Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat

Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.     

Physiological and biochemical characterization of Trichoderma harzianum, a biological control agent against soilborne fungal plant pathogens.

Monoconidial cultures of 15 isolates of Trichoderma harzianum were characterized on the basis of 82 morphological, physiological, and biochemical features and 99 isoenzyme bands from seven enzyme systems. The results were subjected to numerical analysis which revealed four distinct groups. Representative sequences of the internal transcribed spacer 1 (ITS 1)-ITS 2 region in the ribosomal DNA gene cluster were compared between groups confirming this distribution. The utility of the groupings generated from the morphological, physiological, and biochemical data was assessed by including an additional environmental isolate in the electrophoretic analysis. The in vitro antibiotic activity of the T. harzianum isolates was assayed against 10 isolates of five different soilborne fungal plant pathogens: Aphanomyces cochlioides, Rhizoctonia solani, Phoma betae, Acremonium cucurbitacearum, and Fusarium oxysporum f. sp. radicis lycopersici. Similarities between levels and specificities of biological activity and the numerical characterization groupings are both discussed in relation to antagonist-specific populations in known and potential biocontrol species.     

Biocontrol potential and polyphasic characterization of novel native <Emphasis Type="Italic">Trichoderma</Emphasis> strains against <Emphasis Type="Italic">Macrophomina phaseolina</Emphasis> isolated from sorghum and common bean

Native strains of Trichoderma isolated from sorghum and common bean crop soils were investigated to assess their biocontrol potential over the phytopathogenic fungus Macrophomina phaseolina, isolated from diseased plants. The Trichoderma strains were characterized with a polyphasic approach, which combined the analysis of their morphological characteristics, enzymatic activity, macro- and microculture test results, rDNA restriction patterns (AFLP), ITS1-5.8S-ITS2 rDNA sequences, and protein profiles. The integration of these data sets can be used to select new isolates as biological control agents against native fungal phytopathogens. In general, we observed a positive correlation between the secretion of beta-1,3-glucanase and N-acetylhexosaminidase, and the biocontrol capacities of all the Trichoderma isolates. Strains with the best hyperparasitic behavior against M. phaseolina isolated from diseased bean and sorghum were Trichoderma sp. (TCBG-2) and Trichoderma koningiopsis (TCBG-8), respectively.     

Identification and characterization of filamentous fungi isolated from fermentation starters for Hong Qu glutinous rice wine brewing

Hong Qu glutinous rice wine is one of the most popular traditional rice wines in China. Traditionally, this wine is brewed from glutinous rice with the addition of wine fermentation starters (Hong Qu (also called red yeast rice) and White Qu). The objective of this study was to investigate the variability of filamentous fungi associated with traditional fermentation starters through a traditional culture-dependent method and a molecular identification approach. In this study, forty-three filamentous fungi were separated by traditional culture-dependent means (macro- and microscopic characteristics) from 10 fermentation starters and classified into 16 different species based on morphological examination and the internal transcribed spacer (ITS) sequences analysis. It was observed that the genus Aspergillus had the highest number (14 isolates) of isolates followed by Rhizopus (11 isolates), Monascus (5 isolates) and Penicillium (4 isolates). The species R. oryzae, A. niger, A. flavus and M. purpureus were frequently found in wine starter samples, among which R. oryzae was the most frequent species. The enzyme-producing properties (glucoamylase, α-amylase and protease) of all fungal isolates from different starters were also evaluated. A. flavus, R. oryzae and M. purpureus were found to be better glucoamylase producers. A. flavus, R. oryzae and A.oryzae exhibited higher activity of α-amylase. A. flavus and A. oryzae had higher protease activity. However, some fungal isolates of the same species exhibited a significant variability in the production levels for all determined enzyme activity. This study is the first to identify filamentous fungi associated with the starter of Hong Qu glutinous rice wine using both traditional and molecular methods. The results enrich our knowledge of liquor-related micro-organisms, and can be used to promote the development of the traditional fermentation technology.     

