Toxic effects of ethanol on bovine serum albumin

The toxic effects of ethanol on bovine serum albumin (BSA) were measured by resonance light scattering (RLS), fluorescence spectroscopy, ultraviolet spectrophotometry (UV), circular dichroism (CD), and transmission electron microscopy (TEM). The results indicated that ethanol had toxic effects on BSA, which led to protein denaturation and the effects increased with the ethanol dose. By means of RLS, BSA was found to aggregate in the presence of ethanol and particles smaller than 100 nm were observed from TEM. The fluorescence spectra showed that the intensity of the characteristic peak of BSA decreased and blue shifted, because of changes in the BSA skeleton structure, as well as alteration of the microenvironment of tryptophan (Trp) residues. The conformation changes of BSA were also shown by UV and CD spectrometry. © 2010 Wiley Periodicals, Inc. J Biochem Mol Toxicol 24:66–71, 2010; Published online in Wiley InterScience ( www.interscience.wiley.com ). DOI 10.1002/jbt.20314     

Investigations of the effects of ethanol on warfarin binding to human serum albumin

Ethanol effects on warfarin binding to human serum albumin (HSA) have been studied by equilibrium dialysis and fluorescence methods at pH 7.4 in phosphate-buffered saline at 37 degrees C. In the presence of various amounts of ethanol fluorescence intensity of bound warfarin decreased significantly but this intensity reduction was not solely from displacement of bound warfarin from HSA. By comparing fluorescence and equilibrium dialysis data we concluded that fluorescence intensity reduction of warfarin was mainly the result of changes in the surrounding environment of the warfarin binding site by ethanol interaction with HSA and that displacement of bound warfarin was not significant compared to the fluorescence intensity changes. The dissociation constant of warfarin binding to HSA decreased with an increasing amount of ethanol. From the changes in fluorescence intensity upon warfarin binding to HSA with the presence of ethanol ranging from 0 to 5.0% the following dissociation constants (Kd) were determined: 0% ethanol 5.39 +/- 0.2 microM, 0.1% ethanol 5.86 +/- 0.1 microM, 0.3% ethanol 5.83 +/- 0.2 microM, 0.5% ethanol 6.76 +/- 0.1 microM, 1% ethanol 7.01 +/- 0.1 microM, 3% ethanol 9.9 +/- 0.7 microM, 5% ethanol 13.01 +/- 0.1 microM. From the equilibrium dialysis with the same ranges of ethanol presence the following Kd values were obtained: 0% ethanol 6. 62 +/- 1.6 microM, 0.1% ethanol 6.81 +/- 1.1 microM, 0.3% ethanol 8. 26 +/- 2.5 microM, 0.5% ethanol 8.86 +/- 1.9 microM, 1% ethanol 11. 01 +/- 4.2 microM, 3% ethanol 20.75 +/- 2.4 microM, 5% ethanol 21.67 +/- 2.2 microM. The results suggest that warfarin bound to HSA was displaced by ethanol. These data indicate that ethanol influence on warfarin binding to HSA may alter the pharmacokinetics of warfarin.     

ATP binding to bovine serum albumin.

Specific binding of ATP to bovine serum albumin (BSA) is demonstrated employing ATP derivatives spin-labeled at either N6 or C8 of adenine ring or at the ribose moiety. Based on a 1:1 stoichiometry binding constants are in the 50-100 microM range. Binding is largely competitive with ATP or stearic acid. A small fraction of the labeled nucleotides could not be liberated by these ligands. Binding of AMP is in the millimolar range, only.     

