Juxta-centromeric region of human chromosome 21 is enriched for pseudogenes and gene fragments

A physical map including four pseudogenes and 10 gene fragments and spanning 500 kb in the juxta-centromeric region of the long arm of human chromosome 21 is presented. cDNA fragments isolated from a selected cDNA library were characterized and mapped to the 831B6 YAC and to two BAC contigs that cover 250 kb of the region. An 85 kb genomic sequence located in the proximal region of the map was analyzed for putative exons. Four pseudogenes were found, including psiIGSF3, psiEIF3, psiGCT-rel whose functional copies map to chromosome 1p13, chromosome 2 and chromosome 22q11, respectively. The TTLL1 pseudogene corresponds to a new gene whose functional copy maps to chromosome 22q13. Ten gene fragments represent novel sequences that have related sequences on different human chromosomes and show 97-100% nucleotide identity to chromosome 21. These may correspond to pseudogenes on chromosome 21 and to functional genes in other chromosomes. The 85 kb genomic sequence was analyzed also for GC content, CpG islands, and repetitive sequence distribution. A GC-poor L isochore spanning 40 kb from satellite 1 was observed in the most centromeric region, next to a GC-rich H isochore that is a candidate region for the presence of functional genes. The pericentric duplication of a 7.8 kb region that is derived from the 22q13 chromosome band is described. We showed that the juxta-centromeric region of human chromosome 21 is enriched for retrotransposed pseudogenes and gene fragments transferred by interchromosome duplications, but we do not rule out the possibility that the region harbors functional genes also.     

Chromosomal localization of a tandemly repeated DNA sequence in Trifolium repens L

INTRoDUCTIoNlYho1iumrePensL,whiteclover,isaneconomicallyimportantplantspeciesintemperatepastures.Asbrieflyreportedby[1],ithas16pairsofchromosomes(2n=32).Asyet,nodetailedcytologicalexaminationofthisspecies,suchasC-banding,hasbeenrep0rted.Inthelastdecade,thetechnique0fC-bandinghasbeenusedt0examinehighlyrepeatedsequencesinplantchrom0s0mesandhasprovidedausefultoolf0rtheanalysis0fcyt0geneticstructureincr0pplants[2-71.Inplants,thechr0m0s0mall0calizationofhighlyrepeatedDNAsequencesbyinsituhybr…     

Localization of the active gene of aldolase on chromosome 16, and two aldolase A pseudogenes on chromosomes 3 and 10

Summary Southern blot analysis of human genomic DNA hybridized with a coding region aldolase A cDNA probe (600 bases) revealed four restriction fragments with EcoRI restriction enzyme: 7.8 kb, 13 kb, 17 kb and >30 kb. By human-hamster hybrid analysis (Southern technique) the principal fragments, 7.8 kb, 13 kb, >30 kb, were localized to chromosomes 10, 16 and 3 respectively. The 17-kb fragment was very weak in intensity; it co-segregated with the >30-kb fragment and is probably localized on chromosome 3 with the >30-kb fragment. Analysis of a second aldolase A labelled probe protected against S1 nuclease digestion by RNAs from different hybrid cells, indicated the presence of aldolase A mRNAs in hybrid cells containing only chromosome 16. Under the stringency conditions used, the EcoRI sequences detected by the coding region aldolase A cDNA probe did not correspond to aldolase B or C. The 7.8-kb and >30-kb EcoRI sequences, localized respectively on chromosomes 10 and 3, correspond to aldolase A pseudogenes, the 13-kb EcoRI sequence localized on chromosome 16 corresponds to the aldolase active gene. The fact that the aldolase A gene and pseudogenes are located on three different chromosomes supports the hypothesis that the pseudogenes originated from aldolase A mRNAs, copied into DNA and integrated in unrelated chromosomal loci.     

