Human Ku antigen tightly binds and stabilizes a tetrahelical form of the Fragile X syndrome d(CGG)n expanded sequence

Hairpin and tetrahelical structures of a d(CGG)(n) sequence in the FMR1 gene have been implicated in its expansion in fragile X syndrome. The identification of tetraplex d(CGG)(n) destabilizing proteins (Fry, M., and Loeb, L. A.(1999) J. Biol. Chem. 274, 12797-12803; Weisman-Shomer, P., Naot, Y., and Fry, M. (2000) J. Biol. Chem. 275, 2231-2238) suggested that proteins might modulate d(CGG)(n) folding and aggregation. We assayed human TK-6 lymphoblastoid cell extracts for d(CGG)(8) oligomer binding proteins. The principal binding protein was identified as Ku antigen by its partial amino acid sequence and antigenicity. The purified 88/75-kDa heterodimeric Ku bound with similar affinities (K(d) approximately 1. 8-10.2 x 10(-9) mol/liter) to double-stranded d(CGG)(8).d(CCG)(8), hairpin d(CGG)(8), single-stranded d(CII)(8), or tetraplex structures of telomeric or IgG switch region sequences. However, Ku associated more tightly with bimolecular G'2 tetraplex d(CGG)(8) (K(d) approximately 0.35 x 10(-9) mol/liter). Binding to Ku protected G'2 d(CGG)(8) against nuclease digestion and impeded its unwinding by the tetraplex destabilizing protein qTBP42. Stabilization of d(CGG)(n) tetraplex domains in FMR1 by Ku or other proteins might promote d(CGG) expansion and FMR1 silencing.     

Fragile X syndrome and the (CGG)n mutation: two families with discordant MZ twins.

The fragile X phenotype has been found, in the majority of cases, to be due to the expansion of a CGG repeat in the 5'-UTR region of the FMR-1 gene, accompanied by methylation of the adjacent CpG island and inactivation of the FMR-1 gene. Although several important aspects of the genetics of fragile X have been resolved, it remains to be elucidated at which stage in development the transition from the premutation to the full mutation occurs. We present two families in which discordance between two sets of MZ twins illustrates two important genetic points. In one family, two affected MZ brothers differed in the number of CGG repeats, demonstrating in vivo mitotic instability of this CGG repeat and suggesting that the transition to the full mutation occurred postzygotically. In the second family, two MZ sisters had the same number of repeats, but only one was mentally retarded. When the methylation status of the FMR-1 CpG island was studied, we found that the majority of normal chromosomes had been inactivated in the affected twin, thus leading to the expression of the fragile X phenotype.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

Interruption of the fragile X syndrome expanded sequence d(CGG)(n) by interspersed d(AGG) trinucleotides diminishes the formation and stability of d(CGG)(n) tetrahelical structures

Fragile X syndrome is caused by expansion of a d(CGG) trinucleotide repeat sequence in the 5′ untranslated region of the first exon of the FMR1 gene. Repeat expansion is thought to be instigated by formation of d(CGG)_n secondary structures. Stable FMR1 d(CGG)_n runs in normal individuals consist of 6–52 d(CGG) repeats that are interrupted every 9–11 triplets by a single d(AGG) trinucleotide. By contrast, individuals having fragile X syndrome premutation or full mutation present >54–200 or >200–2000 monotonous d(CGG) repeats, respectively. Here we show that the presence of interspersed d(AGG) triplets diminished in vitro formation of bimolecular tetrahelical structures of d(CGG)₁₈ oligomers. Tetraplex structures formed by d(CGG)_n oligomers containing d(AGG) interspersions had lower thermal stability. In addition, tetraplex structures of d(CGG)₁₈ oligomers interspersed by d(AGG) triplets were unwound by human Werner syndrome DNA helicase at rates and to an extent that exceeded the unwinding of tetraplex form consisting of monotonous d(CGG)₁₈. Diminished formation and stability of tetraplex structures of d(AGG)-containing FMR1 d(CGG)_2–50 tracts might restrict their expansion in normal individuals.     

Immune Dysregulation as a Cause of Autoinflammation in Fragile X Premutation Carriers: Link between FMRI CGG Repeat Number and Decreased Cytokine Responses

Background

Increased rates of autoinflammatory and autoimmune disorders have been observed in female premutation carriers of CGG repeat expansion alleles of between 55–200 repeats in the fragile X mental retardation 1 (FMR1) gene. To determine whether an abnormal immune profile was present at a cellular level that may predispose female carriers to autoinflammatory conditions, we investigated dynamic cytokine production following stimulation of blood cells. In addition, splenocyte responses were examined in an FMR1 CGG knock-in mouse model of the fragile X premutation.

