Chromosomal localization of the human and mouse histidine decarboxylase genes by in situ hybridization. Exclusion of the HDC gene from the Prader-Willi syndrome region

Using a rat histidine decarboxylase (HDC) cDNA probe, we have mapped the HDC gene by in situ hybridization to the ql5–q2l region of human chromosom e15 and to the E5-G region of murine chromosome 2. These localizations strengthen a syntenic group conserved between human chromosome 15 and mouse chromosome 2. The localization of the HDC gene on the human chromosome 15 map shows that it is not included within the Prader-Willi Syndrome region (PWCR).     

The Histidine Decarboxylase (HDC) Gene of Tetrahymena Pyriformis is Similar to the Mammalian One. A Study of HDC Expression

RNA was isolated from Tetrahymena pyriformis GL and using human histidine decarboxylase (HDC) gene primers, the RT-PCR product was sequenced. A fraction containing 207 base pairs was compared to the published sequences of prokaryotic and mammalian (rat, mouse and human) HDC cDNA (exons). The HDC-cDNA fraction of Tetrahymena was similar to the mammalian cDNA-s and it was completely different from the prokaryotic HDC-gene. The results indicate the presence of a mammalian-like HDC-gene already in a unicellular eukaryote organism and demonstrates also that the divergence of the prokaryotic–eukaryotic common gene took place already at this low evolutionary level.     

cDNA-derived amino acid sequence of L-histidine decarboxylase from mouse mastocytoma P-815 cells

The primary structure of L-histidine decarboxylase (HDC: L-histidine carboxy-lyase, EC 4.1.1.22) from mouse mastocytoma P-815 cells has been determined by parallel analysis of the amino acid sequence of the protein and the nucleotide sequence of the corresponding cDNA. HDC contains 662 amino acid residues with a molecular mass of 74017, which is larger by about 21,000 Da than that of the previously purified HDC subunit (53 kDa), suggesting that HDC might be posttranslationally processed. The HDC cDNA hybridized to a 2.7 kilobase mRNA of mastocytoma cells. Homology was found between the sequences of mouse mastocytoma HDC and fetal rat liver HDC.     

The human ASM (adult skeletal muscle) gene: expression and chromosomal assignment to 11p15

A rat adult skeletal muscle probe (Asm15) originated from a rhabdomyosarcoma was used to isolate the human homologous sequence from a placenta cDNA library. Among several positive clones the longest EcoRI-EcoRI insert (ASM1) obtained was 1875 bp long with 72% homology with rat Asm15 cDNA sequence. Important variations of ASM1 RNA level were observed in different adult skeletal muscles. Expression of a 29kD ASM1 protein was demonstrated in human adult skeletal muscle lysates using an antiserum (PB1579) raised against the C terminal region of the rat Asm15 protein. The human ASM gene was assigned by somatic cell analysis with human (ASM1) and rat (Asm15) probes to chromosome 11, and by in situ hybridization with the human probe to 11p15, a chromosome region involved in human embryonal rhabdomyosarcomas. Except for the presence of a HindII restriction site, the results obtained for the restriction map and the sequence of ASM1 cDNA (data not shown) exhibited extensive homology with the human H19 DNA sequence which have been mapped with a mouse probe also in 11p15. This suggests that ASM/Asm and H19 may represent the same sequence (in this hypothesis the presence of the supplementary HindII site in our ASM1 probe is explained by polymorphic variability). However it was reported that human and mouse H19 mRNA did not encode for a protein but acted as an RNA molecule whereas in our present study ASM protein was detected in human adult skeletal muscle. This could be explained by important regulation of ASM protein expression during development and cell differentiation. However we cannot exclude for the different species studied (mouse, rat, and man) the hypothesis that H19 and ASM/Asm mRNA may represent two distinct messengers from the same gene or even from duplicated genes.     

Immuno-cross-reactivity of histidine and dopa decarboxylases

Immuno-cross-reactivity between histidine decarboxylase (HDC) and dopa decarboxylase (DDC) was investigated. By comparing the cDNA sequences of rat HDC with rat and guinea-pig DDCs, we found a region that may possibly be related to the cross-reactivity of anti-rat HDC antibody with guinea-pig DDC. The peptide encoded by this region was synthesized and anti-peptide antibody was prepared. We also purified HDC and DDC homogeniously from fetal rat liver and guinea-pig liver, respectively. On immunoblotting, anti-peptide antibody recognized both rat HDC and guinea-pig DDC. Anti-HDC polyclonal antibody which also recognizes both enzymes detected only rat HDC when it was absorbed by the peptide. This result indicates that this region is responsible for the immuno-cross-reactivity of anti-rat HDC antibody with guinea-pig DDC.     

