共查询到20条相似文献,搜索用时 15 毫秒
1.
Sex chromosome aberrations and stature: deduction of the principal factors involved in the determination of adult height 总被引:3,自引:0,他引:3
Although sex chromosome aberrations are frequently associated with statural changes, the underlying factors have not been clarified. To define the factors leading to the statural changes, we took the following three steps: (1) determination of the mean adult height in non-mosaic Caucasian patients with sex chromosome aberrations reported in the literature (assessment of genetic height potential); (2) assessment of the validity of factors that could influence stature; and (3) correlation of the mean adult height with the effects of specific growth-related factors. The results indicate that the adult height in patients with sex chromosome aberrations may primarily be defined by the dosage effect of pseudoautosomal and Y-specific growth genes, together with the degree of growth disadvantage caused by alteration of the quantity of euchromatic or non-inactivated region. 相似文献
2.
K. R. Held S. Kerber E. Kaminsky S. Singh P. Goetz E. Seemanova H. W. Goedde 《Human genetics》1992,88(3):288-294
Summary Cytogenetic and molecular genetic findings in 91 patients with Turner syndrome are reported. In 87 patients, chromosome studies were carried out both in lymphocyte and fibroblast cultures. Mosaicism was demonstrated in 58 of these patients (66.7%), whereas only 18 (20.7%) were apparent non-mosaic 45,X, and 11 patients (12.6%) showed non-mosaic structural aberrations of the X chromosome. Among the mosaic cases 16 (18.4% of all patients) displayed a second cell line containing small marker chromosomes. The association of Y-specific chromosomal material with the presence of marker chromosomes was demonstrated in 6 out of 7 mixoploid fibroblast cell lines by polymerase chain reaction amplification and by Southern-blot analysis. The observation of ring formation and morphological variability in vivo and in vitro, and the continous reduction in the percentage of cells containing marker chromosomes in longterm cultivation experiments indicated an increased instability of marker chromosomes. The findings suggest that in vivo selection of structurally altered sex chromosomes exists. Thus, the observation of apparent non-mosaic 45,X chromosomal complements in liveborn individuals with Turner syndrome does not contradict the hypothesis that some degree of mosaicism is necessary for survival in early pregnancy. 相似文献
3.
OBJECTIVE: To delineate the phenotypic spectrum (clinical and gonadal features) from patients with a 45,X/46,X,mar(Y) karyotype based upon of their clinical, histological, cytogenetic and molecular evaluation. SUBJECTS: Three patients with a 45,X/46,X,mar(Y) karyotype. METHODS: Clinical assessment, karyotyping, endocrine evaluation, FISH and PCR analyses of several Y-chromosome loci and direct sequencing of the SRY gene. RESULTS: The patients, two males and one female had varying degrees of impairment of sexual differentiation, with or without testis formation. One patient (reared as female and aged 17 years) had Turner syndrome with bilateral streak gonads. The second patient (2.4 years old) had ambiguous genitalia and presented a dysgenetic testis with a contralateral streak gonad. A third patient (26 years old) had bilateral dysgenetic testes (dysgenetic male pseudohermaphroditism). The ratio of 45,X vs. 46,X,+mar(Y) cells differed between patients and between different tissues. In each case the marker sexual chromosome was identified as a rearranged Y-chromosome (idic(Y)) using FISH and PCR analyses. In all cases the SRY gene was present in all tissues studied. No mutations were identified in this gene in any of the patients. CONCLUSIONS: The extent of male or female differentiation in these patients depends in part on the prevalence, time occurrence, and distribution of the 45,X cell line. 相似文献
4.
