Analysis of the 10q11 cancer risk locus implicates MSMB and NCOA4 in human prostate tumorigenesis

Genome-wide association studies (GWAS) have established a variant, rs10993994, on chromosome 10q11 as being associated with prostate cancer risk. Since the variant is located outside of a protein-coding region, the target genes driving tumorigenesis are not readily apparent. Two genes nearest to this variant, MSMB and NCOA4, are strong candidates for mediating the effects of rs109939934. In a cohort of 180 individuals, we demonstrate that the rs10993994 risk allele is associated with decreased expression of two MSMB isoforms in histologically normal and malignant prostate tissue. In addition, the risk allele is associated with increased expression of five NCOA4 isoforms in histologically normal prostate tissue only. No consistent association with either gene is observed in breast or colon tissue. In conjunction with these findings, suppression of MSMB expression or NCOA4 overexpression promotes anchorage-independent growth of prostate epithelial cells, but not growth of breast epithelial cells. These data suggest that germline variation at chromosome 10q11 contributes to prostate cancer risk by influencing expression of at least two genes. More broadly, the findings demonstrate that disease risk alleles may influence multiple genes, and associations between genotype and expression may only be observed in the context of specific tissue and disease states.     

Intracranial aneurysm risk locus 5q23.2 is associated with elevated systolic blood pressure

Although genome-wide association studies (GWAS) have identified hundreds of complex trait loci, the pathomechanisms of most remain elusive. Studying the genetics of risk factors predisposing to disease is an attractive approach to identify targets for functional studies. Intracranial aneurysms (IA) are rupture-prone pouches at cerebral artery branching sites. IA is a complex disease for which GWAS have identified five loci with strong association and a further 14 loci with suggestive association. To decipher potential underlying disease mechanisms, we tested whether there are IA loci that convey their effect through elevating blood pressure (BP), a strong risk factor of IA. We performed a meta-analysis of four population-based Finnish cohorts (n(FIN) = 11 266) not selected for IA, to assess the association of previously identified IA candidate loci (n = 19) with BP. We defined systolic BP (SBP), diastolic BP, mean arterial pressure, and pulse pressure as quantitative outcome variables. The most significant result was further tested for association in the ICBP-GWAS cohort of 200 000 individuals. We found that the suggestive IA locus at 5q23.2 in PRDM6 was significantly associated with SBP in individuals of European descent (p(FIN) = 3.01E-05, p(ICBP-GWAS) = 0.0007, p(ALL) = 8.13E-07). The risk allele of IA was associated with higher SBP. PRDM6 encodes a protein predominantly expressed in vascular smooth muscle cells. Our study connects a complex disease (IA) locus with a common risk factor for the disease (SBP). We hypothesize that common variants in PRDM6 can contribute to altered vascular wall structure, hence increasing SBP and predisposing to IA. True positive associations often fail to reach genome-wide significance in GWAS. Our findings show that analysis of traditional risk factors as intermediate phenotypes is an effective tool for deciphering hidden heritability. Further, we demonstrate that common disease loci identified in a population isolate may bear wider significance.     

Residential sunlight exposure is associated with a decreased risk of prostate cancer

The possibility that exposure to sunlight reduces the risk of clinical prostate cancer has been strongly suggested by ecologic data. However, data on prostate cancer risk in relation to sunlight exposure in individuals are sparse. We analyzed data from the First National Health and Nutrition Examination Survey (NHANES I) Epidemiologic Follow-up Study in order to test the hypothesis that residential sunlight exposure reduces the risk of prostate cancer. We identified 153 men with incident prostate cancer from a cohort of 3414 white men who completed the baseline interview and dermatologic examination in 1971-1975 and were followed up to 1992. We used Cox proportional hazards modeling to estimate relative risks (RR) and 95% confidence intervals (CI) for measures of residential sunlight exposure, adjusting for age, family history of prostate cancer, and dietary intake of fat and calcium. Residence in the South at baseline (RR = 0.68, CI = 0.41-1.13), state of longest residence in the South (RR = 0.62, CI = 0.40-0.95), and high solar radiation in the state of birth (RR = 0.49, CI = 0.30-0.79) were associated with significant and substantial reductions in prostate cancer risk. These data support the hypothesis that sunlight exposure reduces the risk of prostate cancer and have important implications for prostate cancer prevention.     