Methods

Human monocyte and peripheral blood leukocytes (PBLs) were isolated from the blood of 36 female FMR1 premutation carriers and 15 age-matched controls. Cells were cultured with media alone, LPS or PHA. In the animal model, splenocytes were isolated from 32 CGG knock-in mice and 32 wild type littermates. Splenocytes were cultured with media alone or LPS or PMA/Ionomycin. Concentrations of cytokines (GM-CSF, IL-1β, IL-6, IL-10, IL-13, IL-17, IFNγ, TNFα, and MCP-1) were determined from the supernatants of cellular cultures via Luminex multiplex assay. Additionally, phenotypic cellular markers were assessed on cells isolated from human subjects via flow cytometry.

Results

We found decreases in cytokine production in human premutation carriers as well as in the FMR1 knock-in mice when compared with controls. Levels of cytokines were found to be associated with CGG repeat length in both human and mouse. Furthermore, T cells from human premutation carriers showed decreases in cell surface markers of activation when compared with controls.

Conclusions

In this study, FMR1 CGG repeat expansions are associated with decreased immune responses and immune dysregulation in both humans and mice. Deficits in immune responses in female premutation carriers may lead to increased susceptibility to autoimmunity and further research is warranted to determine the link between FMR1 CGG repeat lengths and onset of autoinflammatory conditions.     

Trinucleotide repeats (CGG)22TGG(CGG)43TGG(CGG)21 from the fragile X gene remain stable in transgenic mice

Unstable premutation alleles in fragile X contain CGG repeats ranging from 34 to about 200. To study the mechanism of formation and the behavior of dynamic mutations, we constructed and cloned 88 trinucleotide repeats including 43 uninterrupted CGGs and injected them into mouse fertilized oocytes. We analyzed 342 transgenic animals obtained from 6 different founders after one to four generations, and found that the repeats remained stable regardless of the sex of the transmitting mouse. Therefore, we may need to consider factors other than trinucleotide repeat length alone to explain CGG instability and create an animal model. Received: 17 January 1997 / Accepted: 14 April 1997     

A Dual-Mode Single-Molecule Fluorescence Assay for the Detection of Expanded CGG Repeats in Fragile X Syndrome

Fragile X syndrome is the leading cause of inherited mental impairment and is associated with expansions of CGG repeats within the FMR1 gene. To detect expanded CGG repeats, we developed a dual-mode single-molecule fluorescence assay that allows acquisition of two parallel, independent measures of repeat number based on (1) the number of Cy3-labeled probes bound to the repeat region and (2) the physical length of the electric field-linearized repeat region, obtained from the relative position of a single Cy5 dye near the end of the repeat region. Using target strands derived from cell-line DNA with defined numbers of CGG repeats, we show that this assay can rapidly and simultaneously measure the repeats of a collection of individual sample strands within a single field of view. With a low occurrence of false positives, the assay differentiated normal CGG repeat lengths (CGG _N , N = 23) and expanded CGG repeat lengths (CGG _N , N = 118), representing a premutation disease state. Further, mixtures of these DNAs gave results that correlated with their relative populations. This strategy may be useful for identifying heterozygosity or for screening collections of individuals, and it is readily adaptable for screening other repeat disorders.     

Molecular analysis of the (CGG)n expansion in the FMR-1 gene in 59 Spanish fragile X syndrome families

The fragile X mental retardation syndrome is caused by an expansion of a trinucleotide repeat (CGG)_n in the FMR-1 gene. Molecular genetic study of fragile X provides accurate diagnosis and facilitates genetic counseling in families with affected members. We present here the molecular study of 59 Spanish fragile X syndrome families using probe StB 12.3 and the polymerase chain reaction (PCR) of the (CGG)_n repeat sequence of the FMR-1 gene. The results obtained have allowed us to characterize 455 individuals, including eight prenatal diagnoses. The clinical diagnosis of fragile X in 89 affected males was confirmed, 137 female carriers were identified (48 of whom were mentally retarded), 176 individuals at risk were found not to have the expansion, and 12 cases of normal transmitting males (NTM) were detected. In the sample studied, no de novo mutations were detected, nor any mutation different from that described for the (CGG)_n expansion. One nonmentally retarded male was detected as having an unmethylated CpG island for the FMR-1 gene, but with more than 200 CGG repeats (high functioning male). The analysis of the (CGG)_n repeat in 208 normal chromosomes gave an allele distribution similar to that in other Caucasoid population groups, with alleles of 29 and 30 CGG repeats accounting for 46% of the chromosomes. The combination of Southern analysis and PCR of the (CGG)_n repeat is highly efficient for diagnosis, compared with cytogenetic techniques, especially in the detection of female carriers, NTMs, and prenatal diagnosis, enabling accurate genetic counseling to be provided in all cases.     

