Primordia Vita. Deconvolution from Modern Sequences.

Evolution of the triplet code is reconstructed on the basis of consensus temporal order of appearance of amino acids. Several important predictions are confirmed by computational sequence analyses. The earliest amino acids, alanine and glycine, have been encoded by GCC and GGC codons, as today. They were succeeded, respectively, by A- and G-series of amino acids, encoded by pyrimidine-central and purine-central codons. The length of the earliest proteins is estimated to be 6–7 residues. The earliest mRNAs were short G+C-rich molecules. These short sequences could have formed hairpins. This is confirmed by analysis of modern prokaryotic mRNA sequences. Predominant size of detected ancient hairpins also corresponds to 6–7 amino acids, as above. Vestiges of last common ancestor can be found in extant proteins in form of entirely conserved short sequences of size six to nine residues present in all or almost all sequenced prokaryotic proteomes (omnipresent motifs). The functions of the topmost conserved octamers are not involved in the basic elementary syntheses. This suggests an initial abiotic supply of amino acids, bases and sugars. Presented at: National Workshop on Astrobiology: Search for Life in the Solar System, Capri, Italy, 26 to 28 October, 2005.     

Evolution of the genetic code and earliest proteins. Reconstruction from the current sequences

One would expect that present-day protein sequences have changed many times during their evolution, at every point, so that there is no chance to recognize in the sequences any traces of their ancient organization. It turns out to be not true. Massive analysis of complete genomes of bacteria allows one to derive, according to very specific predictions, distinct features of very early sequences and to outline the history of evolution protein. Modern proteins appear to have evolved from short peptides of mixed sequences of two alphabet types. They were then closed to sequences of optimal size from which modern folds/domains and multidomain proteins were formed. The reconstruction of amino acid and codon chronology is described. A specific idea on the nature and evolutionary significance of gene splicing is suggested. The gene splicing, while obeying the rules of basic structural organization of proteins, offers accessibility to regions of sequence space that could not be reached by mutational changes typical for prokaryotes.     

Distinct Stages of Protein Evolution as Suggested by Protein Sequence Analysis

Evolution of proteins encoded in nucleotide sequences began with the advent of the triplet code. The chronological order of the appearance of amino acids on the evolution scene and the steps in the evolution of the triplet code have been recently reconstructed (Trifonov, 2000b) on the basis of 40 different ranking criteria and hypotheses. According to the consensus chronology, the pair of complementary GGC and GCC codons for the amino acids alanine and glycine appeared first. Other codons appeared as complementary pairs as well, which divided their respective amino acids into two alphabets, encoded by triplets with either central purines or central pyrimidines: G, D, S, E, N, R, K, Q, C, H, Y, and W (Glycine alphabet G) and A, V, P, S, L, T, I, F, and M (Alanine alphabet A). It is speculated that the earliest polypeptide chains were very short, presumably of uniform length, belonging to two alphabet types encoded in the two complementary strands of the earliest mRNA duplexes. After the fusion of the minigenes, a mosaic of the alphabets would form. Traces of the predicted mosaic structure have been, indeed, detected in the protein sequences of complete prokaryotic genomes in the form of weak oscillations with the period 12 residues in the form of alteration of two types of 6 residue long units. The next stage of protein evolution corresponded to the closure of the chains in the loops of the size 25–30 residues (Berezovsky et al., 2000). Autocorrelation analysis of proteins of 23 complete archaebacterial and eubacterial genomes revealed that the preferred distances between valine, alanine, glycine, leucine, and isoleucine along the sequences are in the same range of 25–30 residues, indicating that the loops are primarily closed by hydrophobic interactions between the ends of the loops. The loop closure stage is followed by the formation of typical folds of 100–200 amino acids, via end-to-end fusion of the genes encoding the loop-size chains. This size was apparently dictated by the optimal ring closure for DNA. In both cases the closure into the ring (loop) rendered evolutionarily advantageous stability to the respective structures. Further gene fusions lead to the formation of modern multidomain proteins. Recombinational gene splicing is likely to have appeared after the DNA circularization stage. Received: 21 December 2000 / Accepted: 28 February 2001     

Within-genome evolution of REPINs: a new family of miniature mobile DNA in bacteria