Sex- and age-dependent DNA methylation at the 17q12-q21 locus associated with childhood asthma

Chromosomal region 17q12-q21 is one of the best-replicated genome-wide association study (GWAS) hits and associated with childhood-onset asthma. However, the mechanism by which the genetic association is restricted to childhood-onset disease is unclear. During childhood, more boys than girls develop asthma. Therefore, we tested the hypothesis that the 17q12-q21 genetic association was sex-specific. Indeed, a TDT test showed that in the Saguenay-Lac-Saint-Jean familial collection, the 17q12-q21 association was significant among male, but not among female asthmatic subjects. We next hypothesized that the bias in the genetic association resulted from sex-specific and/or age-dependent DNA methylation at regulatory regions and determined the methylation profiles of five 17q12-q21 gene promoters using the bisulfite sequencing methylation assay. We identified a single regulatory region within the zona pellucida binding protein 2 (ZPBP2) gene, which showed statistically significant differences between males and females with respect to DNA methylation. DNA methylation also varied with age and was higher in adult males compared to boys. We have recently identified two functionally important polymorphisms, both within the ZPBP2 gene that influence expression levels of neighboring genes. Combined with the results of the present work, these data converge pointing to the same 5 kb region within the ZPBP2 gene as a critical region for both gene expression regulation and predisposition to asthma. Our data show that sex- and age-dependent DNA methylation may act as a modifier of genetic effects and influence the results of genetic association studies.     

Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCT?AGCGGGTACCGAGCTCGAAT; ?A=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67fmol/μg DNA/h vs 3.47±1.35fmol/μg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.     

Fine mapping the KLK3 locus on chromosome 19q13.33 associated with prostate cancer susceptibility and PSA levels

Measurements of serum prostate-specific antigen (PSA) protein levels form the basis for a widely used test to screen men for prostate cancer. Germline variants in the gene that encodes the PSA protein (KLK3) have been shown to be associated with both serum PSA levels and prostate cancer. Based on a resequencing analysis of a 56?kb region on chromosome 19q13.33, centered on the KLK3 gene, we fine mapped this locus by genotyping tag SNPs in 3,522 prostate cancer cases and 3,338 controls from five case?Ccontrol studies. We did not observe a strong association with the KLK3 variant, reported in previous studies to confer risk for prostate cancer (rs2735839; P?=?0.20) but did observe three highly correlated SNPs (rs17632542, rs62113212 and rs62113214) associated with prostate cancer [P?=?3.41?×?10^?4, per-allele trend odds ratio (OR)?=?0.77, 95% CI?=?0.67?C0.89]. The signal was apparent only for nonaggressive prostate cancer cases with Gleason score <7 and disease stage <III (P?=?4.72?×?10^?5, per-allele trend OR?=?0.68, 95% CI?=?0.57?C0.82) and not for advanced cases with Gleason score >8 or stage ??III (P?=?0.31, per-allele trend OR?=?1.12, 95% CI?=?0.90?C1.40). One of the three highly correlated SNPs, rs17632542, introduces a non-synonymous amino acid change in the KLK3 protein with a predicted benign or neutral functional impact. Baseline PSA levels were 43.7% higher in control subjects with no minor alleles (1.61?ng/ml, 95% CI?=?1.49?C1.72) than in those with one or more minor alleles at any one of the three SNPs (1.12?ng/ml, 95% CI?=?0.96?C1.28) (P?=?9.70?×?10^?5). Together our results suggest that germline KLK3 variants could influence the diagnosis of nonaggressive prostate cancer by influencing the likelihood of biopsy.     

Genetic variants of IDE-KIF11-HHEX at 10q23.33 associated with type 2 diabetes risk: a fine-mapping study in Chinese population

Background

Genome-wide association studies (GWAS) in populations of European ancestry have mapped a type 2 diabetes susceptibility region to chromosome 10q23.33 containing IDE, KIF11 and HHEX genes (IDE-KIF11-HHEX), which has also been replicated in Chinese populations. However, the functional relevance for genetic variants at this locus is still unclear. It is critical to systematically assess the relationship of genetic variants in this region with the risk of type 2 diabetes.

Methodology/Principal Findings

A fine-mapping study was conducted by genotyping fourteen tagging single-nucleotide polymorphisms (SNPs) in a 290-kb linkage disequilibrium (LD) region using a two-stage case-control study of type 2 diabetes in a Chinese Han population. Suggestive associations (P<0.05) observed from 1,200 cases and 1,200 controls in the first stage were further replicated in 1,725 cases and 2,081 controls in the second stage. Seven tagging SNPs were consistently associated with type 2 diabetes in both stages (P<0.05), with combined odds ratios (ORs) ranging from 1.14 to 1.33 in the combined analysis. The most significant locus was rs7923837 [OR = 1.33, 95% confidence interval (CI): 1.21–1.47] at the 3′-flanking region of HHEX gene. SNP rs1111875 was found to be another partially independent locus (OR = 1.23, 95% CI: 1.13–1.35) in this region that was associated with type 2 diabetes risk. A cumulative effect of rs7923837 and rs1111875 was observed with individuals carrying 1, 2, and 3 or 4 risk alleles having a 1.27, 1.44, and 1.73-fold increased risk, respectively, for type 2 diabetes (P for trend = 4.1E-10).