Antagonistic potentiality of Trichoderma harzianum towards seed-borne fungal pathogens of winter wheat cv. Protiva in vitro and in vivo

The antagonistic effect of Trichoderma harzianum on a range of seed-borne fungal pathogens of wheat (viz. Fusarium graminearum, Bipolaris sorokiniana, Aspergillus spp., and Penicillium spp.) was assessed. The potential of T. harzianum as a biocontrol agent was tested in vitro and under field conditions. Coculture of the pathogens and Trichoderma under laboratory conditions clearly showed dominance of T. harzianum. Under natural conditions, biocontrol effects were also obtained against the test fungi. One month after sowing, field emergence (plant stand) was increased by 15.93% over that obtained with the control treatment, and seedling infection was reduced significantly. Leaf blight severity was decreased from 22 to 11 at the heading stage, 35 to 31 at the flowering stage, and 86 to 74 at the grain filling stage. At harvest, the number of tillers per plant was increased by 50%, the yield was increased by 31.58%, and the 1,000-seed weight was increased by 21%.     

Biochemical and metabolic profiles of Trichoderma strains isolated from common bean crops in the Brazilian Cerrado, and potential antagonism against Sclerotinia sclerotiorum

Some species of Trichoderma have successfully been used in the commercial biological control of fungal pathogens, e.g., Sclerotinia sclerotiorum, an economically important pathogen of common beans (Phaseolus vulgaris L.). The objectives of the present study were (1) to provide molecular characterization of Trichoderma strains isolated from the Brazilian Cerrado; (2) to assess the metabolic profile of each strain by means of Biolog FF Microplates; and (3) to evaluate the ability of each strain to antagonize S. sclerotiorum via the production of cell wall-degrading enzymes (CWDEs), volatile antibiotics, and dual-culture tests. Among 21 isolates, we identified 42.86% as Trichoderma asperellum, 33.33% as Trichoderma harzianum, 14.29% as Trichoderma tomentosum, 4.76% as Trichoderma koningiopsis, and 4.76% as Trichoderma erinaceum. Trichoderma asperellum showed the highest CWDE activity. However, no species secreted a specific group of CWDEs. Trichoderma asperellum 364/01, T. asperellum 483/02, and T. asperellum 356/02 exhibited high and medium specific activities for key enzymes in the mycoparasitic process, but a low capacity for antagonism. We observed no significant correlation between CWDE and antagonism, or between metabolic profile and antagonism. The diversity of Trichoderma species, and in particular of T. harzianum, was clearly reflected in their metabolic profiles. Our findings indicate that the selection of Trichoderma candidates for biological control should be based primarily on the environmental fitness of competitive isolates and the target pathogen.     

A potato carboxypeptidase inhibitor gene provides pathogen resistance in transgenic rice

A defensive role against insect attack has been traditionally attributed to plant protease inhibitors. Here, evidence is described of the potential of a plant protease inhibitor, the potato carboxypeptidase inhibitor (PCI), to provide resistance to fungal pathogens when expressed in rice as a heterologous protein. It is shown that rice plants constitutively expressing the pci gene exhibit resistance against the economically important pathogens Magnaporthe oryzae and Fusarium verticillioides . A M. oryzae carboxypeptidase was purified by affinity chromatography and further characterized by mass spectrometry. This fungal carboxypeptidase was found to be a novel carboxypeptidase B which was fully inhibited by PCI. Overall, the results indicate that PCI exerts its antifungal activity through the inhibition of this particular fungal carboxypeptidase B. Although pci confers protection against fungal pathogens in transgenic rice, a significant cost in insect resistance is observed. Thus, the weight gain of larvae of the specialist insect Chilo suppressalis (striped stem borer) and the polyphagous insect Spodoptera littoralis (Egyptian cotton worm) fed on pci rice is significantly larger than that of insects fed on wild-type plants. Homology-based modelling revealed structural similarities between the predicted structure of the M. oryzae carboxypeptidase B and the crystal structure of insect carboxypeptidases, indicating that PCI may function not only as an inhibitor of fungal carboxypeptidases, but also as an inhibitor of insect carboxypeptidases. The potential impact of the pci gene in terms of protection against fungal and insect diseases is discussed.     