The binding of palmitoyl-CoA to bovine serum albumin

Bovine serum albumin (BSA) is routinely utilized in vitro to prevent the adverse detergent effects of long-chain acyl-CoA esters (i.e., palmitoyl-CoA) in enzyme assays. Determination of substrate saturation kinetics in the presence of albumin would only be valid if the relationship between bound and free substrate concentrations was known. To elucidate the relationship between bound and free palmitoyl-CoA concentrations in the presence of BSA, several different techniques including equilibrium dialysis, equilibrium partitioning, fluorescence polarization and direct fluorescence enhancement were investigated. Direct fluorescence enhancement using a custom synthesized fluorescent probe, 16-(9-anthroyloxy)palmitoyl-CoA (AP-CoA), was the best approach to this question. Measurement of the relationship between mol of palmitoyl-CoA bound per mol of BSA (nu) versus -log[free palmitoyl-CoA] revealed that the binding of palmitoyl-CoA to BSA, like palmitate was nonlinear, suggesting the presence of more than one class of acyl-CoA binding sites. Computer analyses of the binding data gave a best fit to the 2,4 two-class Scatchard model, suggesting the presence of two high-affinity primary binding sites (k1 = (1.55 +/- 0.46) x 10(-6) M-1) and four lower affinity secondary binding sites (k2 = (1.90 +/- 0.09) x 10(-8) M-1). Further analyses using the six parameter stoichiometric (stepwise) ligand binding model supports the existence of six binding sites with the higher affinities associated with the binding of the first mole of palmitoyl-CoA and weaker binding occurring after the first two sites are occupied. The association constants from this model of multiple binding diminish sequentially (i.e., K1 greater than K2 greater than K3 greater than...greater than or equal to K6), suggesting that each mol of long-chain acyl-CoA binds to BSA with decreasing affinities.     

Investigating the binding of curcumin derivatives to bovine serum albumin

The interaction of bovine serum albumin (BSA) with isoxazolcurcumin (IOC) and diacetylcurcumin (DAC) has been investigated. Binding constants obtained were found to be in the 10⁵ M^? 1 range. Minor conformational changes of BSA were observed from circular dichroism (CD) and Fourier transformed infrared (FT-IR) studies on binding. Based on Förster's theory of non-radiation energy transfer, the average binding distance, r between the donor (BSA) and acceptors IOC and DAC was found to be 3.79 and 4.27 nm respectively. Molecular docking of isoxazolcurcumin and diacetylcurcumin with bovine serum albumin indicated that they docked close to Trp 213, which is within the hydrophobic subdomain.     

Study on the binding of cerium to bovine serum albumin

The interaction of Ce(3+) to bovine serum albumin (BSA) has been investigated mainly by fluorescence spectra, UV-vis absorption spectra, and circular dichroism (CD) under simulative physiological conditions. Fluorescence data revealed that the quenching mechanism of BSA by Ce(3+) was a static quenching process, the binding constant is 6.70 × 10(5) , and the number of binding site is 1. The thermodynamic parameters (ΔH = -29.94 kJ mol(-1) , ΔG = -32.38 kJ mol(-1) , and ΔS = 8.05 J mol(-1) K(-1) ) indicate that electrostatic effect between the protein and the Ce(3+) is the main binding force. In addition, UV-vis, CD, and synchronous fluorescence results showed that the addition of Ce(3+) changed the conformation of BSA.     

Combined spectroscopies and molecular docking approach to characterizing the binding interaction between lisinopril and bovine serum albumin

To further understand the mode of action and pharmacokinetics of lisinopril, the binding interaction of lisinopril with bovine serum albumin (BSA) under imitated physiological conditions (pH 7.4) was investigated using fluorescence emission spectroscopy, synchronous fluorescence spectroscopy, Fourier transform infrared spectroscopy (FTIR), circular dichroism (CD) and molecular docking methods. The results showed that the fluorescence quenching of BSA near 338 nm resulted from the formation of a lisinopril–BSA complex. The number of binding sites (n) for lisinopril binding on subdomain IIIA (site II) of BSA and the binding constant were ~ 1 and 2.04 × 10⁴ M^–1, respectively, at 310 K. The binding of lisinopril to BSA induced a slight change in the conformation of BSA, which retained its α‐helical structure. However, the binding of lisinopril with BSA was spontaneous and the main interaction forces involved were van der Waal's force and hydrogen bonding interaction as shown by the negative values of ΔG⁰, ΔH⁰ and ΔS⁰ for the binding of lisinopril with BSA. It was concluded from the molecular docking results that the flexibility of lisinopril also played an important role in increasing the stability of the lisinopril–BSA complex. Copyright © 2015 John Wiley & Sons, Ltd.     

