Study of the structural-energy aspects of complementary-addressed modifications of nucleic acid with reactive 4-]N-methyl-N-(2-chloroethyl)-amino]benzyl-3'- or 5'-phosphamide oligonucleotide derivatives by a molecular mechanics method

Calculations of probabilities of the complementary addressed modification of target NA by 3'- or 5'-reactive derivatives of oligonucleotides carrying a 4-[N-(2-chloroethyl)-N-methyl]aminobenzyl group attached to the 3'- or 5'-terminal phosphates through a phosphoroamide linkage have been made. It is shown that the structural basis of the high efficiency and positional specificity depending on the NA target base sequence is the extent of structural correspondence of the energetically optimal conformation of the active group in the complex to the mutual arrangement of the active group and nucleophilic site needed for the chemical reaction. The 3'-derivative has the highest dependence of efficiency and positional specificity of the alkylation on the target NA base sequence. The maximal positional specificity of the alkylation is found for the modification of the cytidine at the first position from the terminal complementary base pair at the 5'-end of the target NA. For the 5'-derivative, the alkylating ability was determined to depend on the insertion of additional methylene bridges into the standard phosphoroamide linker: two methylene groups provide for the maximal increase of the modification ability of the nucleophilic site of the target NA in the double-stranded part of the complex. The efficiency of alkylation of the target NA in a three component complex with oligonucleotide-effector also complementary to the target NA have been studied. It was found that formation of the three-component complex lead to an additional stabilization of the conformation needed for the reaction of the active group, in comparison with two-component complex, by means of the intercalation of the phenyl group of the reagent in the gap between the oligonucleotide derivative and the oligonucleotide effector.     

Interactions of derivatives of short oligonucleotides with nucleic acids. VII. Effect of conformation changes in the duplex structure on on the specificity and efficacy of modification of target DNA by alkylating oligonucleotide derivatives]

The modification of a target DNA by alkylating oligonucleotide derivatives possessing various capacities for complex formation was studied. The binding properties of oligonucleotides were changed either by increasing their length (tetra-, octa-, and dodecamers) or by introducing a point substitution and/or an N-(2-hydroxyethylphenazinium) residue. It was found that conformational changes occurring in the structure of the target.reagent complex upon elevating the reaction temperature affect the efficiency and site-specificity of the alkylation. In the case of complete saturation of the target with the reagent, an increase in the hybridization ability of the reagent reduced the efficiency of the target modification. It was found that the modification by the tetranucleotide reagent (in the presence of an effector adjacent to the 3' end) occurs exclusively at an intracomplex target base. In the case of the dodecamer, which forms a stable, highly cooperative complex with the target, several bases of the target undergo alkylation, and an increase in temperature changes the site-specificity of alkylation. In this process, the redistribution of the target modification sites toward stronger nucleophilic centers enhances alkylation at temperatures near the melting temperature of the target.dodecanucleotide complex despite a decrease in the extent of target association.     

Factors influencing the extent and selectivity of alkylation within triplexes by reactive G/A motif oligonucleotides.

G/A motif triplex-forming oligonucleotides (TFOs) complementary to a 21 base pair homopurine/homopyrimidine run were conjugated at one or both ends to chlorambucil. These TFOs were incubated with several synthetic duplexes containing the targeted homopurine run flanked by different sequences. The extent of mono and interstrand cross-linking was compared with the level of binding at equilibrium. Covalent modification took place within a triple-stranded complex and usually occurred at guanine residues in the flanking double-stranded DNA. The efficiency of alkylation was dependent upon the sequence of the flanking duplex, the solution conditions, and the rate of triplex formation relative to the rate of chlorambucil reaction. Self-association of the TFOs as parallel duplexes was demonstrated and this did not interfere with triple strand formation. With an optimal target, cross-linking of the triplex was very efficient when incubation was carried in a physiological buffer supplemented with the triplex selective intercalator coralyne.     

Nucleotide selection by the Y-family DNA polymerase Dpo4 involves template translocation and misalignment

Y-family DNA polymerases play a crucial role in translesion DNA synthesis. Here, we have characterized the binding kinetics and conformational dynamics of the Y-family polymerase Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) using single-molecule fluorescence. We find that in the absence of dNTPs, the binary complex shuttles between two different conformations within ∼1 s. These data are consistent with prior crystal structures in which the nucleotide binding site is either occupied by the terminal base pair (preinsertion conformation) or empty following Dpo4 translocation by 1 base pair (insertion conformation). Most interestingly, on dNTP binding, only the insertion conformation is observed and the correct dNTP stabilizes this complex compared with the binary complex, whereas incorrect dNTPs destabilize it. However, if the n+1 template base is complementary to the incoming dNTP, a structure consistent with a misaligned template conformation is observed, in which the template base at the n position loops out. This structure provides evidence for a Dpo4 mutagenesis pathway involving a transient misalignment mechanism.     