Repetitive sequences are a conserved feature of many bacterial genomes. While first reported almost thirty years ago, and frequently exploited for genotyping purposes, little is known about their origin, maintenance, or processes affecting the dynamics of within-genome evolution. Here, beginning with analysis of the diversity and abundance of short oligonucleotide sequences in the genome of Pseudomonas fluorescens SBW25, we show that over-represented short sequences define three distinct groups (GI, GII, and GIII) of repetitive extragenic palindromic (REP) sequences. Patterns of REP distribution suggest that closely linked REP sequences form a functional replicative unit: REP doublets are over-represented, randomly distributed in extragenic space, and more highly conserved than singlets. In addition, doublets are organized as inverted repeats, which together with intervening spacer sequences are predicted to form hairpin structures in ssDNA or mRNA. We refer to these newly defined entities as REPINs (REP doublets forming hairpins) and identify short reads from population sequencing that reveal putative transposition intermediates. The proximal relationship between GI, GII, and GIII REPINs and specific REP-associated tyrosine transposases (RAYTs), combined with features of the putative transposition intermediate, suggests a mechanism for within-genome dissemination. Analysis of the distribution of REPs in a range of RAYT-containing bacterial genomes, including Escherichia coli K-12 and Nostoc punctiforme, show that REPINs are a widely distributed, but hitherto unrecognized, family of miniature non-autonomous mobile DNA.     

MS2 RNA has a potential to form an unusually large number of stable hairpins

Several long nucleotide sequences were analysed to find out if any of them are unusual in terms of the possible formation of “hairpins” (pairs of complementary runs of nucleotides forming double-stranded structures) as compared to random sequences. The RNA of MS2 bacteriophage has more potential hairpins with short loops (up to 10 bases in a loop) than found in random sequences with the same length and base composition. Other analyzed nucleotide sequences (SV40, φX174, Fd and 16S rRNA) behaved very much as their corresponding random ones. Most of the extra hairpins of the MS2 RNA are estimated to be thermodynamically stable. These potential hairpins might play some role in the function of the MS2 RNA.     

Brain Size Growth and Life History in Human Evolution

Increases in endocranial volume (a measure of brain size) play a major role in human evolution. Despite the importance of brain size increase, the developmental bases of human brain size evolution remain poorly characterized. Comparative analyses of endocranial volume size growth illustrate that distinctions between humans and other primates are consequences of differences in rates of brain size growth, with little evidence for differences in growth duration. Evaluation of available juvenile fossils shows that earliest hominins do not differ perceptibly from chimpanzees (Pan). However, rapid and human-like early brain growth apparently characterized Homo erectus at about 1?Ma before present. Neandertals show patterns of brain growth consistent with modern humans during infancy, but reach larger sizes than modern humans as a result of differences in later growth. Growth analyses reveal commonalities in patterns of early brain size growth during the last million years human evolution, despite major increases in adult size. This result implies consistency across hominins in terms of maternal metabolic costs of infancy. Continued size growth past infancy in Neandertals and modern humans, when compared to earlier hominins, may have cognitive implications. Differences between Neandertals and modern humans are implied, but difficult to define with certainty.     

The secondary structure of mRNAs from Escherichia coli: its possible role in increasing the accuracy of translation.

A secondary structure model was proposed for mRNAs during translation (in a polysome) where the secondary structure is described by a set of small unbranched hairpins. Computer simulation experiments reveal that the number of hairpins is much greater (P less than 10(-6) in highly expressed mRNAs from E. coli as compared with the random sequences coding for the same amino acid sequence, i.e. certain synonymous codons are used in definite mRNA positions to increase the number of hairpins. No constraints on the amino acid sequence, which would affect the secondary structure of mRNAs, were found. The codons UGU, UGC (Cys), GCC (Ala), ACA, ACG (Thr), CCU, CCC (Pro), etc. translated by minor tRNAs were found to occur significantly more frequently in the position 5' to the hairpins than the other codons translated by major tRNAs (P less than 5.10(-6). This correlation leads to the hypothesis that the process of hairpin unfolding can increase the time of translocation from the A to P ribosome site of the codon 5' to the hairpin, thus decreasing the probability of translational error (the latter would likely occur more frequently in the codons translated by minor tRNAs).     

