RNAi-mediated resistance to Potato spindle tuber viroid in transgenic tomato expressing a viroid hairpin RNA construct

Because of their highly ordered structure, mature viroid RNA molecules are assumed to be resistant to degradation by RNA interference (RNAi). In this article, we report that transgenic tomato plants expressing a hairpin RNA (hpRNA) construct derived from Potato spindle tuber viroid (PSTVd) sequences exhibit resistance to PSTVd infection. Resistance seems to be correlated with high-level accumulation of hpRNA-derived short interfering RNAs (siRNAs) in the plant. Thus, although small RNAs produced by infecting viroids [small RNAs of PSTVd (srPSTVds)] do not silence viroid RNAs efficiently to prevent their replication, hpRNA-derived siRNAs (hp-siRNAs) appear to effectively target the mature viroid RNA. Genomic mapping of the hp-siRNAs revealed an unequal distribution of 21- and 24-nucleotide siRNAs of both (+)- and (–)-strand polarities along the PSTVd genome. These data suggest that RNAi can be employed to engineer plants for viroid resistance, as has been well established for viruses.     

Potato spindle tuber viroid as inducer of RNA silencing in infected tomato.

Potato spindle tuber viroid (PSTVd), an RNA plant pathogen encoding no known proteins, induces systemic symptoms on tomato plants. We report detection of small RNAs of approximately 25 nucleotides with sequence specificity to PSTVd in infected plants: an indication of the presence of RNA silencing. RNA silencing, however, did not appear to be responsible for the differing symptoms induced by a mild and a severe strain of PSTVd. The unique structural and biological features of viroids make them attractive experimental tools to investigate mechanisms of RNA silencing and pathogen counterdefense.     

Evidence for the existence of the loop E motif of Potato spindle tuber viroid in vivo

RNA motifs comprising nucleotides that interact through non-Watson-Crick base pairing play critical roles in RNA functions, often by serving as the sites for RNA-RNA, RNA-protein, or RNA small ligand interactions. The structures of viral and viroid RNA motifs are studied commonly by in vitro, computational, and mutagenesis approaches. Demonstration of the in vivo existence of a motif will help establish its biological significance and promote mechanistic studies on its functions. By using UV cross-linking and primer extension, we have obtained direct evidence for the in vivo existence of the loop E motif of Potato spindle tuber viroid. We present our findings and discuss their biological implications.     

Virp1 is a host protein with a major role in Potato spindle tuber viroid infection in Nicotiana plants

Viroids are small, circular, single-stranded RNA molecules that, while not coding for any protein, cause several plant diseases. Viroids rely for their infectious cycle on host proteins, most of which are likely to be involved in endogenous RNA-mediated phenomena. Therefore, characterization of host factors interacting with the viroid may contribute to the elucidation of RNA-related pathways of the hosts. Potato spindle tuber viroid (PSTVd) infects several members of the Solanaceae family. In an RNA ligand screening we have previously isolated the tomato protein Virp1 by its ability to specifically interact with PSTVd positive-strand RNA. Virp1 is a bromodomain-containing protein with an atypical RNA binding domain and a nuclear localization signal. Here we investigate the role of Virp1 in the viroid infection cycle by the use of transgenic lines of Nicotiana tabacum and Nicotiana benthamiana that either overexpress the tomato Virp1 RNA or suppress the orthologous Nicotiana genes through RNA silencing. Plants of the Virp1-suppressed lines were not infected by PSTVd or Citrus exocortis viroid through mechanical inoculation, indicating a major role of Virp1 in viroid infection. On the other hand, overexpression of tomato Virp1 in N. tabacum and N. benthamiana plants did not affect PSTVd KF 440-2 infectivity or symptomatology in these species. Transfection experiments with isolated protoplasts revealed that Virp1-suppressed cells were unable to sustain viroid replication, suggesting that resistance to viroid infection in Virp1-suppressed plants is likely the result of cell-autonomous events.     

Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants

The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid.     