Reactive derivatives of oligonucleotide phosphorothioate analogues. IV.Site-directed modification of nucleic acids in intramolecular alkylation of phosphorothioate groups

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH3)CH2(RCl) (II-PS) and (RCl)CH2N(CH3)pGpsCpsApsTpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl = C6H4N(CH3)(CH2CH2Cl) at the 3'- or 5'-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (at t-->infinity) at 20 degrees C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH3)CH2(RCl) (II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex.     

Dideoxy sequencing of double-stranded DNA from poly(A)-extended 3'-ends

A simple method has been developed for sequencing double-stranded DNA by the chain termination method. The DNA to be sequenced is cut with a restriction enzyme that leaves a 3'-overhang which is extended by terminal deoxynucleotidyltransferase with limiting amounts of dATP. The sequencing reaction is then primed with an oligo(dT) primer which has a base pair "anchor" complementary to the overhang generated by the restriction enzyme. The method presented here eliminates the need for subcloning of the DNA or sequencing by chemical modification. Furthermore, sequences of more than 300 nucleotides are obtained from any 3'-overhanging restriction end.     

Precise binding of single-stranded DNA termini by human RAD52 protein

The human RAD52 protein, which exhibits a heptameric ring structure, has been shown to bind resected double strand breaks (DSBs), consistent with an early role in meiotic recombination and DSB repair. In this work, we show that RAD52 binds single-stranded and tailed duplex DNA molecules via precise interactions with the terminal base. When probed with hydroxyl radicals, ssDNA-RAD52 complexes exhibit a four-nucleotide repeat hypersensitivity pattern. This unique pattern is due to the interaction of RAD52 with either a 5' or a 3' terminus of the ssDNA, is sequence independent and is phased precisely from the terminal nucleotide. Hypersensitivity is observed over approximately 36 nucleotides, consistent with the length of DNA that is protected by RAD52 in nuclease protection assays. We propose that RAD52 binds DNA breaks via specific interactions with the terminal base, leading to the formation of a precisely organized ssDNA-RAD52 complex in which the DNA lies on an exposed surface of the protein. This protein-DNA arrangement may facilitate the DNA-DNA interactions necessary for RAD52-mediated annealing of complementary DNA strands.     

Complementary addressed modification of yeast tRNA Val 1 with alkylating derivative of d(pC-G)-A. The positions of the alkylated nucleotides and the course of the alkylation in the complex.

Yeast tRNA Val 1 alkylation with 2', 3'-O-4-(N-2-chloroethyl-N-methylamino) benzylidene d(pC-G)-A proceeds at 20 degrees - 30 degrees C in the complementary complexes which are formed by d(pC-G)-A greater than RC1 binding to 3 sequences of tRNA Val 1 : psi-C-G58 in the T loop, C-G40 at the 3'-side of the anticodon loop and C-G18 in the D loop. The reaction in the complexes results in A53, I35, and psi 13 alkylation to form beta-/N-methyl-N-(formylphenyl 17 amino/ethyl-tRNA Val 1 with the relative rate constants of the alkylation that are 3 or 2 orders of magnitude higher than that for the alkylation without a complex formation. It is the third nucleotide from the 5'-terminus of the binding site of the modifying agent that is subjected to alkylation in the t RNA Val 1. The course of the alkylation does not depend on the possible base pairing of the 3'-terminal nucleotide of the reagent. The extent of the reagent binding and the relative rate constants of the alkalytion in the complexes indicate the following order of the complex stability: (psi-C-G58) greater than (CO-G40) approximately (C-G18) at 20 degrees and (psi-C-G58) greater than (C-G40) greater than (C-G18) at 30 degrees.     

Promoter elements in the influenza vRNA terminal structure.