A regulatory locus,Hdc-e,determines the response of mouse kidney histidine decarboxylase to estrogen

Levels of histidine decarboxylase (HDC; EC 4.1.1.22) activity in female mouse kidney are modulated by estrogen (administered as implanted pellets). In some inbred strains HDC activity is induced by estrogen, while in others the enzyme is repressed. Immunoprecipitation with an anti-fetal rat HDC antiserum has shown that induction and repression of HDC levels are due to changes in enzyme concentration. Segregation analysis has identified a single additively inherited regulatory locus, Hdc-e, which determines the response to estrogen. The allele Hdc-eb (C57BL/10) determines induction, and the allele Hdc-ed (DBA/2) determines repression. Preliminary evidence indicates cosegregation of Hdc-e alleles with alleles of another regulatory locus, Hdc-c (determining kidney HDC concentration), and therefore putative linkage of Hdc-e with the HDC gene complex on chromosome 2. This is the first report of a mammalian regulatory gene controlling two opposite mechanisms, induction and repression in response to a single effector.     

HDC gene polymorphisms are associated with age at natural menopause in Caucasian women

Histidine decarboxylase gene (HDC) encodes histidine decarboxylase which is the crucial enzyme for the biosynthesis of histidine. Studies have shown that histamine is likely to be involved in the regulation of reproduction system. To find the possible correlation between HDC gene and AANM (age at natural menopause), we selected 265 postmenopausal women from 131 nuclear families and performed a transmission disequilibrium test. Significant within-family associations with AANM for SNP rs854163 and SNP rs854158 of HDC gene were observed (P values=0.0018 and 0.0197, respectively). After 1000 permutations, SNP rs854163 still remained significant within-family association with AANM. Consistently, we also detected a significant within-family association between haplotype block 2 (defined by SNP rs854163 and rs860526) and AANM in the haplotype analyses (P value=0.0397). Our results suggest that the HDC gene polymorphisms are significantly associated with AANM in Caucasian women.     

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.     

The GABAA receptor beta 3 subunit gene: characterization of a human cDNA from chromosome 15q11q13 and mapping to a region of conserved synteny on mouse chromosome 7.

A cDNA encoding the human GABAA receptor beta 3 subunit has been isolated from a brain cDNA library and its nucleotide sequence has been determined. This gene, GABRB3, has recently been mapped to human chromosome 15q11q13, the region deleted in Angelman and Prader-Willi syndromes. The association of distinct phenotypes with maternal versus paternal deletions of this region suggests that one or more genes in this region show parental-origin-dependent expression (genetic imprinting). Comparison of the inferred human beta 3 subunit amino acid sequence with beta 3 subunit sequences from rat, cow, and chicken shows a very high degree of evolutionary conservation. We have used this cDNA to map the mouse beta 3 subunit gene, Gabrb-3, in recombinant inbred strains. The gene is located on mouse chromosome 7, very closely linked to Xmv-33 between Tam-1 and Mtv-1, where two other genes from human 15q11q13 have also been mapped. This provides further evidence for a region of conserved synteny between human chromosome 15q11q13 and mouse chromosome 7. Proximal and distal regions of mouse chromosome 7 show genetic imprinting effects; however, the region of homology with human chromosome 15q11q13 has not yet been associated with these effects.     

In vitro study of proteolytic degradation of rat histidine decarboxylase.