Characterization of nuclear import of potato spindle tuber viroid RNA in permeabilized protoplasts

Most viroids replicate in the nuclei of infected plant cells. Nuclear import of the incoming RNA thus represents a key control point for establishment of a systemic infection. However, little is known about the mechanisms by which viroids are transported into the nucleus. We have characterized nuclear import of infectious, fluorescein-labeled potato spindle tuber viroid (F-PSTVd) in permeabilized tobacco BY2 cells. Import was observed for F-PSTVd but not for mRNA fragments of the same size or two viroids believed to replicate in the chloroplasts. Import of F-PSTVd was inhibited by addition of a 10-fold excess of non-fluorescent PSTVd but not by similar amounts of control RNAs. Import was not inhibited by pre-incubation with GTP-γ-S or GDP-β-S, however. Disruption of microtubules and actin filaments with oryzalin or cytochalasin D did not inhibit F-PSTVd import. Taken together, our results indicate that (i) PSTVd possesses a sequence and/or structural motif for nuclear import and (ii) the import is a cytoskeleton-independent process that is mediated by a specific and saturable receptor. Insensitivity to GTP-γ-S and GDP-β-S treatment suggests that PSTVd import is not coupled to Ran GTPase cycle, which mediates nuclear transport of many proteins and nucleic acids. To our knowledge, our studies are the first to examine the mechanisms of nuclear transport of RNA in plants.     

Resistance of tomato infected with cucumber mosaic virus satellite RNA to potato spindle tuber viroid

Tomato (Lycopersicon esculentum cvs Rutgers and Lichun) plants were firstly pre-inoculated either with a cucumber mosaic virus (CMV) isolate containing satellite RNA (CMV-S52) or with a CMV isolate without satellite RNA, and then challenged 14 days later with a severe strain of potato spindle tuber viroid (PSTVd). Also, tomato plants transformed with CMV satellite cDNA and non-transgenic control plants were directly inoculated with PSTVd. Protection effects were assessed by the observation of symptoms and by assay of PSTVd accumulation in tomato plants using return polyacrylamide gel electrophoresis and silver staining. The results indicated that the satellite-transgenic plants and plants pre-inoculated with CMV-S52 showed much milder symptoms of PSTVd infection than the respective control plants. The concentration of PSTVd RNA in the satellite-transgenic plants and CMV-S52 pre-inoculated plants was reduced to about 0.02-0.03 of the controls. PSTVd infection did not increase the amount of satellite ds-RNA in plants. It is concluded that the plant resistance to PSTVd is induced by the presence of satellite RNA rather than the CMV infection. It is suggested that as there is considerable sequence similarity between satellite RNA and PSTVd, base pairings may be a cause of reduction of both symptoms and the accumulation of PSTVd.     

Resistance of tomato infected with cucumber mosaic virus satellite RNA to potato spindle tuber viroid

Tomato (Lycopersicon esculentum cvs Rutgers and Lichun) plants were firstly pre-inoculated either with a cucumber mosaic virus (CMV) isolate containing satellite RNA (CMV-S52) or with a CMV isolate without satellite RNA, and then challenged 14 days later with a severe strain of potato spindle tuber viroid (PSTVd). Also, tomato plants transformed with CMV satellite cDNA and non-transgenic control plants were directly inoculated with PSTVd. Protection effects were assessed by the observation of symptoms and by assay of PSTVd accumulation in tomato plants using return polyacrylamide gel electrophoresis and silver staining. The results indicated that the satellite-transgenic plants and plants pre-inoculated with CMV-S52 showed much milder symptoms of PSTVd infection than the respective control plants. The concentration of PSTVd RNA in the satellite-transgenic plants and CMV-S52 pre-inoculated plants was reduced to about 0.02–0.03 of the controls. PSTVd infection did not increase the amount of satellite ds-RNA in plants. It is concluded that the plant resistance to PSTVd is induced by the presence of satellite RNA rather than the CMV infection. It is suggested that as there is considerable sequence similarity between satellite RNA and PSTVd, base pairings may be a cause of reduction of both symptoms and the accumulation of PSTVd.     