An alpha satellite DNA polymorphism specific for the centromeric region of chromosome 13

Alpha satellite DNA is composed of variants of a short consensus sequence that are repeated in tandem arrays in the centromeric heterochromatin of each human chromosome. To define centromeric markers for linkage studies, we screened human genomic DNA for restriction fragment length polymorphisms using a probe detecting alphoid sequences on chromosomes 13 and 21. We describe one such DNA polymorphism. Analysis of linkage of this DNA marker to other polymorphic markers in the CEPH pedigrees demonstrates linkage to markers on the proximal long arm of chromosome 13 and defines the centromeric end of the linkage map of this chromosome.     

Alphoid DNA polymorphisms for chromosome 21 can be distinguished from those of chromosome 13 using probes homologous to both.

Although alphoid DNA sequences shared among acrocentric chromosomes have been identified, no human chromosome 21-specific sequence has been isolated from the centromeric region. To identify alphoid DNA restriction fragment length polymorphisms (RFLPs) specific for chromosome 21, we hybridized human genomic DNA with alphoid DNA probes [L1.26; aRI(680),21-208] shared by chromosomes 13 and 21. We detected RFLPs with restriction enzymes ECoRI, HaeIII, MboI,StuI, and TaqI. The segregation of these RFLPs was analyzed in the 40 CEPH families. Linkage analysis between these RFLPs and loci previously mapped to either chromosome 13 or 21 revealed RFLPs that appear to be specific to chromosome 21. These polymorphisms may be useful as genetic markers of the centromeric region of chromosome 21. Different alphoid loci within the centromeric region of chromosome 13 were identified.     

Analysis of the genomic organisation of a small chromosome of Leishmania braziliensis M2903 reveals two genes encoding GTP-binding proteins, one of which belongs to a new G-protein family and is an antigen

Leishmania braziliensis M2903 contains a highly amplified small chromosome. This work is aimed at resolving its structural organization and determining whether this unusual chromosome contains specific genes encoding proteins with important functions in disease pathology or drug resistance. Our results show that the M2903 250-kb small chromosome contains LD1 sequences and has an inverted repeat structure. The LD1 sequences and two cDNAs (cDNA2 and cDNA53) were mapped on a cosmid contig, and the two cDNAs and the corresponding genomic fragments from the small chromosome were sequenced. The gene encoding cDNA2 predicts a putative GTP-binding protein with homology to other GTP-binding proteins only in the G-1 domain region; however, four other conserved motifs can be recognized. Sequence similarity to cDNA53 is located in at least five chromosomes, and its small chromosome copy is a pseudogene. An open reading frame downstream of the cDNA53 pseudogene predicts another GTP-binding protein that belongs to a new G-protein family with an unusual conserved GTP-binding domain and a newly characterized conserved sequence motif. A portion of this GTP-binding protein gene was studied previously in L. aethiopica as a recombinant antigen that reacts with human antibodies.     

Human (Homo sapiens) and chimpanzee (Pan troglodytes) share similar ancestral centromeric alpha satellite DNA sequences but other fractions of heterochromatin differ considerably