Lacka K 《Endokrynologia Polska》2005,56(6):986-993
Turner's syndrome is defined as a congenital disease determining by quantitative and/or structural aberrations of one from two X chromosomes with frequent presence of mosaicism. Clinically it is characterized by growth and body proportion abnormalities, gonadal dysgenesis resulting in sexual infantilism, primary amenorrhoea, infertility, characteristic stigmata, anomalies of heart, renal and bones and the presence of some diseases like Hashimoto thyroiditis with hypothyroidism, diabetes mellitus type 2, osteoporosis, hypertension. Turner's syndrome occurs in 1:2000 to 1:2500 female livebirth. The most frequent X chromosome aberrations in patients with phenotype of Turner syndrome are as follows: X monosomy - 45,X; mosaicism (50-75%), including 45,X/46,XX (10-15%), 45,X/46,XY (2-6%), 45,X/46,X,i(Xq), 45,X/46,X,del(Xp), 45,X/46,XX/47,XXX; aberration of X structure: total or partial deletion of short arm of X chromosome (46,X,del(Xp)) isochromosom of long arm of X chromosome (46,X,(i(Xq)), ring chromosome (46, X,r(X)), marker chromosome (46,X+m). Searching of X chromosome and mapping and sequencing of genes located at this chromosome (such as SHOX, ODG2, VSPA, SOX 3) have made possible to look for linkage between phenotypes and adequate genes or regions of X chromosome. In this paper current data concerning correlation between phenotype and karyotype in patients with TS have been presented. 相似文献
5.
A Kleczkowska E Dmoch E Kubien J P Fryns H Van den Berghe 《Genetic counseling (Geneva, Switzerland)》1990,1(3-4):227-233
In this report, we present the cytogenetic findings in 478 patients with Turner syndrome diagnosed in Leuven in the period 1965-1989. The karyotypic anomalies are classified into seven groups: 1) classic, 45,X karyotype (52.1%); 2) mosaic 45,X/46,XX (10.9%); 3) mosaic 45,X/47,XXX and other "super-female" cell lines (4.6%); 4) isochromosomes i(Xq) and i(Xp) (16.1%); 5) ring chromosomes r(X) (4.4%); 6) other structural aberrations of the X chromosome (7.7%); and finally 7) mosaic 45,X/46,XY patients (4%). The most pertinent chromosomal findings are briefly discussed and compared with previous reported surveys on subject. 相似文献
6.
Uniparental disomy of the entire X chromosome in a female with Duchenne muscular dystrophy. 总被引:6,自引:0,他引:6 下载免费PDF全文
F Quan J Janas S Toth-Fejel D B Johnson J K Wolford B W Popovich 《American journal of human genetics》1997,60(1):160-165
Duchenne muscular dystrophy (DMD) is a severe, progressive, X-linked muscle-wasting disorder with an incidence of approximately 1/3,500 male births. Females are also affected, in rare instances. The manifestation of mild to severe symptoms in female carriers of dystrophin mutations is often the result of the preferential inactivation of the X chromosome carrying the normal dystrophin gene. The severity of the symptoms is dependent on the proportion of cells that have inactivated the normal X chromosome. A skewed pattern of X inactivation is also responsible for the clinical manifestation of DMD in females carrying X;autosome translocations, which disrupt the dystrophin gene. DMD may also be observed in females with Turner syndrome (45,X), if the remaining X chromosome carries a DMD mutation. We report here the case of a karyotypically normal female affected with DMD as a result of homozygosity for a deletion of exon 50 of the dystrophin gene. PCR analysis of microsatellite markers spanning the length of the X chromosome demonstrated that homozygosity for the dystrophin gene mutation was caused by maternal isodisomy for the entire X chromosome. This finding demonstrates that uniparental isodisomy of the X chromosome is an additional mechanism for the expression of X-linked recessive disorders. The proband's clinical presentation is consistent with the absence of imprinted genes (i.e., genes that are selectively expressed based on the parent of origin) on the X chromosome. 相似文献
7.
8.
