detected in rat liver and HeLa cells. Chicken is the first vertebrate described so far in which two 5S RNA genes are expressed in somatic cells.     

The topology of bulges in the long stem of the flavivirus 3' stem-loop is a major determinant of RNA replication competence

All flavivirus genomes contain a 3'terminal stem-loop secondary structure (3'SL) formed by the most downstream approximately 100 nucleotides (nt) of the viral RNA. The 3'SL is required for virus replication and has been shown to bind both virus-coded and cellular proteins. Results of the present study using an infectious DNA for WN virus strain 956 initially demonstrated that the dengue virus serotype 2 (DEN2) 3'SL nucleotide sequence could not substitute for that of the WN 3'SL to support WN genome replication. To determine what WN virus-specific 3'SL nucleotide sequences were required for WN virus replication, WN virus 3'SL nucleotide sequences were selectively deleted and replaced by analogous segments of the DEN2 3'SL nucleotide sequence such that the overall 3'SL secondary structure was not disrupted. Top and bottom portions of the WN virus 3'SL were defined according to previous studies (J. L. Blackwell and M. A. Brinton, J. Virol. 71:6433-6444, 1997; L. Zeng, L., B. Falgout, and L. Markoff, J. Virol. 72:7510-7522, 1998). A bulge in the top portion of the long stem of the WN 3'SL was essential for replication of mutant WN RNAs, and replication-defective RNAs failed to produce negative strands in transfected cells. Introduction of a second bulge into the bottom portion of the long stem of the wild-type WN 3'SL markedly enhanced the replication competence of WN virus in mosquito cells but had no effect on replication in mammalian cells. This second bulge was identified as a host cell-specific enhancer of flavivirus replication. Results suggested that bulges and their topological location within the long stem of the 3'SL are primary determinants of replication competence for flavivirus genomes.