The euchromatic regions of chimpanzee (Pan troglodytes) genome share approximately 98% sequence similarity with the human (Homo sapiens), while the heterochromatic regions display considerable divergence. Positive heterochromatic regions revealed by the CBG-technique are confined to pericentromeric areas in humans, while in chimpanzees, these regions are pericentromeric, telomeric, and intercalary. When human chromosomes are digested with restriction endonuclease AluI and stained by Giemsa (AluI/Giemsa), positive heterochromatin is detected only in the pericentromeric regions, while in chimpanzee, telomeric, pericentromeric, and in some chromosomes both telomeric and centromeric, regions are positive. The DA/DAPI technique further revealed extensive cytochemical heterogeneity of heterochromatin in both species. Nevertheless, the fluorescence in situ hybridization technique (FISH) using a centromeric alpha satellite cocktail probe revealed that both primates share similar pericentromeric alpha satellite DNA sequences. Furthermore, cross-hybridization experiments using chromosomes of gorilla (Gorilla gorilla) and orangutan (Pongo pygmaeus) suggest that the alphoid repeats of human and great apes are highly conserved, implying that these repeat families were present in their common ancestor. Nevertheless, the orangutan's chromosome 9 did not cross-hybridize with human probe. The euchromatic regions of chimpanzee (Pan troglodytes) genome share approximately 98% sequence similarity with the human (Homo sapiens), while the heterochromatic regions display considerable divergence. Positive heterochromatic regions revealed by the CBG-technique are confined to pericentromeric areas in humans, while in chimpanzees, these regions are pericentromeric, telomeric, and intercalary. When human chromosomes are digested with restriction endonuclease AluI and stained by Giemsa (AluI/Giemsa), positive heterochromatin is detected only in the pericentromeric regions, while in chimpanzee, telomeric, pericentromeric, and in some chromosomes both telomeric and centromeric, regions are positive. The DA/DAPI technique further revealed extensive cytochemical heterogeneity of heterochromatin in both species. Nevertheless, the fluorescence in situ hybridization technique (FISH) using a centromeric alpha satellite cocktail probe revealed that both primates share similar pericentromeric alpha satellite DNA sequences. Furthermore, cross-hybridization experiments using chromosomes of gorilla (Gorilla gorilla) and orangutan (Pongo pygmaeus) suggest that the alphoid repeats of human and great apes are highly conserved, implying that these repeat families were present in their common ancestor. Nevertheless, the orangutan's chromosome 9 did not cross-hybridize with human probe. © 1995 Wiley-Liss, Inc.     

Gene for selenium-dependent glutathione peroxidase maps to human chromosomes 3, 21 and X

A human glutathione peroxidase cDNA has been used as a probe to hybridize to DNAs isolated from human - rodent somatic cell hybrids that have segregated human chromosomes. A 609 bp probe which contains the entire coding region hybridizes to human chromosomes 3, 21 and Xp. Fragments of the cDNA coding sequence and of the 3' untranslated region were also used as probes. These fragments hybridized to each of the three chromosomes with the same efficiency, suggesting similarity between the loci, whereas an intronic probe detected only the gene on chromosome 3. The general organization of each gene was determined from the hybridization data. The data suggest that the locus on chromosome 3 is a functional gene containing a single intron and a pattern of restriction sites identical to those found in the cDNA coding sequence. The data also suggest that the sequences on chromosomes X and 21 have equal conservation of the 3' untranslated and coding sequences but do not contain introns, providing evidence that the latter two sequences are processed pseudogenes. A simple two allele polymorphism in PvuII digests was detected at the locus on chromosome 21.     

Mapping, characterization, and expression analysis of the SM-20 human homologue, c1orf12, and identification of a novel related gene, SCAND2

Major psychosis was shown to segregate with a balanced translocation (1q42.1; 11q14.3) in a multigenerational family. This study describes the identification of a human SM-20 homologue gene that lies at about 400 kb on the centromeric side of the 1q42.1 breakpoint. The full-length cDNA sequence and gene structure were determined. Expression analysis was performed, showing high expression levels in skeletal and cardiac muscles; in the central nervous system, expression was restricted to dopaminergic neurons and spinal motoneurons. A second gene displaying high sequence similarity with SM-20 was also identified by BLAST. This gene, located on chromosome 15, is likely to have evolved by retroposition of SM-20 mRNA and an exon-shuffling mechanism. It encodes a 306-amino-acid protein harboring strong homology with an N-terminal motif found in some zinc-finger proteins. This gene was named SCAND2 (SCAN domain-containing 2).     

A degenerate alpha satellite probe, detecting a centromeric deletion on chromosome 21 in an apparently normal human male, shows limitations of the use of satellite DNA probes for interphase ploidy analysis.

A degenerate alpha satellite DNA probe specific for a repeated sequence on human chromosomes 13 and 21 was synthesized using the polymerase chain reaction (PCR). Fluorescence in situ hybridization (FISH) with this probe to normal metaphase spreads revealed strong probe binding to the centromeric regions of human chromosomes 13 and 21 with negligible cross-hybridization with other chromosomes. FISH to normal interphase cell nuclei showed four distinct domains of probe binding. However, hybridization with probe to interphase and metaphase preparations from one apparently normal human male resulted in only three major binding domains. Metaphase chromosome analysis revealed a centromeric deletion on one chromosome 21 that caused greatly reduced probe binding. The result suggest caution in the interpretation of interphase ploidy studies performed with chromosome-specific alphoid DNA probes.     