The role of the partially double-stranded influenza vRNA terminal structure and its constitutive elements as a promoter signal was studied in vivo in a series of nucleotide substitution and insertion derivatives. A series of single and complementary double exchanges restoring intrastrand base pairing shows that a distal promoter element consists of a six-base pair double-stranded RNA rod in long-range complementary interaction. Within the distal element, all base pair positions are freely exchangeable, and hence no nucleotide-specific recognition could be identified. The proximal promoter element consists of nine partially complementary nucleotides at the vRNA 5' and 3' end. The nine plus six base pair panhandle rod of protein-free vRNA is interrupted by a central third element, a single unpaired nucleotide: adenosine 10 or various substitute residues, which appears to cause a bulged conformation in the overall structure. Mutagenization studies in the promoter proximal element indicate that, upon binding to polymerase, nucleotides at positions 2 and 3 interact with positions 9 and 8 within each branch (5' or 3') in short-range base pairing. In this conformation, the intermediate positions 4-7 are exposed as a single-stranded tetra-loop, which includes invariant guanosine residue 5 in the top conformational position of the 5' segment loop. Altogether, the three base paired segments in angular conjunction to each other adopt a conformation that is described in a "corkscrew model" for an activated stage of vRNA/polymerase interaction.     

Sequence specific recognition of DNA by tailor-made hairpin conjugates of achiral seco-cyclopropaneindoline-2-benzofurancarboxamide and pyrrole-imidazole polyamides

Hairpin conjugates of achiral seco-cyclopropaneindoline-2-benzofurancarboxamide (achiral seco-CI-Bf) and three diamides (ImPy 1, PyIm 2, and PyPy 3, where Py is pyrrole, and Im is imidazole), linked by a gamma-aminobutyrate group, were synthesized. The sequence-specific covalent alkylation of the achiral CI moiety with adenine-N3 in the minor groove was ascertained by thermally induced DNA cleavage experiments. The results provide evidence that hairpin conjugates of achiral seco-CI-Bf-gamma-polyamides could be tailored to target specific DNA sequences according to a set of general rules: the achiral CI moiety selectively reacts with adenine-N3, a stacked pair of imidazole/benzofuran prefers a G/C base pair, and a pyrrole/benzofuran prefers an A/T or T/A base pair. Models for the binding of hairpin conjugates 1-3 with sequences 5'-TCA(888)G-3', 5'-CAA(857)C-3', and 5'-TTA(843)C-3' are proposed.     

Thermodynamics of RNA-RNA duplexes with 2- or 4-thiouridines: implications for antisense design and targeting a group I intron

Antisense compounds are designed to optimize selective hybridization of an exogenous oligonucleotide to a cellular target. Typically, Watson-Crick base pairing between the antisense compound and target provides the key recognition element. Uridine (U), however, not only stably base pairs with adenosine (A) but also with guanosine (G), thus reducing specificity. Studies of duplex formation by oligonucleotides with either an internal or a terminal 2- or 4-thiouridine (s(2)U or s(4)U) show that s(2)U can increase the stability of base pairing with A more than with G, while s(4)U can increase the stability of base pairing with G more than with A. The latter may be useful when binding can be enhanced by tertiary interactions with a s(4)U-G pair. To test the effects of s(2)U and s(4)U substitutions on tertiary interactions, binding to a group I intron ribozyme from mouse-derived Pneumocystis carinii was measured for the hexamers, r(AUGACU), r(AUGACs(2)U), and r(AUGACs(4)U), which mimic the 3' end of the 5' exon. The results suggest that at least one of the carbonyl groups of the 3' terminal U of r(AUGACU) is involved in tertiary interactions with the catalytic core of the ribozyme and/or thio groups change the orientation of a terminal U-G base pair. Thus thio substitutions may affect tertiary interactions. Studies of trans-splicing of 5' exon mimics to a truncated rRNA precursor, however, indicate that thio substitutions have negligible effects on overall reactivity. Therefore, modified bases can enhance the specificity of base pairing while retaining other activities and, thus, increase the specificity of antisense compounds targeting cellular RNA.     

Minimising the secondary structure of DNA targets by incorporation of a modified deoxynucleoside: implications for nucleic acid analysis by hybridisation

Some regions of nucleic acid targets are not accessible to heteroduplex formation with complementary oligonucleotide probes because they are involved in secondary structure through intramolecular Watson–Crick pairing. The secondary conformation of the target may be destabilised to assist its interaction with oligonucleotide probes. To achieve this, we modified a DNA target, which has self-complementary sequence able to form a hairpin loop, by replacing dC with N4-ethyldeoxycytidine (d^4EtC), which hybridises specifically with natural dG to give a G:^4EtC base pair with reduced stability compared to the natural G:C base pair. Substitution by d^4EtC greatly reduced formation of the target secondary structure. The lower level of secondary structure allowed hybridisation with complementary probes made with natural bases. We confirmed that hybridisation could be further enhanced by modifying the probes with intercalating groups which stabilise the duplex.     