Rocha MN Melo MR Longui CA de Oliveira DV Figueiredo CC Pacchi PR 《Genetics and molecular research : GMR》2005,4(4):749-754
Turner syndrome (TS) is one of the most common human chromosomal abnormalities; it is characterized by the presence of one normal X chromosome and the complete or partial loss of the second X chromosome. The early recognition of TS patients allows for adequate therapy for short stature and pubertal sex steroid substitution. We developed a cost-effective molecular diagnostic tool that can be used to identify 45,X TS patients from dried blood spots, for possible use in neonatal screening for TS. We used a three-step method for 45,X TS detection: i) DNA extraction from dried blood spot samples, ii) pre-PCR HpaII digestion (methylation-sensitive enzyme) and iii) GeneScan analysis of selected cases. DAX-1 gene amplification was used to recognize DNA integrity, and the androgen receptor gene (Xq11-12), which is both a highly polymorphic and methylated gene, was used to determine the number of X chromosome alleles. Using this three-step diagnostic procedure, we detected apparent TS in 1/304 (0.33%) samples; such individuals should be submitted to clinical examination and karyotype confirmation. The three-step 45,X TS neonatal screening protocol is a simple, reliable, fast (under 30 h) and cost-effective diagnostic tool, useful for the neonatal detection of TS. 相似文献
9.
Summary Steroid sulphatase (STS) activity was measured with two different steroid substrates in leucocytes from normal human males and females, from females heterozygous for STS deficiency and recessive X-linked ichthyosis, and from individuals with numerical X chromosome aberrations. The results indicate non-inactivation with a partial gene dosage compensation at the STS locus. It is estimated that STS loci on inactive X chromosomes express approximately 45% of the STS activity originating from STS loci on active X chromosomes. It is also demonstrated that 45.XO (Turner syndrome) and 47,XXY (Klinefelter syndrome) individuals have abnormal STS enzyme levels compared with normal women and men, respectively.Supported by the Danish Cancer Society 相似文献
10.
Makoto Higurashi Kumiko Iijima Norihiko Ishikawa Hiroki Hoshina Nobuo Watanabe 《Human genetics》1979,46(2):163-172
Summary In order to ascertain the frequency of chromosome aberrations among newborn infants in Japan, a chromosome survey of a large number of newborn infants is in progress. A consecutive series of 12,319 newborn babies, 6382 male and 5937 female, have been screened for clinical manifestations of autosomal aberrations and for sex chromatin and sex chromosome aberrations. Chromosome studies were carried out on 694 infants with suspected chromosome aberrations. The clinically abnormal infants were screened by conventional staining, and banding techniques have been used in the part of the study performed since 1974. Of the clincally abnormal infants, 25 had abnormal karyotypes, including two males with a 47,XXY complement, one female with a 45,X complement, three male infants with a 47,XYY complement, two with trisomy 13 syndrome, three with trisomy 18 (including one case of mosaicism), eleven with Down's syndrome (including one case of mosaicism), one with B5p partial trisomy, one with cri-du-chat syndrome, and one with Y/D translocation. The overall results are comparable to those of previous population cytogenetic studies only in the autosomal trisomies and sex chromosome abnormalities and in that the observed frequencies were comparable to those found in studies in Caucasians.To whom offprint requests should be sent 相似文献
11.
