Evolution of green plants and their relationship with other photosynthetic eukaryotes as deduced from 5S ribosomal RNA sequences

The nucleotide sequence of cytoplasmic 5S ribosomal RNAs from three gymnosperms,Pinus contorta, Taxus baccata andJuniperus media and from one fern,Pteridium aquilinum, have been determined. These sequences were aligned with all hitherto known cytoplasmic 5S ribosomal RNA sequences of photosynthetic eukaryotes. A dendrogram based on that set of sequences was constructed by a distance matrix method and the resulting tree compared with established views concerning plant and algal evolution. The following monophyletic groups of photosynthetic eukaryotes are recognizable: theRhodophyta, a group consisting ofPhaeophyta, Bacillariophyta andChrysophyta, and the green plants, the latter comprising green algae,Bryophyta, Pteridophyta andSpermatophyta. According to our 5S ribosomal RNA tree, green plants may have originated from some type of a green flagellated organism such asChlamydomonas. The land plants seem to have originated from some form of charophyte such asNitella. 5S ribosomal RNA seems to be less appropriate to estimate dissimilarities between species which have diverged relatively recently, like the angiosperms. Therefore, a precise evolutionary process is difficult to reconstruct for members of this group.     

A gene from the photosynthetic gene cluster ofRhodobacter sphaeroides inducestrans suppression of bacteriochlorophyll and carotenoid levels inR. sphaeroides andR. capsulatus

ARhodobacter sphaeroides gene (pps) inducestrans suppression of bacteriochlorophyll (Bch) and carotenoid (Crt) levels in bothR. sphaeroides andR. capsulatus. It also induces suppression of Crt levels in aParacoccus denitrificans strain carrying the Crt genes ofR. sphaeroides. The gene is located approximately 11 kilobases fromcrtA in the photosynthetic gene cluster. Crt suppression bypps is quantitatively different from that caused by an absence of mature Bch.     

The 5S ribosomal RNA sequences of a red algal rhodoplast and a gymnosperm chloroplast. Implications for the evolution of plastids and cyanobacteria

Summary The 5S ribosomal RNA sequences have been determined for the rhodoplast of the red algaPorphyra umbilicalis and the chloroplast of the coniferJuniperus media. The 5S RNA sequence of theVicia faba chloroplast is corrected with respect to a previous report. A survey of the known sequences and secondary structures of 5S RNAs from plastids and cyanobacteria shows a close structural similarity between all 5S RNAs from land plant chloroplasts. The algal plastid 5S RNAs on the other hand show much more structural diversity and have certain structural features in common with bacterial 5S RNAs. A dendrogram constructed from the aligned sequences by a clustering algorithm points to a common ancestor for the present-living cyanobacteria and the land plant plastids. However, the algal plastids branch off at an early stage within the plastid-cyanobacteria cluster, before the divergence between cyanobacteria and land plant chloroplasts. This evolutionary picture points to the occurrence of multiple endosymbiotic events, with the ancestors of the present algal plastids already established as photosynthetic endosymbionts at a time when the ancestors of the present land plant chloroplasts were still free-living cells.     

Structural features unique to the 5 S ribosomal RNAs of the thermophilic cyanobacterium Synechococcus lividus III and the green plant chloroplasts

The complete nucleotide sequence of the 5 S ribosomal RNA from the thermophilic cyanobacterium Synechococcus lividus III was determined. The sequence is: ^5′U-C- C-U-G-G-U-G-G-U-G-A-U-G-G-C-G-A-U-G-U-G-G-A-C-C-C-A-C-A-C-U-C-A-U-C- C-A-U-C-C-C-G-A-A-C-U-G-A-G-U-G-G-U-G-A-A-A-C-G-C-A-U-U-U-G-C-G-G-C- G-A-C-G-A-U-A-G-U-U-G-G-A-G-G-G-U-A-G-C-C-U-C-C-U-G-U-C-A-A-A-A-U-A- G-C-U-A-A-C-C-G-C-C-A-G-G-G-U_OH^3′This 5 S RNA has regional structural characteristics that are found in the green plant chloroplast 5 S RNAs and not in other known sequences of 5 S ribosomal RNAs. These homologies suggest a close phylogenetic relationship between S. lividus and the green plant chloroplasts.     