Conclusions/Significance

Our results confirm that genetic variants of the IDE-KIF11-HHEX region at 10q23.33 contribute to type 2 diabetes susceptibility and suggest that rs7923837 may represent the strongest signal related to type 2 diabetes risk in the Chinese Han population.     

The citrus flavonoid naringenin stimulates DNA repair in prostate cancer cells

As part of a systematic study of the effects of phytochemicals beyond antioxidation on cancer prevention, we investigated whether naringenin (NR), a citrus flavonoid, stimulates DNA repair following oxidative damage in LNCaP human prostate cancer cells. The 8-hydroxydeoxyguanosine (8-OH-dG) to deoxyguanosine (dG) ratio was measured after cells were treated with 200 micromol/L of ferrous sulfate in serum-free medium followed by NR exposure for 24 h in growth medium. The results demonstrated that exposure to 10-80 micromol/L of NR led to a significant decrease in the ratio of 8-OH-dG to 10(6) dG. Because cells were treated with NR after ferrous sulfate was removed, we conclude that we demonstrated an effect on DNA repair beyond antioxidation. In support of this conclusion, we determined the induction of mRNA expression over time after oxidative stress followed by NR administration of three major enzymes in the DNA base excision repair (BER) pathway: 8-oxoguanine-DNA glycosylase 1 (hOGG1), apurinic/apyrimidinic endonuclease and DNA polymerase beta (DNA poly beta). hOGG1 and DNA poly beta mRNA expression in cells after 24-h exposure to NR was increased significantly compared with control cells without NR. The intracellular concentration of NR after exposure to 80 micromol/L was 3 pmol/mg protein, which is physiologically achievable in tissues. In conclusion, the cancer-preventive effects of citrus fruits demonstrated in epidemiological studies may be due in part to stimulation of DNA repair by NR, which by stimulating BER processes may prevent mutagenic changes in prostate cancer cells.     

RNASEL 1623A>C variant is associated with the risk of prostate cancer in African descendants

Association between ribonuclease L (RNASEL) gene 1623A>C polymorphism and prostate cancer (PCa) susceptibility has been assessed in large quantities of studies but with controversial conclusions. We undertook a pooled analysis containing 7397 PCa cases and 6088 control subjects to assess the correlation between RNASEL 1623A>C polymorphism and PCa risk. Moreover, we used enzyme-linked immunosorbent assay to test the serum RNASEL expression among patients enrolled in our centers and in-silico tools were also utilized. The overall results of our analysis indicated a positive relationship between 1623A>C variant and PCa risk (allelic contrast, odds ratio [OR] = 1.07; 95% confidence interval [CI] = 1.02-1.12; P_{heterogeneity} = 0.575; CC vs AA, OR = 1.14; 95% CI = 1.03-1.26; P_{heterogeneity} = 0.217; CC + CA vs AA, OR = 1.10; 95% CI = 1.01-1.19; P_{heterogeneity} = 0.303; and CC vs CA + AA, OR = 1.08; 95% CI = 1.00-1.17; P_{heterogeneity} = 0.298). In ethnicity subgroup analysis, similar results were especially indicated in African descendants. In addition, serum RNASEL levels in PCa cases with CC + CA genotypes were higher than those with AA genotypes. Our present study showed evidence that RNASEL 1623A>C polymorphism is related to PCa risk, especially in African descendants.     

Localization of MCT2 at peroxisomes is associated with malignant transformation in prostate cancer

Previous studies on monocarboxylate transporters expression in prostate cancer (PCa) have shown that monocarboxylate transporter 2 (MCT2) was clearly overexpressed in prostate malignant glands, pointing it out as a putative biomarker for PCa. However, its localization and possible role in PCa cells remained unclear. In this study, we demonstrate that MCT2 localizes mainly at peroxisomes in PCa cells and is able to take advantage of the peroxisomal transport machinery by interacting with Pex19. We have also shown an increase in MCT2 expression from non‐malignant to malignant cells that was directly correlated with its peroxisomal localization. Upon analysis of the expression of several peroxisomal β‐oxidation proteins in PIN lesions and PCa cells from a large variety of human prostate samples, we suggest that MCT2 presence at peroxisomes is related to an increase in β ‐oxidation levels which may be crucial for malignant transformation. Our results present novel evidence that may not only contribute to the study of PCa development mechanisms but also pinpoint novel targets for cancer therapy.     