The dynamic structural basis of differential enhancement of conformational stability by 5'- and 3'-dangling ends in RNA

Unpaired bases at the end of an RNA duplex (dangling ends) can stabilize the core duplex in a sequence-dependent manner and are important determinants of RNA folding, recognition, and functions. Using 2-aminopurine as a dangling end purine base, we have employed femtosecond time-resolved fluorescence spectroscopy, combined with UV optical melting, to quantitatively investigate the physical and structural nature of the stacking interactions between the dangling end bases and the terminal base pairs. A 3'-dangling purine base has a large subpopulation that stacks on the guanine base of the terminal GC or UG pair, either intrastrand or cross-strand depending on the orientation of the pair, thus providing stabilization of different magnitudes. On the contrary, a 5'-dangling purine base only has a marginal subpopulation that stacks on the purine of the same strand (intrastrand) but has little cross-strand stacking. Thus a 5'-dangling purine does not provide significant stabilization. These stacking structures are not static, and a dangling end base samples a range of stacked and unstacked conformations with respect to the terminal base pair. Femtosecond time-resolved anisotropy decay reveals certain hindered base conformational dynamics that occur on the picosecond to nanosecond time scales, which allow the dangling base to sample these substates. When the dangling purine is opposite to a U and is able to form a potential base pair at the end of the duplex, there is an interplay of base stacking and hydrogen-bonding interactions that depends on the orientation of the base pair relative to the adjacent GC pair. By resolving these populations that are dynamically exchanging on fast time scales, we elucidated the correlation between dynamic conformational distributions and thermodynamic stability.     

Reactive derivatives of oligonucleotide phosphorothioate analogues: IV. Site-directed modification of nucleic acids and intramolecular alkylation of phosphorothioate groups

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH₃)CH₂(RCl)(II-PS) and (RCl)CH₂N(CH₃)pGpsCpsAps TpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl=C₆H₄N(CH₃)(CH₂CH₂Cl) at the 3′- or 5′-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (att→∞) at 20°C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH₃)CH₂(RCl)(II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex. For Part III, see [1].     

Site-directed chemical restriction of a single-stranded DNA fragment by an alkylating derivative of the tetranucleotide d(pApGpCpA) in the presence of tetranucleotide effectors]

Alkylation of a single-stranded DNA 302-mer by a 5'-O-phosphoryl-[4-(N-2-chloroethyl-N-methylamino)benzyl]amide derivative of the tetradeoxyribonucleotide d(pApGpCpA) in the presence of 3',5'-di-N-(2-hydroxyethyl) phenazinium derivatives of tetranucleotides as effectors led to specific chemical cleavage of the target at the guanosine residues of the sites ... pTpGppT. The reagent can be selectively addressed to one of three alkylation sites with the aid of a pair of tetranucleotide effectors flanking the chemically reactive tetranucleotide in the complex with the target DNA. The yield of the cleavage depends on the concentration of both the reagent and effectors, and can be enhanced, if a chain of two or more effectors from each side of the reagent is used. In this case, 3',5'-di-Phn-tetranucleotide effectors are to immediately flank the reagent.     

Complementary addressed alkylation of 16S rRNA of Escherichia coli by 2',3'-O-[4-N-methyl-N-(2-chloroethyl)-amino]benzylidene derivatives of oligodeoxyribonucleotides. V. Study of the factors affecting selectivity of modification]

We studied the effect of different factors (reagent concentration, temperature, presence of oligonucleotide-effector (3',5'-diphenazinium derivative of oligodeoxyribonucleotide) stabilizing duplex RNA.reagent) on the selectivity of the site-directed modification of 16S rRNA with 2,3'-O-[4-N-methyl-N-(2-chloroethyl)-amino]-benzylidene derivative of oligonucleotide p(dTTTGCTCCCC)rA (reagent I) under conditions of secondary structure stability. The constant of cooperative binding of the reagent and oligonucleotide-effector with 16s rRNA was determined. The temperature rise from 20 to 40 degrees C brought about a 1.5-fold increase in the relative extent of modification at the target site 771-781. In the presence of oligonucleotide-effector, which is a full complementary copy of the 782-789 fragment of 16S rRNA (reagent concentration is 1 x 10(-6) M), the selectivity of the RNA modification at the target site is doubled and a high level of the modification is retained. When the reagent concentration in the reaction mixture was decreased down to 1 x 10(-7) M, the same level of selectivity was achieved without the oligonucleotide-effector. Under these conditions, however, a drastic (20-fold) drop of the level of the 16S rRNA alkylation was observed.     

Photo-cross-linking of psoralen-derivatized oligonucleoside methylphosphonates to single-stranded DNA.