Sequence and characterisation of a ribosomal RNA operon fromAgrobacterium vitis

One of the four ribosomal RNA operons (rrnA) from theAgrobacterium vitis vitopine strain S4 was sequenced.rrnA is most closely related to therrn operons ofBradyrhizobium japonicum andRhodobacter sphaeroides and carries an fMet-tRNA gene downstream of its 5S gene, as in the case ofR. sphaeroides. The 16S rRNA sequence of S4 differs from theA. vitis K309 type strain sequence by only one nucleotide, in spite of the fact that S4 and K309 have very different Ti plasmids. The predicted secondary structure of the S4 23S rRNA shows several features that are specific for the alpha proteobacteria, and an unusual branched structure in the universal B8 stem. The 3 ends of the three otherrrn copies of S4 were also cloned and sequenced. Sequence comparison delimits the 3 ends of the four repeats and defines two groups:rrnA/rrnB andrrnC/rrnD.     

Comparison of RNA sequences from widely divergent species

Summary Tests that take into account the effects of gaps have been applied to 5S ribosomal RNA sequences from the bacteria,E. coli andP. fluorescens, and from KB carcinoma cells. The 5S RNAs from KB andP. fluorescens, when compared to that ofE. coli are shown to be more similar than random sequences of the same composition. Intrasequential analyses of 5S RNAs give some evidence for partial gene duplication or repetitive subsequences, but the proposed duplication of Brownlee, Sanger and Barrell (1968) is not supported by our data.     

Sequence and characterisation of a ribosomal RNA operon fromAgrobacterium vitis

One of the four ribosomal RNA operons (rrnA) from theAgrobacterium vitis vitopine strain S4 was sequenced.rrnA is most closely related to therrn operons ofBradyrhizobium japonicum andRhodobacter sphaeroides and carries an fMet-tRNA gene downstream of its 5S gene, as in the case ofR. sphaeroides. The 16S rRNA sequence of S4 differs from theA. vitis K309 type strain sequence by only one nucleotide, in spite of the fact that S4 and K309 have very different Ti plasmids. The predicted secondary structure of the S4 23S rRNA shows several features that are specific for the alpha proteobacteria, and an unusual branched structure in the universal B8 stem. The 3′ ends of the three otherrrn copies of S4 were also cloned and sequenced. Sequence comparison delimits the 3′ ends of the four repeats and defines two groups:rrnA/rrnB andrrnC/rrnD.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Molecular evolution in hypotrichous ciliates: Sequence of the small subunit ribosomal RNA genes fromOnychodromus quadricornutus andOxytricha granulifera (Oxytrichidae,Hypotrichida, Ciliophora)

Summary The small subunit ribosomal RNA (16S-like rRNA) coding regions of the hypotrichous ciliatesOnychodromus quadricornutus andOxytricha granulifera were amplified using polymerase chain reaction techniques. Complete sequences were determined for the amplified genes and compared to those of other ciliated protozoa. In phylogenetic trees inferred using distance matrix methods oxytrichids are not seen as a cohesive phylogenetic group.Oxytricha nova is most closely related toStylonychia pustulata in a lineage that also includesO. quadricornutus. This phylogeny contradicts phylogenetic schemes in whichOnychodromus is considered to be a primitive hypotrichous ciliate and suggests thatO. nova was misidentified as members of the genusOxytricha.     

Simultaneous removal of chemical oxygen demand (COD), phosphate, nitrate and H2S in the synthetic sewage wastewater using porous ceramic immobilized photosynthetic bacteria

Simultaneous aerobic treatment of COD, phosphate, nitrate and H₂S in a synthetic sewage wastewater was carried out using porous ceramic immobilized photosynthetic bacteria, Rhodobacter sphaeroidesS, Rb. sphaeroidesNR-3 and Rhodopseudomonas palustris. In the batch treatment, effective simultaneous removal of COD (89%), phosphate (77%), nitrate (99%) and H₂S (99.8%) was observed after 48 h. In semi-continuous treatments with dilution rates of 0.17 to 0.75 day^–1under aerobic conditions, simultaneous removal of these four components was also observed after about one month.     

A comparison of the 16S ribosomal RNAs from mesophilic and thermophilic bacilli: Some modifications in the sanger method for RNA sequencing

Summary Two modifications in the Sanger two dimensional electrophoretic procedure for RNA analysis are reported. One increases resolution on the primary fingerprint to the point that digests of large RNAs, of the size 1500–3000 nucleotides yield well resolved fingerprint patterns. The other is a novel endonucleolytic procedure that proves useful in determining sequences of the large oligonucleotides produced by T1 ribonuclease.These modifications have been used in determining the catalogs of oligomers produced by T1 ribonuclease digestion of 16S rRNAs from three related organisms,Bacillus subtilis, B.pumilus andB.stearothermophilus. The possible effects of adaptation to a thermophilic niche on ribosomal RNA primary structure and the phylogenetic relatedness of the two mesophilic Bacilli are discussed.This is contribution No.6 in a series on procaryote phylogeny.     