The co-occurrence of two numerical chromosomal abnormalities in same individual (double aneuploidy) is relatively rare and its clinical presentations are variable depending on the predominating aneuploidy or a combination effect of both. Furthermore, double aneuploidy involving both autosomal and sex chromosomes is seldom described. In this study, we present three patients with double aneuploidy involving chromosome 21 and sex chromosomes. They all had the classical non disjunction trisomy 21; that was associated with monosomy X in two of them and double X in the other. Clinically, they had most of the phenotypic features of Down syndrome as well as variable features characteristic of Turner or Klinefelter syndrome. Cytogenetic studies and fluorescence in situ hybridization (FISH) analysis were carried out for all patients and their parents. The first patient was a male, mosaic with 2 cell lines (45,X/47,XY,+21) by regular banding techniques and had an affected sib with Down syndrome (47,XY,+21). The second was a female, mosaic (46,X,+21/47,XX,+21) where monosomy X was detected only by FISH in 15 percentages of cells, nevertheless, stigmata of Turner syndrome was more obvious in this patient. The third patient had non mosaic double trisomy; Down-Klinefelter (48,XXY,+21) presented with Down syndrome phenotype. Parental karyotypes and FISH studies for these patients were normal with no evidence of mosaicism. In this report, we review the variable clinical presentations among the few reported cases with the same aneuploidy in relation to ours. Also, the proposed mechanisms of double aneuploidy and the occurrence of non-disjunction in more than one family member are discussed. This study emphasizes the importance of molecular cytogenetics studies for more than one tissue in cases with atypical features of characteristic chromosomal aberration syndromes. To our knowledge, this is the first report of double aneuploidy, Down-Turner and Down-Klinefelter syndromes in Egyptian patients. 相似文献
12.
Gravholt CH 《Hormone research》2005,64(Z2):86-93
Turner syndrome is a common genetic disorder associated with abnormalities of the X chromosome and occurs in about 50 per 100,000 liveborn girls. It is associated with reduced adult height, gonadal dysgenesis and thus insufficient circulating levels of female sex steroids and infertility. Morbidity and mortality are increased throughout the lifespan. The average intellectual performance is within the normal range. A number of recent clinical studies have given new insight particularly into the adult phase of Turner syndrome. Treatment with growth hormone during childhood and adolescence enables a considerable gain in adult height. In most cases puberty has to be induced and female sex hormone replacement therapy is given during adulthood. Type 2 diabetes is often seen, and hypertension and associated cardiovascular disorders are frequent. The proper treatments of these disorders have not been firmly established. Since the risk of cardiovascular and endocrinological disease is clearly elevated, proper care during adulthood is crucial. Cognition and social functioning are altered in Turner syndrome. 相似文献
13.
Kubota T Wakui K Nakamura T Ohashi H Watanabe Y Yoshino M Kida T Okamoto N Matsumura M Muroya K Ogata T Goto Y Fukushima Y 《Cytogenetic and genome research》2002,99(1-4):276-284
Turner syndrome females (45,X) do not have mental retardation (MR), whereas some mosaic ring X Turner syndrome females, with 45,X/46,X,r(X), have severe MR. The MR is believed to be caused by a failure of X chromosome inactivation (XCI) of the small ring X chromosome, which leads to functional X disomy (FXD), To explore this hypothesis, we examined the proportion of FXD cells in the peripheral blood of four ring X Turner syndrome females with various levels of MR, using two newly developed XCI assays based on DNA methylation of X-linked genes. As a result, the two patients with extremely severe MR showed complete FXD patterns, whereas the remaining two patients with relatively milder MR showed partial FXD patterns. These results indicate that the proportion of FXD cells may be associated with the severity of MR in mosaic ring X Turner syndrome females, although this association should be confirmed by examining brain cells during development. One of the cases with severe MR and a complete FXD pattern neither lacked the XIST gene nor had uniparental X isodisomy, and we discuss the mechanism of the failure of XCI in this case. 相似文献
14.
Kochi C Longui CA Lemos-Marini SH Guerra-Junior G Melo MB Calliari LE Monte O 《Genetics and molecular research : GMR》2007,6(1):1-7
Thirty-seven 45 X Turner syndrome patients with confirmed peripheral blood lymphocyte karyotype were initially selected to determine the origin of the retained X chromosome and to correlate it with their parents' stature. Blood samples were available in 25 families. The parental origin of the X chromosome was determined in 24 informative families through the analysis of the exon 1-CAG repeat variation of the androgen receptor gene. In 70.8% of the cases, the retained X chromosome was maternal in origin and 29.2% was paternal. When we classified the patients according to maternal (Xm) or paternal (Xp) X chromosome, there was a positive correlation between patients' and maternal heights only in the Xm group. There was no correlation with paternal height in either group, and a significant correlation with target height was only observed in the Xm group. In conclusion, maternal height is the best variable correlating with the height of 45 X Turner syndrome patients who retain the maternal X chromosome, suggesting a strong influence of genes located on the maternal X chromosome on stature. 相似文献
15.