Diversity and Antimicrobial Activity of Culturable Fungi Isolated from Six Species of the South China Sea Gorgonians

Fungi in gorgonians are now known to cause gorgonian diseases, but little attention has been paid to the nature of fungal communities associated with gorgonians. The diversity of culturable fungi associated with six species of healthy South China Sea gorgonians were investigated using a culture-dependent method followed by analysis of fungal internal transcribed spacer sequences. A total of 121 fungal isolates were recovered and identified using the Basic Local Alignment Search Tool search program. These belonged to 41 fungal species from 20 genera. Of these, 30 species and 12 genera are new reports for gorgonians, and the genera Aspergillus and Penicillium were the most diverse and common in the six gorgonian species. Comparison of the fungal communities in the six gorgonian species, together with results from previous relevant studies, indicated that different gorgonian species and the same gorgonian species living in different geographic locations had different fungal communities. The gorgonian Dichotella gemmacea harbored the most fungal species and isolates, while Echinogorgia aurantiaca had the least fungal diversity. Among the six media used for fungal isolation, potato glucose agar yielded the highest isolates (27 isolates), while glucose peptone starch agar had the best recoverability of fungal species (15 species). The antimicrobial activity of the 121 fungal isolates was tested against three marine bacteria and two marine gorgonian pathogenic fungi. A relatively high proportion (38?%) of fungal isolates displayed distinct antibacterial and antifungal activity, suggesting that the gorgonian-associated fungi may aid their hosts in protection against pathogens. This is the first report comparing the diversity of fungal communities among the South China Sea gorgonians. It contributes to our knowledge of gorgonian-associated fungi and further increases the pool of fungi available for natural bioactive product screening.     

An oligonucleotide barcode for species identification in Trichoderma and Hypocrea

One of the biggest obstructions to studies on Trichoderma has been the incorrect and confused application of species names to isolates used in industry, biocontrol of plant pathogens and ecological surveys, thereby making the comparison of results questionable. Here we provide a convenient, on-line method for the quick molecular identification of Hypocrea/Trichoderma at the genus and species levels based on an oligonucleotide barcode: a diagnostic combination of several oligonucleotides (hallmarks) specifically allocated within the internal transcribed spacer 1 and 2 (ITS1 and 2) sequences of the rDNA repeat. The barcode was developed on the basis of 979 sequences of 88 vouchered species which displayed in total 135 ITS1 and 2 haplotypes. Oligonucleotide sequences which are constant in all known ITS1 and 2 of Hypocrea/Trichoderma but different in closely related fungal genera, were used to define genus-specific hallmarks. The library of species-, clade- and genus-specific hallmarks is stored in the MySQL database and integrated in the TrichOKey v. 1.0 - barcode sequence identification program with the web interface located on . TrichOKey v. 1.0 identifies 75 single species, 5 species pairs and 1 species triplet. Verification of the DNA-barcode was done by a blind test on 53 unknown isolates of Trichoderma, collected in Central and South America. The obtained results were in a total agreement with phylogenetic identification based on tef1 (large intron), NCBI BLAST of vouchered records and postum morphological analysis. We conclude that oligonucleotide barcode is a powerful tool for the routine identification of Hypocrea/Trichoderma species and should be useful as a complement to traditional methods.     

Evidence for specificity of cultivable bacteria associated with arbuscular mycorrhizal fungal spores

Bacteria associated with arbuscular mycorrhizal (AM) fungal spores may play functional roles in interactions between AM fungi, plant hosts and defence against plant pathogens. To study AM fungal spore-associated bacteria (AMB) with regard to diversity, source effects (AM fungal species, plant host) and antagonistic properties, we isolated AMB from surface-decontaminated spores of Glomus intraradices and Glomus mosseae extracted from field rhizospheres of Festuca ovina and Leucanthemum vulgare. Analysis of 385 AMB was carried out by fatty acid methyl ester (FAME) profile analysis, and some also identified using 16S rRNA gene sequence analysis. The AMB were tested for capacity to inhibit growth in vitro of Rhizoctonia solani and production of fluorescent siderophores. Half of the AMB isolates could be identified to species (similarity index 0.6) within 16 genera and 36 species. AMB were most abundant in the genera Arthrobacter and Pseudomonas and in a cluster of unidentified isolates related to Stenotrophomonas. The AMB composition was affected by AM fungal species and to some extent by plant species. The occurrence of antagonistic isolates depended on AM fungal species, but not plant host, and originated from G. intraradices spores. AM fungal spores appear to host certain sets of AMB, of which some can contribute to resistance by AM fungi against plant pathogens.     

Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens. Ralstonia solanacearum, Xanthomoans axonopodis pv. vesicatoria, and Xanthomonas oryzae pv. oryzae are phytopathogenic bacteria, which can infect vegetables, cause severe yield loss. PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA. The technique of PCR-SSCP is being exploited so far, only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi. Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials. In this study, we developed PCR-SSCP technique to identify phytopathogenic bacteria. The PCR product was denatured and separated on a non-denaturing polyacrylamide gel. SSCP banding patterns were detected by silver staining of nucleic acids. We tested over 56 isolates of R. solanacearum, 44 isolates of X. axonopodis pv. vesicatoria, and 20 isolates of X. oryzae pv. oryzae. With the use of universal primer 16S rRNA, we could discriminate such species at the genus and species levels. Species-specific patterns were obtained for bacteria R. solanacearum, X. axonopodis pv. vesicatoria, and X. oryzae pv. oryzae. The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.     

Multiple translocation of the AVR-Pita effector gene among chromosomes of the rice blast fungus Magnaporthe oryzae and related species

Magnaporthe oryzae is the causal agent of rice blast disease, a devastating problem worldwide. This fungus has caused breakdown of resistance conferred by newly developed commercial cultivars. To address how the rice blast fungus adapts itself to new resistance genes so quickly, we examined chromosomal locations of AVR-Pita, a subtelomeric gene family corresponding to the Pita resistance gene, in various isolates of M. oryzae (including wheat and millet pathogens) and its related species. We found that AVR-Pita (AVR-Pita1 and AVR-Pita2) is highly variable in its genome location, occurring in chromosomes 1, 3, 4, 5, 6, 7, and supernumerary chromosomes, particularly in rice-infecting isolates. When expressed in M. oryzae, most of the AVR-Pita homologs could elicit Pita-mediated resistance, even those from non-rice isolates. AVR-Pita was flanked by a retrotransposon, which presumably contributed to its multiple translocation across the genome. On the other hand, family member AVR-Pita3, which lacks avirulence activity, was stably located on chromosome 7 in a vast majority of isolates. These results suggest that the diversification in genome location of AVR-Pita in the rice isolates is a consequence of recognition by Pita in rice. We propose a model that the multiple translocation of AVR-Pita may be associated with its frequent loss and recovery mediated by its transfer among individuals in asexual populations. This model implies that the high mobility of AVR-Pita is a key mechanism accounting for the rapid adaptation toward Pita. Dynamic adaptation of some fungal plant pathogens may be achieved by deletion and recovery of avirulence genes using a population as a unit of adaptation.     

The expression of a bean PGIP in transgenic wheat confers increased resistance to the fungal pathogen Bipolaris sorokiniana

A possible strategy to control plant pathogens is the improvement of natural plant defense mechanisms against the tools that pathogens commonly use to penetrate and colonize the host tissue. One of these mechanisms is represented by the host plant's ability to inhibit the pathogen's capacity to degrade plant cell wall polysaccharides. Polygalacturonase-inhibiting proteins (PGIP) are plant defense cell wall glycoproteins that inhibit the activity of fungal endopolygalacturonases (endo-PGs). To assess the effectiveness of these proteins in protecting wheat from fungal pathogens, we produced a number of transgenic wheat lines expressing a bean PGIP (PvPGIP2) having a wide spectrum of specificities against fungal PGs. Three independent transgenic lines were characterized in detail, including determination of the levels of PvPGIP2 accumulation and its subcellular localization and inhibitory activity. Results show that the transgene-encoded protein is correctly secreted into the apoplast, maintains its characteristic recognition specificities, and endows the transgenic wheat with new PG recognition capabilities. As a consequence, transgenic wheat tissue showed increased resistance to digestion by the PG of Fusarium moniliforme. These new properties also were confirmed at the plant level during interactions with the fungal pathogen Bipolaris sorokiniana. All three lines showed significant reductions in symptom progression (46 to 50%) through the leaves following infection with this pathogen. Our results illustrate the feasibility of improving wheat's defenses against pathogens by expression of proteins with new capabilities to counteract those produced by the pathogens.     