Construction of a physical map of the 45 kb photosynthetic gene cluster of Rhodobacter sphaeroides

1) A number of overlapping clones have been isolated from a Rhodobacter sphaeroides gene bank. Following conjugative gene transfer from Escherichia coli these clones restore a wild type phenotype to several mutants unable to synthesise bacteriochlorophyll. 2) The insert DNA was analysed by restriction mapping and together the clones form the basis of the first restriction map of the 45 kb photosynthetic gene cluster of Rb. sphaeroides. 3) This cluster is bounded on one side by puh A encoding the reaction centre H polypeptide and on the other by the puf operon encoding reaction centre L and M apoproteins and light harvesting LH1 and polypeptides. 4) DNA fragments from the 45 kb cluster were used to probe genomic DNA from other photosynthetic bacteria. Using heterologous hybridisation conditions, a significant degree of homology is shown between Rb. sphaeroides and these other bacteria, suggesting close evolutionary links with Rb. capsulatus in particular.     

Photosynthetic reaction center mutagenesis via chimeric rescue of a non-functional Rhodobacter capsulatus puf operon with sequences from Rhodobacter sphaeroides

Photosynthetically active chimeric reaction centers which utilize genetic information from both Rhodobacter capsulatus and Rb. sphaeroides puf operons were isolated using a novel method termed chimeric rescue. This method involves in vivo recombination repair of a Rb. capsulatus host operon harboring a deletion in pufM with a non-expressed Rb. sphaeroides donor puf operon. Following photosynthetic selection, three revertant classes were recovered: 1) those which used Rb. sphaeroides donor sequence to repair the Rb. capsulatus host operon without modification of Rb. sphaeroides puf operon sequences (conversions), 2) those which exchanged sequence between the two operons (inversions), and 3) those which modified plasmid or genomic sequences allowing expression of the Rb. sphaeroides donor operon. The distribution of recombination events across the Rb. capsulatus puf operon was decidedly non-random and could be the result of the intrinsic recombination systems or could be a reflection of some species-specific, functionally distinct characteristic(s). The minimum region required for chimeric rescue is the D-helix and half of the D/E-interhelix of M. When puf operon sequences 3 of nucleotide M882 are exchanged, significant impairment of excitation trapping is observed. This region includes both the 3 end of pufM and sequences past the end of pufM.     

Phylogeny of the GenusAgaricusInferred from Restriction Analysis of Enzymatically Amplified Ribosomal DNA

Bunyard, B. A., Nicholson, M. S., and Royse, D. J. 1996. Phylogeny of the genusAgaricusinferred from restriction analysis of enzymatically amplified ribosomal DNA.Fungal Genetics and Biology20,243–253. The 26S and 5S ribosomal RNA genes and the intergenic region between the 26S and the 5S rRNA genes of the ribosomal DNA repeat of 21 species ofAgaricuswere amplified using PCR and then digested with 10 restriction enzymes. Restriction fragment length polymorphisms were found among the 21 putative species ofAgaricusinvestigated and used to develop a phylogenetic tree of the evolutionary history ofA. bisporus.The 5′ end of the 26S gene showed more variability than the 3′ end.A. excellens, A. chionodermus,andA. carolirepresented the species most distantly related toA. bisporus.We present here the first comprehensive attempt at systematically resolving the entire genusAgaricususing modern techniques for molecular genetic analysis. Our data indicate that previous taxonomic schemes, based on morphological characters, are in need of revision.     