Evolution of olfaction in non-avian theropod dinosaurs and birds

Little is known about the olfactory capabilities of extinct basal (non-neornithine) birds or the evolutionary changes in olfaction that occurred from non-avian theropods through modern birds. Although modern birds are known to have diverse olfactory capabilities, olfaction is generally considered to have declined during avian evolution as visual and vestibular sensory enhancements occurred in association with flight. To test the hypothesis that olfaction diminished through avian evolution, we assessed relative olfactory bulb size, here used as a neuroanatomical proxy for olfactory capabilities, in 157 species of non-avian theropods, fossil birds and living birds. We show that relative olfactory bulb size increased during non-avian maniraptoriform evolution, remained stable across the non-avian theropod/bird transition, and increased during basal bird and early neornithine evolution. From early neornithines through a major part of neornithine evolution, the relative size of the olfactory bulbs remained stable before decreasing in derived neoavian clades. Our results show that, rather than decreasing, the importance of olfaction actually increased during early bird evolution, representing a previously unrecognized sensory enhancement. The relatively larger olfactory bulbs of earliest neornithines, compared with those of basal birds, may have endowed neornithines with improved olfaction for more effective foraging or navigation skills, which in turn may have been a factor allowing them to survive the end-Cretaceous mass extinction.     

Conservation versus variation of dinucleotide frequencies across genomes: Evolutionary implications

Background  

In order to find traits or evolutionary relics of the primordial genome (the most primitive nucleic acid genome for earth's life) remained in modern genomes, we have studied the characteristics of dinucleotide frequencies across genomes. As the longer a sequence is, the more probable it would be modified during genome evolution. For that reason, short nucleotide sequences, especially dinucleotides, would have considerable chances to be intact during billions of years of evolution. Consequently, conservation of the genomic profiles of the frequencies of dinucleotides across modern genomes may exist and would be an evolutionary relic of the primordial genome.     

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.     

Molecular evolution more than three billion years ago

The earlier stages of life evolution at the molecular level were reconstructed. A set of triplets incorporated into the earliest RNA molecules (mRNA) was determined. It is believed that tRNA is one of the descedants of the earliest protein-encoding sequences. It was shown that tRNA has a hidden periodic structure of base sequences that conforms to the rule (GNY)n, indicating it ancient age. A set of the earliest amino acids was established and their distribution with respect to age was made. It was shown that genomes were built from elementary units (primary genes) by recombination or binding some time prior to division into eukaryotes and prokaryotes. Mean dimensions of the elementary unit for eukaryotes and prokaryotes were determined.     

Oldest known pantherine skull and evolution of the tiger

The tiger is one of the most iconic extant animals, and its origin and evolution have been intensely debated. Fossils attributable to extant pantherine species-lineages are less than 2 MYA and the earliest tiger fossils are from the Calabrian, Lower Pleistocene. Molecular studies predict a much younger age for the divergence of modern tiger subspecies at <100 KYA, although their cranial morphology is readily distinguishable, indicating that early Pleistocene tigers would likely have differed markedly anatomically from extant tigers. Such inferences are hampered by the fact that well-known fossil tiger material is middle to late Pleistocene in age. Here we describe a new species of pantherine cat from Longdan, Gansu Province, China, Panthera zdanskyi sp. nov. With an estimated age of 2.55-2.16 MYA it represents the oldest complete skull of a pantherine cat hitherto found. Although smaller, it appears morphologically to be surprisingly similar to modern tigers considering its age. Morphological, morphometric, and cladistic analyses are congruent in confirming its very close affinity to the tiger, and it may be regarded as the most primitive species of the tiger lineage, demonstrating the first unequivocal presence of a modern pantherine species-lineage in the basal stage of the Pleistocene (Gelasian; traditionally considered to be Late Pliocene). This find supports a north-central Chinese origin of the tiger lineage, and demonstrates that various parts of the cranium, mandible, and dentition evolved at different rates. An increase in size and a reduction in the relative size of parts of the dentition appear to have been prominent features of tiger evolution, whereas the distinctive cranial morphology of modern tigers was established very early in their evolutionary history. The evolutionary trend of increasing size in the tiger lineage is likely coupled to the evolution of its primary prey species.     

Evolutionary aspects of protein structure and folding

Four basic stages of evolution of protein structure are described based on recent work of the authors targeted specifically on reconstruction of the earliest events in the protein evolution. According to this reconstruction, the initial stage of short peptides of, probably, only few amino-acid residues had been followed by formation of closed loops of the size 25-30 residues, which corresponds to the polymer-statistically optimal ring closure size for mixed polypeptide chains. The next stage involved fusion of the respective small linear genes and formation of protein structures consisting of several closed loops of the nearly standard size, up to 4-6 loops (100-200 amino acid residues) in a typical protein fold. The last, modern stage began with combinatorial fusion of the presumably circular 300-600 bp DNA units and, accordingly, formation of multidomain proteins.     