Molecular Cloning and Characterization of a Novel Human C4orf13 Gene, Tentatively a Member of the Sodium Bile Acid Cotransporter Family

By large-scale sequencing analysis of a human fetal brain cDNA library, we isolated a novel human cDNA (C4orf13). This cDNA is 2706 bp in length, encoding a 340-amino-acid polypeptide that contains a typical SBF (sodium bile acid cotransporter family) domain and ten possible transmembrane segments. The putative protein C4orf13 shows high similarity with its orthologs in Mus musculus and Xenopus laevis. Human C4orf13 is mapped to chromosome 4q31.2 and contains 12 exons. RT-PCR analysis shows that human C4orf13 is widely expressed in human tissues, and the expression levels in liver and lung are relatively high, expression levels in placenta, kidney, spleen, and thymus are moderate, low levels of expression are detected in heart, prostate, and testis.The nucleotide sequence reported in this paper has been deposited to GenBank under accession number AY346324.     

The chicken immunoregulatory receptor families SIRP, TREM, and CMRF35/CD300L

Mammalian immunoregulatory families of genes encoding activating and inhibitory Ig-like receptor pairs have been located on distinct chromosomes. In chicken, a single Ig-like receptor family with many members had been described so far. By looking at sequence similarity and synteny conservations in the chicken genome, the signal-regulatory protein (SIRP), triggering receptor expressed on myeloid cells (TREM), and CMRF35/CD300L Ig-like gene families were identified on chromosomes 20, 26, and 3, respectively. Further analysis of the three corresponding genomic regions and partial bacterial artificial chromosome sequencing were used to identify more members and to realign several contigs. All putative genomic sequences were monitored by investigating existing expressed sequence tag and cloning cDNA. This approach yielded a single pair of activating and inhibitory SIRP, two inhibitory, and one activating TREM as well as one inhibitory CMRF35/CD300L with a potentially soluble variant and an additional member lacking categorizing motifs. The CMRF35/CD300L and TREM receptors were composed of one or two V-set Ig domains, whereas in SIRP, either a single Ig V domain was present or a combination of a V and C1 domains. Like in many Ig superfamily members, separate exons encode individual Ig domains. However, in two CMRF35/CD300L genes, the signal peptide and the distal Ig domain were encoded by a single exon. In conclusion, the mammalian diversity of immunoregulatory molecules is present the chicken suggesting an important role for TREM, SIRP, and CMRF35/CD300L in a functionally conserved network.     

Chalcone synthase in rice (Oryza sativa L.): Detection of the CHS protein in seedlings and molecular mapping of the chs locus

The chalcone synthase is a key enzyme that catalyses the first dedicated reaction of the flavonoid pathway in higher plants. The chs gene and its protein product in rice has been investigated. The presence of a chalcone synthase (CHS) protein in rice seedlings and its developmental stage-specific expression has been demonstrated by western analysis. The chalcone synthase of rice was found to be immunologically similar to that of maize. A rice cDNA clone, Os-chs cDNA, encoding chalcone synthase, isolated from a leaf cDNA library of an indica rice variety Purpleputtu has been mapped to the centromeric region of chromosome 11 of rice. It was mapped between RFLP markers RG2 and RG103. RG2 is the nearest RFLP marker located at a genetic distance of 3.3 cM. Some segments of chromosome 11 of rice including chs locus are conserved on chromosome 4 of maize. The markers, including chs locus on chromosome 11 of rice are located, though not in the same order, on chromosome 4 of maize. Genetic analysis of purple pigmentation in two rice lines, Abhaya and Shyamala, used in the present mapping studies, indicated the involvement of three genes, one of which has been identified as a dominant inhibitor of leaf pigmentation. The Os-chs cDNA shows extensive sequence homology, both for DNA and protein (deduced), to that of maize, barley and also to different monocots and dicots.     