Vaiman D 《Cytogenetic and genome research》2002,99(1-4):224-228
Because of its function, the X chromosome has a special status in mammalian genomes, with the specific occurrence of genes that influence both female and male fertility. Long ago, the XO karyotype (Turner syndrome) was associated with infertility, proving the correlation between normal X chromosome dosage and normal female fertility. Nevertheless, the search for specific X-borne fertility genes was not completely successful and suggested, instead, that female X-linked fertility, for example, depends upon groups of X-linked genes. Conversely, X-linked hyperfertility has been observed in sheep, where a mutation in BMP15 leads to a hyperfertile phenotype, but only in the heterozygous state. Many male fertility genes map to the X chromosome, consistent with a genetic model developed in the early 1990s. Ironically, NR0B1 (formerly DAX1), once presented as the paradigm of genes responsible for ovarian development and function, is probably one of these male fertility factors and is active in the maintenance of spermatogenesis. Indeed, duplications of this gene on the human X chromosome lead to XY sex reversal, as NR0B1 is able to counterbalance the effect in humans. Nevertheless, invalidation experiments in mice demonstrate the effect of this factor on male germ-cell production. 相似文献
16.
17.
Turner syndrome (TS) affects 1:2500 live females. It is caused by partial or complete absence of a sex chromosome. Patients with deletions of the distal segment of the short arm of X chromosome (Xp-) including haploinsufficiency of the SHOX (short stature homeobox) have, more often, short stature, skeletal abnormalities and hearing impairments. This article evaluates the current knowledge of the SHOX gene role in TS pathophysiology. Articles were searched from MEDLINE and LILACS databases, in the past 10 years, using the following keywords: Turner syndrome, SHOX gene, haploinsufficiency, short stature and hearing loss. As the inheritance of only one copy of the SHOX gene does not explain most of TS anomalies, more studies are needed to explain them. These studies will also improve understanding how SHOX participates in cartilage and bone growth and will help develop novel therapeutic strategies focused on SHOX-related disorders. 相似文献
18.
S Dahoun 《Annales de génétique》1990,33(1):52-55
A de novo paracentric inversion of the short arm of an X chromosome (p11.2p22.1) was observed in a 17-year-old girl studied because of primary amenorrhea and a Turner phenotype. To our knowledge this is only the second case of a paracentric inversion of the X chromosome short arm reported, the first having been briefly described in 1982, in a young lady with the Turner phenotype. In spite of its balanced appearance, there is little doubt that this rearrangement is the cause of the phenotypic anomalies of the patient, probably as the result of gene(s) modification(s) at the breakpoints on the X chromosome, or because the inverted gene sequence resulted in modifications by position effect. It has become increasingly difficult to recognize obvious phenotype-genotype correlations in Turner syndrome, given the multiplicity of chromosome rearrangements--some of them quite subtle--which are associated with ovarian dysgenesis. 相似文献
19.
This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome. 相似文献
20.
Summary The present report summarizes molecular studies of parental origin and sex chromosome mosaicism in forty-one 45,X conceptuses, consisting of 29 spontaneous abortions and 12 liveborn individuals with Turner syndrome. Our studies indicate that most 45,X conceptuses have a single, maternally derived X chromosome, regardless of whether the conceptus is liveborn or spontaneously aborted. In studies of mosaicism, our identification of X- and Y-chromosome mosaics among 45,X spontaneous abortions indicates that mosaicism does not ensure survival to term of 45,X fetuses. However, the incidence of sex chromosmome mosaicism is substantially higher in liveborn than in aborted 45,X conceptuses, indicating that the presence of a second cell line increases the likelihood of survival to term. 相似文献