Characterization of the RNA motif responsible for the specific interaction of potato spindle tuber viroid RNA (PSTVd) and the tomato protein Virp1

Viroids are small non-coding parasitic RNAs that are able to infect their host plants systemically. This circular naked RNA makes use of host proteins to accomplish its proliferation. Here we analyze the specific binding of the tomato protein Virp1 to the terminal right domain of potato spindle tuber viroid RNA (PSTVd). We find that two asymmetric internal loops within the PSTVd (+) RNA, each composed of the sequence elements 5′-ACAGG and CUCUUCC-5′, are responsible for the specific RNA–protein interaction. In view of the nucleotide composition we call this structural element an ‘RY motif’. The RY motif located close to the terminal right hairpin loop of the PSTVd secondary structure has an ~5-fold stronger binding affinity than the more centrally located RY motif. Simultaneous sequence alterations in both RY motifs abolished the specific binding to Virp1. Mutations in any of the two RY motifs resulted in non-infectious viroid RNA, with the exception of one case, where reversion to sequence wild type took place. In contrast, the simultaneous exchange of two nucleotides within the terminal right hairpin loop of PSTVd had only moderate influence on the binding to Virp1. This variant was infectious and sequence changes were maintained in the progeny. The relevance of the phylogenetic conservation of the RY motif, and sequence elements therein, amongst various genera of the family Pospiviroidae is discussed.     

Direct role of a viroid RNA motif in mediating directional RNA trafficking across a specific cellular boundary

The plasmodesmata and phloem form a symplasmic network that mediates direct cell-cell communication and transport throughout a plant. Selected endogenous RNAs, viral RNAs, and viroids traffic between specific cells or organs via this network. Whether an RNA itself has structural motifs to potentiate trafficking is not well understood. We have used mutational analysis to identify a motif that the noncoding Potato spindle tuber viroid RNA evolved to potentiate its efficient trafficking from the bundle sheath into mesophyll that is vital to establishing systemic infection in tobacco (Nicotiana tabacum). Surprisingly, this motif is not necessary for trafficking in the reverse direction (i.e., from the mesophyll to bundle sheath). It is not required for trafficking between other cell types either. We also found that the requirement for this motif to mediate bundle sheath-to-mesophyll trafficking is dependent on leaf developmental stages. Our results provide genetic evidence that (1) RNA structural motifs can play a direct role in mediating trafficking across a cellular boundary in a defined direction, (2) the bundle sheath-mesophyll boundary serves as a novel regulatory point for RNA trafficking between the phloem and nonvascular tissues, and (3) the symplasmic network remodels its capacity to traffic RNAs during plant development. These findings may help further studies to elucidate the interactions between RNA motifs and cellular factors that potentiate directional trafficking across specific cellular boundaries.     

Abiotic stress responses promote Potato virus A infection in Nicotiana benthamiana

The effect of abiotic stress responses on Potato virus A (PVA; genus Potyvirus) infection was studied. Salt, osmotic and wounding stress all increased PVA gene expression in infected Nicotiana benthamiana leaves. According to the literature, an early response to these stresses is an elevation in cytosolic Ca(2+) concentration. The infiltration of 0.1 m CaCl(2) into the infected leaf area enhanced the translation of PVA RNA, and this Ca(2+) -induced effect was more profound than that induced solely by osmotic stress. The inhibition of voltage-gated Ca(2+) channels within the plasma membrane abolished the Ca(2+) effect, suggesting that Ca(2+) had to be transported into the cytosol to affect viral gene expression. This was also supported by a reduced wounding effect in the presence of the Ca(2+) -chelating agent ethylene glycol tetraacetic acid (EGTA). In the absence of viral replication, the intense synthesis of viral proteins in response to Ca(2+) was transient. However, a Ca(2+) pulse administered at the onset of wild-type PVA infection enhanced the progress of infection within the locally infected leaf, and the virus appeared earlier in the systemic leaves than in the control plants. This suggests that the cellular environment was thoroughly modified by the Ca(2+) pulse to support viral infection. One message of this study is that the sensing of abiotic stress, which leads to cellular responses, probably via Ca(2+) signalling, associated with enhanced virus infection, may lead to higher field crop losses. Therefore, the effect of abiotic stress on plant viral infection warrants further analysis.     