Distinct domains in the CArG-box binding factor A destabilize tetraplex forms of the fragile X expanded sequence d(CGG)n

Formation of hairpin or tetraplex structures of the FMR1 gene d(CGG)_n sequence triggers its expansion, setting off fragile X syndrome. In searching for proteins that destabilize d(CGG)_n secondary structures we purified from rat liver quadruplex telomeric DNA binding protein 42 (qTBP42) that disrupts G′2 bimolecular tetraplex d(CGG)_n while paradoxically stabilizing the G′2 structure of the telomeric sequence d(TTAGGG)_n. Based on peptide sequence homology of qTBP42 and mouse CArG-box binding factor A (CBF-A), we provide direct evidence that recombinant CBF-A protein is physically and immunochemically indistinguishable from qTBP42 and that it too destabilizes G′2 d(CGG)_n while stabilizing G′2 d(TTAGGG)_n. We inquired whether CBF-A employs the same or different domains to differentially interact with G′2 d(CGG)_n and G′2 d(TTAGGG)_n. Mutant CBF-A proteins that lack each or combinations of its five conserved motifs: RNP1₁, RNP1₂, RNP2₁, RNP2₂ and ATP/GTP-binding box were tested for their G′2 d(CGG)_n destabilization and G′2 d(TTAGGG)_n stabilization activities. We find that either RNP1₁ or the ATP/GTP motifs are necessary and sufficient for G′2 d(CGG)_n destabilization whereas RNP2₁ suppresses destabilization by either one of these two motifs. Neither RNP1₁ nor the ATP/GTP motif are required for G′2 d(TTAGGG)_n stabilization. Hence, CBF-A employs different domains to destabilize G′2 d(CGG)_n or stabilize G′2 d(TTAGGG)_n.     

DNA damage-induced reactive oxygen species (ROS) stress response in Saccharomyces cerevisiae

Cells are exposed to both endogenous and exogenous sources of reactive oxygen species (ROS). At high levels, ROS can lead to impaired physiological function through cellular damage of DNA, proteins, lipids, and other macromolecules, which can lead to certain human pathologies including cancers, neurodegenerative disorders, and cardiovascular disease, as well as aging. We have employed Saccharomyces cerevisiae as a model system to examine the levels and types of ROS that are produced in response to DNA damage in isogenic strains with different DNA repair capacities. We find that when DNA damage is introduced into cells from exogenous or endogenous sources there is an increase in the amount of intracellular ROS which is not directly related to cell death. We have examined the spectrum of ROS in order to elucidate its role in the cellular response to DNA damage. As an independent verification of the DNA damage-induced ROS response, we show that a major activator of the oxidative stress response, Yap1, relocalizes to the nucleus following exposure to the DNA-alkylating agent methyl methanesulfonate. Our results indicate that the DNA damage-induced increase in intracellular ROS levels is a generalized stress response that is likely to function in various signaling pathways.     

Elucidation of the DNA End-Replication Problem in Saccharomyces cerevisiae

1. Download : Download high-res image (209KB)
2. Download : Download full-size image

     

Methylation mosaicism of 5'-(CGG)(n)-3' repeats in fragile X, premutation and normal individuals

Fragile X syndrome (FRAXA) is characterized at the molecular level by an expansion of a naturally occurring 5′-(CGG)_n-3′ repeat in the promoter and 5′-untranslated region (5′-UTR) of the fragile X mental retardation (FMR1) gene on human chromosome Xq27.3. When expanded, this region is usually hypermethylated. Inactivation of the FMR1 promoter and absence of the FMR1 protein are the likely cause of the syndrome. By using the bisulfite protocol of the genomic sequencing method, we have determined the methylation patterns in this region on single chromosomes of healthy individuals and of selected premutation carriers and FRAXA patients. In control experiments with unmethylated or M-SssI-premethylated DNAs, this protocol has been ascertained to reliably detect all cytidines or 5-methylcytidines as unmethylated or methylated nucleotides, respectively. Analyses of the DNA from FRAXA patients reveal considerable variability in the lengths of the 5′-(CGG)_n-3′ repeats and in the levels of methylation in the repeat and the 5′-UTR. In one patient (OEl) with high repeat length heterogeneity (n = 15 to >200), shorter repeats (n = 20–80) were methylated or unmethylated, longer repeats (n = 100–150) were often completely methylated, but one repeat with n = 160 proved to be completely unmethylated. This type of methylation mosaicism was observed in several FRAXA patients. In healthy females, methylated 5′-CG-3′ sequences were found in some repeats and 5′-UTRs, as expected for the sequences from one of the X chromosomes. The natural FMR1 promoter is methylation sensitive, as demonstrated by the loss of activity in transfection experiments using the unmethylated or M-SssI-premethylated FMR1 promoter fused to the luciferase gene as an activity indicator.     