The preparation of oligodeoxyribonucleoside methylphosphonates derivatized with 3-[(2-aminoethyl)carbamoyl]psoralen [(ae)CP] is described. These derivatized oligomers are capable of cross-linking with single-stranded DNA via formation of a photoadduct between the furan side of the psoralen ring and a thymidine of the target DNA when the oligomer-target duplex is irradiated with 365-nm light. The photoreactions of (ae)CP-derivatized methylphosphonate oligomers with single-stranded DNA targets in which the position of the psoralen-linking site is varied are characterized and compared to results obtained with oligomers derivatized with 4'-[[N-(aminoethyl)amino]methyl]-4,5',8-trimethylpsoralen [(ae)AMT]. It appears that the psoralen ring can stack on the terminal base pair formed between the oligomer and its target DNA or can intercalate between the last two base pairs of the oligomer-target duplex. Oligomers derivatized with (ae)CP cross-link efficiently to a thymidine located in the last base pair (n position) or 3' to the last base pair (n + 1 position) of the target, whereas the (ae)AMT-derivatized oligomers cross-link most efficiently to a thymidine located in the n + 1 position. The results show that both the extent and kinetics of cross-linking are influenced by the location of the psoralen-linking site in the oligomer-target duplex.     

Effect of LNA- and OMeN-modified oligonucleotide probes on the stability and discrimination of mismatched base pairs of duplexes

Locked nucleic acid (LNA) and 2'-O-methyl nucleotide (OMeN) are the most extensively studied nucleotide analogues. Although both LNA and OMeN are characterized by the C3'-endo sugar pucker conformation, which is dominant in A-form DNA and RNA nucleotides, they demonstrate different binding behaviours. Previous studies have focused attention on their properties of duplex stabilities, hybridization kinetics and resistance against nuclease digestion; however, their ability to discriminate mismatched hybridizations has been explored much less. In this study, LNA- and OMeN-modified oligonucleotide probes have been prepared and their effects on the DNA duplex stability have been examined: LNA modifications can enhance the duplex stability, whereas OMeN modifications reduce the duplex stability. Next, we studied how the LNA:DNA and OMeN:DNA mismatches reduced the duplex stability. Melting temperature measurement showed that different LNA:DNA or OMeN:DNA mismatches indeed influence the duplex stability differently. LNA purines can discriminate LNA:DNA mismatches more effectively than LNA pyrimidines as well as DNA nucleotides. Furthermore, we designed five LNA- and five OMeN-modified oligonucleotide probes to simulate realistic situations where target-probe duplexes contain a complementary LNA:DNA or OMeN:DNA base pairs and a DNA:DNA mismatch simultaneously. The measured collective effect showed that the duplex stability was enhanced by the complementary LNA:DNA base pair but decreased by the DNA:DNA mismatch in a position-dependent manner regardless of the chemical identity and position of the complementary LNA:DNA base pair. On the other hand, the OMeN-modified probes also showed that the duplex stability was reduced by both the OMeN modification and the OMeN:DNA mismatch in a position-dependent manner.     

Structure and function of the 3' terminal six nucleotides of the west nile virus genome in viral replication

Using a self-replicating reporting replicon of West Nile (WN) virus, we performed a mutagenesis analysis to define the structure and function of the 3'-terminal 6 nucleotides (nt) (5'-GGAUCU(OH)-3') of the WN virus genome in viral replication. We show that mutations of nucleotide sequence or base pair structure of any of the 3'-terminal 6 nt do not significantly affect viral translation, but exert discrete effects on RNA replication. (i). The flavivirus-conserved terminal 3' U is optimal for WN virus replication. Replacement of the wild-type 3' U with a purine A or G resulted in a substantial reduction in RNA replication, with a complete reversion to the wild-type sequence. In contrast, replacement with a pyrimidine C resulted in a replication level similar to that of the 3' A or G mutants, with only partial reversion. (ii). The flavivirus-conserved 3' penultimate C and two upstream nucleotides (positions 78 and 79), which potentially base pair with the 3'-terminal CU(OH), are absolutely essential for viral replication. (iii). The base pair structures, but not the nucleotide sequences at the 3rd (U) and the 4th (A) positions, are critical for RNA replication. (iv). The nucleotide sequences of the 5th (G) position and its base pair nucleotide (C) are essential for viral replication. (v). Neither the sequence nor the base pair structure of the 6th nucleotide (G) is critical for WN virus replication. These results provide strong functional evidence for the existence of the 3' flavivirus-conserved RNA structure, which may function as contact sites for specific assembly of the replication complex or for efficient initiation of minus-sense RNA synthesis.