The photosynthesis gene cluster of Rhodobacter sphaeroides

The photosynthetic bacteria are at the forefront of the study of many aspects of photosynthesis, including photopigment biosynthesis, photosynthetic-membrane assembly, light-harvesting, and reaction center photochemistry. The facultative growth of some photosynthetic bacteria, their simple photosystems, and their ease of genetic manipulation have all contributed to advances in these areas. Amongst these bacteria, the purple non-sulfur bacterium Rhodobacter sphaeroides has emerged as, arguably, the leading contender for a model system in which to integrate the studies of all the different aspects of the assembly and function of the photosynthetic apparatus. Many of the genes encoding photosynthesis-related proteins are known to be clustered within a small region of the genome in this organism. As a further aid to studying the assembly and function of the photosystem of Rb. sphaeroides, the DNA sequence for a genomic segment containing this photosynthesis gene cluster (PGC) has been assembled from previous EMBL submissions and formerly unpublished data. The Rb. sphaeroides PGC is 40.7 kb in length and consists of 38 open reading frames encoding the reaction center H, L and M subunits, the and polypeptides of the light-harvesting I (B875) complex, and the enzymes of bacteriochlorophyll and carotenoid biosynthesis. PGCs are a feature of gene organization in several photosynthetic bacteria, and the similarities between the clusters of Rb. sphaeroides and Rb. capsulatus have been apparent for some time. Here we present the first comprehensive analysis of the PGC of Rb. sphaeroides, as well as a comparison with that of Rb. capsulatus.     

Relationships between species ofLeymus,Psathyrostachys, andHordeum (Poaceae,Triticeae) inferred from Southern hybridization of genomic and cloned DNA probes

We have used total genomic DNA as a probe to size-fractionated restriction enzyme digests of genomic DNA from a range ofTriticeae species from the generaLeymus Hochst.,Psathyrostachys Nevski, andHordeum L., and hybrids betweenHordeum andLeymus to investigate their taxonomic relationships. Genomic Southern hybridization was found to be an effective and simple way to assess the distribution and diversity of essentially species-specific and common, repetitive DNA sequences, and is hence especially useful in evolutionary studies. The DNA sequences ofH. vulgare seem to diverge substantially from those ofH. brachyantherum, H. lechleri, H. procerum, andH. depressum. The genome ofThinopyron bessarabicum shows little homology to those of theLeymus species investigated, confirming thatT. bessarabicum is not an ancestral genome inLeymus. Although the genomes ofLeymus andPsathyrostachys share substantial proportions of DNA sequences, they include divergent repeated sequences as well. Hybridization with a ribosomal DNA probe (pTa 71) showed that the coding regions containing structural genes encoding the 18 S, 5.8 S, and 26 S ribosomal RNA were conserved among the species investigated, whereas the intergenic spacer region was more variable, presenting different sizes of restriction fragments and enabling a classification of the species. The rye heterochromatin probe pSc 119.2 hybridized to DNA fromH. lechleri andT. bessarabicum, but not to DNA from the other species investigated.     

Molecular systematic studies in cycads: Evidence fromtrnL Intron and ITS2 rDNA sequences

The results of a pilot DNA sequencing study of cycads conducted at the new molecular systematics laboratory at Fairchild Tropical Garden are presented and assessed with reference to previous phylogenetic analyses and classification schemes based on morphology and anatomy. Two DNA regions were sequenced and analyzed for variation, an intron in the trriL gene in the chloroplast genome (trriL intron) and the internal transcribed spacer region between the 5.8S and 26S ribosomal DNA subunits (ITS2). The trnL intron proved to be relatively conservative among cycad genera, while the ITS2 region contained higher levels of variation. Parsimony analysis of the sequences suggests a number of relationships, some of which were inferred by previous morphological studies, some of which are new. The sequences ofCycas are the most divergent among cycads, suggesting the longest isolation.Dioon is relatively isolated from the other genera and contains two major clades.Stangeria does not appear closely related toBowenia but does seem to have a weak affinity withZamia andMicrocycas. Lepidozamia is more closely related toEncephalartos than toMacrozamia. Sequence variation among the species ofCeratozamia is low.Microcycas andZamia are closely related.     

Ribosomal RNA sequence comparisons demonstrate an evolutionary relationship betweenZygnematales and charophytes

The nuclear-encoded small subunit ribosomal RNA (rRNA) sequences were determined forGenicularia spirotaenia, Mesotaenium caldariorum, andStaurastrum spec. (Zygnematales) to elucidate the evolutionary position of these green algae. Results of neighbour-joining and maximum parsimony phylogenetic analyses support a monophyletic origin of theZygnematales within the evolutionary assemblage defined by theCharophyceae (sensuMattox & Stewart) and land plants. TheZygnematales/Charophyceae/land plants are evolutionarily distinct from the monophyletic lineage defined by theChlorodendrales, Pseudoscourfieldiales, and theMicrothamniales/Chlorophyceae. In memoriamRobert W. Hoshaw.