The earliest evidence of damselfly‐like endophytic oviposition in the fossil record

The reproductive strategy of insects of inserting eggs into plant tissue (endophytic oviposition) is known from the Late Carboniferous onwards. The earliest known ovipositional scars are large, that is up to 38 mm long, and irregular both in size and in shape, and they are not arranged in a regular pattern. Oviposition patterns resembling those of present‐day Odonata are first reported from the Late Palaeozoic. These egg cavities are generally of smaller size and have a regular oval shape. They are usually arranged in longitudinal rows or in a zigzag configuration. The most likely tracemakers were gracile damselfly‐like insects such as the Archizygoptera, a group closely related to modern Zygoptera. In this paper, the earliest evidence of endophytic oviposition resembling the ‘Coenagrionid Type’ of Odonatoptera is described. It derives from the Wettin member of the Siebigerode Formation of the Saale‐Basin in Central Germany (Upper Carboniferous, Gzhelian) and consists of about 49 elliptical scars with lengths of about 2 mm, probably deposited on a leaf of Cordaites. The arrangement of the scars in short transverse rows, their regular size and elliptical shape suggest that the tracemaker was probably a member of the extinct odonatopteran suborder Archizygoptera. If so, the tracefossil described here would be the earliest evidence for this endophytic oviposition in an ancestral group of modern Zygoptera.     

Evolutionary Aspects of Protein Structure and Folding

Four basic stages of evolution of protein structure are described, basing on recent work of the authors aimed specifically to reconstruct the earliest events in the protein evolution. According to this reconstruction, the initial stage of short peptides comprising, probably, only a few amino acid residues had been followed by formation of closed loops of 25–30 residues, which corresponds to the polymer-statistically optimal ring closure size for mixed polypeptide chains. The next stage involved fusion of relatively small linear genes and formation of protein structures consisting of several closed loops of a nearly standard size, with 4–6 loops (100–200 amino acid residues) in a typical protein fold. The last, modern stage began with combinatorial fusion of the presumably circular 300–600 bp DNA units and, accordingly, formation of multidomain proteins.     

Isolation and characterization of genomic clones covering the chicken vitellogenin gene

A series of overlapping recombinant clones, which cover the vitellogenin gene, has been isolated from a phage-lambda linked chicken gene library. The DNA of the overlapping clones spans 28 kb of contiguous DNA sequences in the chicken genome. Electron microscopic analysis of hybrids between vitellogenin mRNA and the genomic clones indicates that the chicken vitellogenin gene has a length of approximately 22 kb, about 3.8 times the size of the mRNA. The mRNA sequence is interrupted by at least 33 intervening sequences (introns). Comparison with the vitellogenin gene A2 from Xenopus laevis (Wahli et al., 1980, Cell 20: 107-117) indicates conservation of the number and length of the exons during evolution. Heteroduplex analysis reveals a short stretch of sequence homology between the genes from chicken and frog.     

Modelling the Transport of Nutrients in Early Animals

The single-celled ancestors of multi-cellular animals (metazoans) did not need to transport nutrients between cells, but this ability is vital for modern animals. How could intercellular nutrient transport have begun? And how did this influence the early evolution of animals? In this hypothesis, I suggest that nutrients could have passed directly between the cytoplasm of conjoined cells in early compacted cell-balls, along the plane of the closed epithelium. This would have limited early animals to the size and form of modern embryos. The mechanisms that indirectly transport nutrients between discrete cells, via the extracellular fluid within the body-space, are modelled to have evolved sequentially; so comparison of nutrient transport processes could provide evidence of any early divergences of phyla. When the last of the indirect intercellular transport processes for essential nutrients had been developed, the extracellular fluid within the body-space would have contained all necessary nutrients. Then the epithelium could have greatly expanded, and cells lived and divided within the body-space. This development of nutrient transport processes would have enabled animals to greatly increase in size and complexity.     

Control of transgenesis in higher cells: the procell transposon Tn10 TetR mRNA has several major hairpins and can be unstable in eucells.

The TetR regulatory gene from the transposon Tn10 has some excellent characteristics for transgenic control in higher cells. However, we experienced severe problems with mRNA instability for this gene in eucells (CHO cells). This may be connected with the existence within the Tn10 TetR mRNA of several sizeable hairpins. They resemble canonical RNase E sites for mRNA destabilisation in procells and possibly also in eucells. Two of the hairpins also included sequences resembling eucell hnRNA polyadenylation or processing signals. The TetR counterpart from the plasmid RA1 appears to have less of the hairpin secondary structure; perhaps because of this, it did not present these mRNA instability problems in CHO cells, and it may prove a valuable alternative for transgene control in gene therapy and biotechnology.