Human and Giardia ADP-ribosylation factors (ARFs) complement ARF function in Saccharomyces cerevisiae.

ADP-ribosylation factors (ARFs) are approximately 20-kDa guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin in vitro. ARFs are highly conserved, ubiquitously expressed in eukaryotic cells and appear to be involved in vesicular protein transport. The two yeast ARFs are > 60% identical to mammalian ARFs and are essential for cell viability (Stearns, T., Kahn, R. A., Botstein, D., and Hoyt, M. A. (1990) Mol. Cell. Biol. 10, 6690-6699). Although the two yeast ARF proteins are 96% identical in amino acid sequence, the yeast ARF1 gene is constitutively expressed, whereas the ARF2 gene is repressed by glucose. Human ARF5 and ARF6 and a Giardia ARF differ substantially in size and amino acid identity from other mammalian and eukaryotic ARFs but will, as befits their designation, activate cholera toxin. Expression of human ARF5, ARF6, or Giardia ARF cDNA rescued the lethal yeast ARF double mutant (arf1, arf2). Strains rescued by human ARF5, ARF6, or Giardia ARF grew much more slowly than wild-type yeast or strains rescued with yeast ARF1. We infer from the impaired growth of these rescued strains that the homologous ARFs may have specific targeting information that does not interact effectively or efficiently with the yeast protein membrane trafficking system.     

DNA Repair Mechanisms and the Bypass of DNA Damage in Saccharomyces cerevisiae

DNA repair mechanisms are critical for maintaining the integrity of genomic DNA, and their loss is associated with cancer predisposition syndromes. Studies in Saccharomyces cerevisiae have played a central role in elucidating the highly conserved mechanisms that promote eukaryotic genome stability. This review will focus on repair mechanisms that involve excision of a single strand from duplex DNA with the intact, complementary strand serving as a template to fill the resulting gap. These mechanisms are of two general types: those that remove damage from DNA and those that repair errors made during DNA synthesis. The major DNA-damage repair pathways are base excision repair and nucleotide excision repair, which, in the most simple terms, are distinguished by the extent of single-strand DNA removed together with the lesion. Mistakes made by DNA polymerases are corrected by the mismatch repair pathway, which also corrects mismatches generated when single strands of non-identical duplexes are exchanged during homologous recombination. In addition to the true repair pathways, the postreplication repair pathway allows lesions or structural aberrations that block replicative DNA polymerases to be tolerated. There are two bypass mechanisms: an error-free mechanism that involves a switch to an undamaged template for synthesis past the lesion and an error-prone mechanism that utilizes specialized translesion synthesis DNA polymerases to directly synthesize DNA across the lesion. A high level of functional redundancy exists among the pathways that deal with lesions, which minimizes the detrimental effects of endogenous and exogenous DNA damage.     

Metabolism and selected functions of sphingolipids in the yeast Saccharomyces cerevisiae.

Our knowledge of sphingolipid metabolism and function in Saccharomyces cerevisiae is growing rapidly. Here we discuss the current status of sphingolipid metabolism including recent evidence suggesting that exogenous sphingoid long-chain bases must first be phosphorylated and then dephosphorylated before incorporation into ceramide. Phenotypes of strains defective in sphingolipid metabolism are discussed because they provide hints about the undiscovered functions of sphingolipids and are one of the major reasons for studying this model eukaryote. The long-chain base phosphates, dihydrosphingosine-1-phosphate and phytosphingosine-1-phosphate, have been hypothesized to play roles in heat stress resistance, perhaps acting as signaling molecules. We evaluate the data supporting this hypothesis and suggest future experiments needed to verify it. Finally, we discuss recent clues that may help to reveal how sphingolipid synthesis and total cellular sphingolipid content are regulated.