Potato spindle tuber viroid strains of different pathogenicity induces and suppresses expression of common and unique genes in infected tomato

Viroids are the smallest plant pathogens. These RNAs do not encode proteins and are not encapsidated, and yet they can replicate autonomously, move systemically, and cause diseases in infected plants. Notably, strains of a viroid with subtle differences in nucleotide sequences can cause dramatically different symptoms in infected plants. These features make viroids unique probes to investigate the role of a pathogenic RNA genome in triggering host responses. We conducted a comprehensive analysis of the differential gene expression patterns of tomato plants at various stages of infection by a mild and severe strain of Potato spindle tuber viroid (PSTVd). We also compared tomato gene expression altered by the PSTVd strains with that altered by Tobacco mosaic virus (TMV). Our analyses revealed that the two PSTVd strains altered expression of both common and unique tomato genes. These genes encode products involved in defense/stress response, cell wall structure, chloroplast function, protein metabolism, and other diverse functions. Five genes have unknown functions. Four genes are novel. The expression of some but not all of these genes was also altered by TMV infection. Our results indicate that viroids, although structurally simple, can trigger complex host responses. Further characterization of viroid-altered gene expression in a host plant should help understand viroid pathogenicity and, potentially, the mechanisms of RNA-mediated regulation of plant gene expression.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

A multifunctional protein encoded by turkey herpesvirus suppresses RNA silencing in Nicotiana benthamiana

Many plant and animal viruses counteract RNA silencing-mediated defense by encoding diverse RNA silencing suppressors. We characterized HVT063, a multifunctional protein encoded by turkey herpesvirus (HVT), as a silencing suppressor in coinfiltration assays with green fluorescent protein transgenic Nicotiana benthamiana line 16c. Our results indicated that HVT063 could strongly suppress both local and systemic RNA silencing induced by either sense RNA or double-stranded RNA (dsRNA). HVT063 could reverse local silencing, but not systemic silencing, in newly emerging leaves. The local silencing suppression activity of HVT063 was also verified using the heterologous vector PVX. Further, single alanine substitution of arginine or lysine residues of the HVT063 protein showed that each selected single amino acid contributed to the suppression activity of HVT063 and region 1 (residues 138 to 141) was more important, because three of four single amino acid mutations in this region could abolish the silencing suppressor activity of HVT063. Moreover, HVT063 seemed to induce a cell death phenotype in the infiltrated leaf region, and the HVT063 dilutions could decrease the silencing suppressor activity and alleviate the cell death phenotype. Collectively, these results suggest that HVT063 functions as a viral suppressor of RNA silencing that targets a downstream step of the dsRNA formation in the RNA silencing process. Positively charged amino acids in HVT063, such as arginine and lysine, might contribute to the suppressor activity by boosting the interaction between HVT063 and RNA, since HVT063 has been demonstrated to be an RNA binding protein.     

A novel conserved targeting motif found in ABCA transporters mediates trafficking to early post-Golgi compartments

The ATP binding cassette, class A (ABCA) proteins are homologous polytopic transmembrane transporters that function as lipid pumps at distinct subcellular sites in a variety of cells. Located within the N terminus of these transporters, there exists a highly conserved xLxxKN motif of unknown function. To define its role, human ABCA3 was employed as a primary model representing ABCA transporters, while mouse ABCA1 was utilized to support major findings. Transfection studies showed colocalization of both transporters with surfactant protein C (SP-C), a marker peptide for successful protein targeting to lysosomal-like organelles. In contrast, alanine mutation of xLxxKN resulted in endoplasmic reticulum retention. As proof of principle, swapping xLxxKN for the known lysosomal targeting motif of SP-C resulted in post-Golgi targeting of the SP-C chimera. However, these products failed to reach their terminal processing compartments, suggesting that the xLxxKN motif only serves as a Golgi exit signal. We propose a model whereby an N-terminal signal sequence, xLxxKN, directs ABCA transporters to a post-Golgi vesicular sorting station where additional signals may be required for selective delivery of individual transporters to final subcellular destinations.