Genetic variation in Drechslera teres populations as indicated by RAPD markers

Random amplified polymorphic DNA (RAPD) was used to assess genetic variation among 48 isolates of Drechslera teres originating from different sites in Finland. RAPD profiles were generated with five arbitrary 10-mer primers and revealed polymorphisms suitable for screening differentiation in this fungal population. Using UPGMA clustering analysis, a similarity coefficient of approximately 63% was observed between all D. teres isolates studied. The variation was, however, distributed on a small scale as different genotypes were found from the same plant. The isolates could not be grouped according to geographic origin, aggressiveness, growth rate or morphological features, indicating that the primers used in this study were neutral markers for these characters. The primers were, however, able to differentiate between isolates of Helminthosporium species (D. teres, Drechslera graminea and Bipolaris sorokiniana).     

Assessment of diversity,distribution and antibacterial activity of endophytic fungi isolated from a medicinal plant <Emphasis Type="Italic">Adenocalymma alliaceum</Emphasis> Miers

A study was conducted for isolation, identification and antibacterial potential of fungal endophytes of Adenocalymma alliaceum Miers., (Bignoniaceae), a medicinal shrub vine plant which has long history for its usages in curing various disorders. A total of 149 isolates of endophytic fungi representing 17 fungal taxa were obtained from 270 segments (90 from each stem, leaf and petiole) of this plant. Hyphomycetes (77.85%) were the most prevalent, followed by Ascomycetes (8.05%) and Coelomycetes (4.03%) respectively. A considerable amount of fungal isolates was kept under (10.07%) Mycelia-Sterilia (MS). Leaf harboured maximum colonization of endophytic fungi (72.22%) which was greater than stem (67.78%) and petiole (25.54%). The Jc similarity index was maximum (0.619) between stem vs leaf followed by leaf vs petiole (0.571) and stem vs petiole (0.428). The dominant endophytic fungi were Alternaria alternata, Aspergillus niger, Stenella agalis, Fusarium oxysporum, Curvularia lunata and Fusarium roseum. Among twelve endophytic fungi tested for antibacterial activity, crude extracts of nine endophytic fungi (75%), showed antibacterial potential against one or more clinical human pathogens. Alternaria alternata, Curvularia lunata, Penicillium sp. and Chaetomium globosum exhibited significant antibacterial activity against 4 of 5 tested pathogens, showing broad spectrum activity. This investigation explains the value of sampling from different tissues of a host plant for the greater species diversity, and additionally, the antibacterial screening of some endophytic fungi from this specific medicinal plant may represent a unique source for many of the useful antibacterial compounds.     

Production and partial characterization of bacteriocin-like pepitdes by Bacillus licheniformis ZJU12

Bacillus licheniformis ZJU12, which was isolated from soil, could produce bacteriocin-like peptides that exhibited a broad spectrum of antagonistic activity against various species of Gram-positive bacteria and fungal pathogens, but not against Gram-negative bacteria tested except Xanthomonas oryzae pv. oryzae, a rice pathogen. The bacteriocin-like peptides were sensitive to proteinase K and trypsin. The activity was stable during temperature exposure up to 100 °C for 30 min, but lost completely at 121 °C for 15 min. The cell-free supernatant of B. licheniformis ZJU12 was shown to retain the activity within the pH range of 2–9, and the optimum pH for the activity was about 6.5. No adverse effect of the antagonistic compound to mice was observed in acute toxicity tests with the dose of 0.8 mg/20 g.     