Structure of DNA near long tandem arrays of alpha satellite DNA at the centromere of human chromosome 7.

The centromeric regions of human chromosomes contain long tracts of tandemly repeated DNA, of which the most extensively characterized is alpha satellite. In a screen for additional centromeric DNA sequences, four phage clones were obtained which contain alpha satellite as well as other sequences not usually found associated with tandemly repeated alpha satellite DNA, including L1 repetitive elements, an Alu element, and a novel AT-rich repeated sequence. The alpha satellite DNA contained within these clones does not demonstrate the higher-order repeat structure typical of tandemly repeated alpha satellite. Two of the clones contain inversions; instead of the usual head-to-tail arrangement of alpha satellite monomers, the direction of the monomers changes partway through each clone. The presence of both inversions was confirmed in human genomic DNA by polymerase chain reaction amplification of the inverted regions. One phage clone contains a junction between alpha satellite DNA and a novel low-copy repeated sequence. The junction between the two types of DNA is abrupt and the junction sequence is characterized by the presence of runs of A's and T's, yielding an overall base composition of 65% AT with local areas > 80% AT. The AT-rich sequence is found in multiple copies on chromosome 7 and homologous sequences are found in (peri)centromeric locations on other human chromosomes, including chromosomes 1, 2, and 16. As such, the AT-rich sequence adjacent to alpha satellite DNA provides a tool for the further study of the DNA from this region of the chromosome. The phage clones examined are located within the same 3.3-Mb SstII restriction fragment on chromosome 7 as the two previously described alpha satellite arrays, D7Z1 and D7Z2. These new clones demonstrate that centromeric repetitive DNA, at least on chromosome 7, may be more heterogeneous in composition and organization than had previously been thought.     

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.     

A polymorphic alpha satellite sequence specific for human chromosome 13 detected by oligonucleotide primed in situ labelling (PRINS)

The centromeric alpha satellite DNA subfamilies from chromosomes 13 and 21 are almost identical in sequence and cannot be easily distinguished by mean of probes for Southern blot or in situ hybridisation. We have used the oligonucleotide-primed in situ (PRINS) labelling technique with primers defined from the alpha satellite sequence of chromosome 13. One primer was found to label specifically the centromeric region of chromosomes 13 and allowed the detection of a polymorphism between two chromosome 13 homologues in one individual.     

HeT-A telomere-specific retrotransposons in the centric heterochromatin of Drosophila melanogaster chromosome 3

We have isolated two yeast artificial chromosome (YAC) clones from Drosophila melanogaster that contain a small amount of dodeca satellite (a satellite DNA located in the centromeric region of chromosome 3) and sequences homologous to the telomeric retrotransposon HeT-A. Using these YACs as probes for fluorescence in situ hybridization to mitotic chromosomes, we have localized these HeT-A elements to the centric heterochromatin of chromosome 3, at region h55. The possible origin of these telomeric elements in a centromeric position is discussed. Received: 30 July 1999 / Accepted: 19 September 1999     

Reliability and efficiency of interphase-fish with alpha-satellite probe for detection of aneuploidy

Early diagnosis is very important in pre- and postnatal diagnosis of Down syndrome. This study examines the use of fluorescence in situ hybridization (FISH) to detect trisomy 21 in interphase nuclei and metaphase chromosome obtained from fifty-four Down syndrome patients with a regular type trisomy 21. Three of them showed six hybridization signals on both interphase nuclei and metaphase spreads instead of five signals corresponding to two chromosomes 13 and three chromosomes 21 although they were cytogenetically trisomy 21. Simultaneous application of probe combination revealed that one of the extra signals of chromosomes 13/21 a-satellite probe was located on chromosome 22 in two cases and one extra signal on chromosomes 15 in one case. In addition, another case showed four hybridization signals on both interphase nuclei and metaphase spreads instead of five signals, indicating deletion of the chromosome specific alpha-satellite DNA sequence of chromosome 13/21. These centromeric sequence changes may have pathological significance in the appearance of aneuploidy because they may be involved in the important centromere function.