Mammalian ornithine decarboxylase (ODC) is a very unstable protein which is degraded in an ATP-dependent manner by proteasome 26S, after making contact with the regulatory protein antizyme. PEST regions are sequences described as signals for protein degradation. The C-terminal PEST region of mammalian ODC is essential for its degradation by proteasome 26S. Mammalian histidine decarboxylase (HDC) is also a short-lived protein. The full primary sequence of mammalian HDC contains PEST-regions at both the N- and C-termini. Rat ODC and different truncated and full versions of rat HDC were expressed in vitro. In vitro degradation of rat ODC and rat 1-512 HDC were compared. Like ODC, rat 1-512 HDC is degraded mainly by an ATP-dependent mechanism. However, antizyme has no effect on the degradation of 1-512 HDC. The use of the inhibitors MG-132 and lactacystine significantly inhibited the degradation of 1-512 HDC, suggesting that a ubiquitin-dependent, proteasome 26S proteolytic pathway is involved. Results obtained with the different modifications of rat HDC containing all three PEST regions (full version, 1-656 HDC), only the N-terminal PEST region (1-512 HDC), or no PEST region (69-512 HDC), indicate that the N-terminal (1-69) fragment, but not the C-terminal fragment, determines that the HDC protein is a proteasome substrate in vitro.     

Cloning and characterization of a cDNA that encodes a 70-kDa novel human thyroid autoantigen

cDNA clones were isolated by screening a human thyroid carcinoma lambda gt11 library with immunoglobulins purified from serum of a patient with autoimmune Graves' disease. One clone (ML8) containing a 1.25-kilobase (kb) insert hybridized with a single 2.0-kb poly(A+) mRNA in human thyroid and lymphocytes but not in human brain, liver, kidney, or muscle. In addition, this probe also hybridized with a single 2.0-kb poly(A+) mRNA from a rat thyroid cell line (FRTL-5). An apparently full length 2,074-base pair (bp) human cDNA was obtained and sequenced. The nucleotide sequence of the 2,074-bp cDNA includes a 5'-noncoding sequence of 17 bp, a 1827-bp open reading frame, and a 222-bp 3'-noncoding sequence. The canonical polyadenylation signal AATAAA is present 18 bp upstream of the poly(A) tail. This cDNA encodes a 69,812-dalton protein with two potential N-linked glycosylation sites and at least one potential membrane spanning domain. Immunoprecipitation of the in vitro translated protein by sera from several patients with Graves' disease argues that the 69,812-dalton protein is an autoantigen.     

Regulation of hdc expression and HDC activity by enological factors in lactic acid bacteria

Aims: The aim of this work was to study the influence of enological factors on the histidine decarboxylase gene (hdc) expression and on histidine decarboxylase enzyme (HDC) activity in Lactobacillus hilgardii, Pediococcus parvulus and Oenococcus oeni. Methods and Results: Cell extracts and whole cells were used. Glucose, fructose, malic acid and citric acid diminished the hdc expression. Ethanol did not increase hdc expression or activity in cells, but increased HDC activity. Temperature and pH had effect on the activity of HDC but not on hdc expression. Tartaric acid and l -lactic acid, and sulphur dioxide (SO₂) had no effect on enzyme synthesis and activity. Bacterial species differ in the relative enzymatic activity but all the factors affected similarly to L. hilgardii, P. parvulus and O. oeni. Conclusions: The hdc gene expression was lowered by glucose, fructose, malic acid, and citric acid, whereas ethanol enhanced the HDC enzyme activity. The conditions that normally occur during malolactic fermentation and later on, could favour histamine production. SO₂ could prevent bacterial growth, but does not diminish the HDC enzyme activity. Significance and Impact of the Study: Information on hdc expression and HDC activity can contribute to the prevention of histamine formation during wine production and storage.     

cDNA cloning and mapping of the human creatine kinase M gene to 19q13

We describe the first isolation of a human creatine kinase M cDNA clone and its mapping of the gene to human chromosome 19. A human creatine kinase M cDNA clone, pJN2CK-M, harboring a 1,160-bp insert, was isolated by colony hybridization with a previously sequenced chicken creatine kinase M cDNA probe. The human cDNA was used as a probe in Southern transfers of TaqI-digested genomic DNA from mouse/human somatic-cell hybrids to localize the human creatine kinase-M gene to chromosome 19. In situ hybridization of the tritiated cDNA probe to metaphase chromosomes of peripheral blood lymphocytes from normal males revealed significant labeling to chromosome 19. These two independent methodologies assign the human creatine kinase-M gene to chromosome 19. Since greater than 69% of the grains of chromosome 19 label band q13, the human creatine kinase-M gene has been mapped to 19q13. On the basis of high-resolution G-banding, the predominant labeling site was 19q13.2-q13.3.