Biodegradation of aliphatic hydrocarbon by indigenous fungi isolated from used motor oil contaminated sites

Eighteen indigenous fungal isolates has been successfully isolated from samples of used motor oil, top five centimetres of soil and drainage water contaminated with used motor oil. All of the pure fungal isolates obtained were identified, characterized and subjected to preliminary screening by evaluating the average growth rate of each fungal isolates on minimal media containing 1% (v/v) used motor oil. Trichoderma asperellum strain TUB F-1067 (SA4), Trichoderma asperellum strain Tr48 (SA5), Trichoderma asperellum strain TUB F-756 (SA6), Penicillium species (P1), and Aspergillus species (P9) were further selected for their hydrocarbon biodegradation potential. Among these five fungal isolates selected, P1 strain presented a significant degree of degradation by degrading almost all of the n-alkanes (n-C-₁₅ to n-C-₂₃ range) present in the used motor oil, thus of greater potential in degrading the aliphatic hydrocarbon compounds of used motor oil. The authors would like to certify that the work have not been sent/considered to be published in other journals.     

Molecular and phenotypic characterization of potential plant growth-promoting <Emphasis Type="Italic">Pseudomonas</Emphasis> from rice and maize rhizospheres

In this study, Pseudomonas species were isolated from the rhizospheres of two plant hosts: rice (Oryza sativa cultivar Pathum Thani 1) and maize (Zea mays cultivar DK888). The genotypic diversity of isolates was determined on basis of amplified rDNA restriction analysis (ARDRA). This analysis showed that both plant varieties selected for two distinct populations of Pseudomonas. The actual biocontrol and plant promotion abilities of these strains was confirmed by bioassays on fungal (Verticillum sp., Rhizoctonia solani and Fusarium sp.) and bacterial (Ralstonia solanacearum and Bacillus subtilis) plant pathogens, as well as indole-3-acetic acid (IAA) production and carbon source utilization. There was a significant difference between isolates from rice and maize rhizosphere in terms of biological control against R.  solanacearum and B.  subtilis. Interestingly, none of the pseudomonads isolated from maize rhizosphere showed antagonistic activity against R.  solanacearum. This study indicated that the percentage of pseudomonad isolates obtained from rice rhizosphere which showed the ability to produce fluorescent pigments was almost threefold higher than pseudomonad isolates obtained from maize rhizosphere. Furthermore, the biocontrol assay results indicated that pseudomonad isolated from rice showed a higher ability to control bacterial and fungal root pathogens than pseudomonad isolates obtained from maize. This work clearly identified a number of isolates with potential for use as plant growth-promoting and biocontrol agents on rice and maize.     

Antifungal activity of Bacillus sp. isolated from compost

Four strains ofBacillus isolated from lupine compost exhibited an antifungal activity against six plant fungal pathogens (Rhizoctonia solani, Bipolaris sorokiniana, Sclerotinia sclerotiorum, Trichothecium roseum, Fusarium solani, Fusarium oxysporum). It was significantly influenced by the composition of the cultivation media.     

Detection of mutagens produced by fungi with the Salmonella typhimurium assay.

Forty-one fungal isolates (one isolate per species) representing common plant pathogens and food crop contaminants were grown on sterile, polished rice and assayed for mutagenic activity in the Salmonella typhimurium-microsome system. Initially, single doses of aqueous and chloroform extracts of the moldy rice were assayed against the TA100 tester strain by incorporating extracts into the growth medium and by applying small quantities on disks placed on the agar surface. Suspected activity was examined further by analysis of several doses in the plate incorporation assay. Extracts of two aflatoxin-producing isolates (Aspergillus flavus and A. parasiticus) showed pronounced mutagenic activity, as did extracts of five other isolates (A. heterothallicus, A. nidulans, A. terricola, Alternaria tenuis, and Fusarium moniliforme) which did not contain detectable aflatoxins. Seven additional isolates (Botrytis cineria, Ceratocystis fimbriata, Cladosporium herbarum, Fusarium solani f. sp. pisi, Penicillium oxalicum, Thermomyces lanuginosus, and Verticilium albo-atrum) revealed activity which was possibly mutagenic; i.e., mutagenic responses were not observed in both the disk and incorporation assays, and clear dose-related activity was not observed in the incorporation assay. Extracts of the remaining fungi were not mutagenic in the bacterial assay.