DNA damage phenotype and prostate cancer risk

The capacity of an individual to process DNA damage is considered a crucial factor in carcinogenesis. The comet assay is a phenotypic measure of the combined effects of sensitivity to a mutagen exposure and repair capacity. In this paper, we evaluate the association of the DNA repair kinetics, as measured by the comet assay, with prostate cancer risk. In a pilot study of 55 men with prostate cancer, 53 men without the disease, and 71 men free of cancer at biopsy, we investigated the association of DNA damage with prostate cancer risk at early (0-15 min) and later (15-45 min) stages following gamma-radiation exposure. Although residual damage within 45 min was the same for all groups (65% of DNA in comet tail disappeared), prostate cancer cases had a slower first phase (38% vs. 41%) and faster second phase (27% vs. 22%) of the repair response compared to controls. When subjects were categorized into quartiles, according to efficiency of repairing DNA damage, high repair-efficiency within the first 15 min after exposure was not associated with prostate cancer risk while higher at the 15-45 min period was associated with increased risk (OR for highest-to-lowest quartiles=3.24, 95% CI=0.98-10.66, p-trend=0.04). Despite limited sample size, our data suggest that DNA repair kinetics marginally differ between prostate cancer cases and controls. This small difference could be associated with differential responses to DNA damage among susceptible individuals.     

MTSS1 hypermethylation is associated with prostate cancer progression

This study was conducted to evaluate the influence of DNA methylation of metastasis suppressor 1 (MTSS1) on prostate cancer (PCa) progression. Forty-nine paired PCa tissue samples and normal tissue samples from The Cancer Genome Atlas were analyzed. Methylome analysis, CpG island arrays and Hierarchical clustering were used to analyze methylation profiles of PCa tissues. MTSS1 methylation level was detected by methylation-specific PCR. Relative messenger RNA and the expression level of MTSS1 protein were identified by quantitative real-time PCR (qRT-PCR) and western blot analysis. The migration, invasion, proliferation, and cell cycle were detected separately by wound-healing assay, transwell chamber assay, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay and flow cytometry. The roles of MTSS1 in PCa progression were demonstrated in vivo by tumor formation assays in nude mice. MTSS1 expression was decreased in PCa tissues in comparison with paired adjacent normal prostate tissues. Compared to the methylation of MTSS1 in normal prostate tissues based on the MethHC website, the MTSS1 in PCa tissues was hypermethylated. The expression of MTSS1 detected by qRT-PCR and western blot analysis was found to be downregulated in PCa cells and tissues. The reduced expression of MTSS1 by small interfering RNA-MTSS1 was recovered by 5-aza-2′-deoxycytidine treatment. Besides, MTSS1 demethylation inhibited migration, invasion, and proliferation of PCa cells, and induced cell cycle to be arrested at G0/G1 phase. Furthermore, it was shown by tumor xenograft assay that MTSS1 inhibited the growth of tumor in vivo. Hypermethylated MTSS1 promoted PCa cells migration, invasion, and proliferation, and suppressed cell cycle arrest at the G0/G1 phase.     

In Swedish families with hereditary prostate cancer, linkage to the HPC1 locus on chromosome 1q24-25 is restricted to families with early-onset prostate cancer.

Prostate cancer clusters in some families, and an estimated 5%-10% of all cases are estimated to result from inheritance of prostate cancer-susceptibility genes. We previously reported evidence of linkage to the 1q24-25 region (HPC1) in 91 North American and Swedish families each with multiple cases of prostate cancer (Smith et al. 1996). In the present report we analyze 40 (12 original and 28 newly identified) Swedish families with hereditary prostate cancer (HPC) that, on the basis of 40 markers spanning a 25-cM interval within 1q24-25, have evidence of linkage. In the complete set of families, a maximum two-point LOD score of 1.10 was observed at D1S413 (at a recombination fraction [theta] of.1), with a maximum NPL (nonparametric linkage) Z score of 1.64 at D1S202 (P=.05). The evidence of linkage to this region originated almost exclusively from the subset of 12 early-onset (age <65 years) families, which yielded a maximum LOD score of 2.38 at D1S413 (straight theta=0) and an NPL Z score of 1.95 at D1S422 (P=.03). Estimates from heterogeneity tests suggest that, within Sweden, as many as 50% of early-onset families had evidence of linkage to the HPC1 region. These results are consistent with the hypothesis of linkage to HPC1 in a subset of families with prostate cancer, particularly those with an early age at diagnosis.