Combined spectroscopies and molecular docking approach to characterizing the binding interaction of enalapril with bovine serum albumin

The binding interaction between bovine serum albumin (BSA) and enalapril (ENPL) at the imitated physiological conditions (pH = 7.4) was investigated using UV–vis absorption spectroscopy (UV–vis), fluorescence emission spectroscopy (FES), synchronous fluorescence spectroscopy (SFS), Fourier transform infrared spectroscopy (FT‐IR), circular dichroism (CD) and molecular docking methods. It can be deduced from the experimental results from the steady‐state fluorescence spectroscopic titration that the intrinsic BSA fluorescence quenching mechanism induced by ENPL is static quenching, based on the decrease in the BSA quenching constants in the presence of ENPL with increase in temperature and BSA quenching rates >10¹⁰ L mol^?1 sec^?1. This result indicates that the ENPL–BSA complex is formed through an intermolecular interaction of ENPL with BSA. The main bonding forces for interaction of BSA and ENPL are van der Waal's forces and hydrogen bonding interaction based on negative values of Gibbs free energy change (ΔG ⁰), enthalpic change (ΔH ⁰) and entropic change (ΔS ⁰). The binding of ENPL with BSA is an enthalpy‐driven process due to |ΔH °| > |T ΔS °| in the binding process. The results of competitive binding experiments and molecular docking confirm that ENPL binds in BSA sub‐domain IIA (site I) and results in a slight change in BSA conformation, but BSA still retains its α‐helical secondary structure.     

Spectroscopic analysis of the binding interaction between tinidazole and bovine serum albumin (BSA)

The interaction between bovine serum albumin (BSA) and tinidazole (Tindamax; 1) in aqueous solution was investigated in detail by means of UV/VIS and fluorescence spectroscopy, as well as through resonance light-scattering (RLS) spectroscopy. The apparent binding constant and number of binding sites were determined at three different temperatures, as well as the average binding distances between 1 and the nearest amino acid residue(s) of BSA, as analyzed by means of F?rster's theory of non-radiation energy transfer. Compound 1 was found to quench the inner fluorescence of BSA by forming a tight 1:1 aggregate, based on both static quenching and non-radiation energy transfer. The entropy change upon complexation was positive, and the enthalpy change was negative, indicating that the observed spontaneous binding is mainly driven by electrostatic interactions.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

A combined spectroscopic and molecular docking approach to characterize binding interaction of megestrol acetate with bovine serum albumin

The binding interactions between megestrol acetate (MA) and bovine serum albumin (BSA) under simulated physiological conditions (pH 7.4) were investigated by fluorescence spectroscopy, circular dichroism and molecular modeling. The results revealed that the intrinsic fluorescence of BSA was quenched by MA due to formation of the MA–BSA complex, which was rationalized in terms of a static quenching procedure. The binding constant (K_b) and number of binding sites (n) for MA binding to BSA were 2.8 × 10⁵ L/mol at 310 K and about 1 respectively. However, the binding of MA with BSA was a spontaneous process due to the negative ∆G⁰ in the binding process. The enthalpy change (∆H⁰) and entropy change (∆S⁰) were – 124.0 kJ/mol and –295.6 J/mol per K, respectively, indicating that the major interaction forces in the binding process of MA with BSA were van der Waals forces and hydrogen bonding. Based on the results of spectroscopic and molecular docking experiments, it can be deduced that MA inserts into the hydrophobic pocket located in subdomain IIIA (site II) of BSA. The binding of MA to BSA leads to a slight change in conformation of BSA but the BSA retained its secondary structure, while conformation of the MA has significant change after forming MA–BSA complex, suggesting that flexibility of the MA molecule supports the binding interaction of BSA with MA. Copyright © 2014 John Wiley & Sons, Ltd.     

The interaction between bovine serum albumin and surfactants.

1. Potassium n-decyl phosphate binds exothermically to bovine serum albumin at pH 7.0 to form a specific complex containing approx. 60 phosphate anions. 2. The formation of the complex is accompanied by changes in the u.v. difference spectrum of the protein. 3. At higher phosphate concentrations (above 0.4mM) surfactant molecules continue to be bound, and the protein undergoes a gross change in conformation. 4. n-Dodecyltri-methylammonium bromide binds endothermically to bovine serum albumin at pH7.0 but the extent of binding for a given free surfactant concentration is less than for the phosphate surfactant. 5. Binding is accompanied by a small change in the specific viscosity and by changes in the u.v. difference spectrum of the protein. 6. It is suggested that over the surfactant concentration ranges studied n-decyl phosphate ions first bind to the C-terminal part of the protein and then to the more compact N-terminal part whereas n-dodecyltrimethylammonium ions bind only to the C-terminal part of bovine serum albumin.     

Study of the interaction of artemisinin with bovine serum albumin

The study on the interaction of artemisinin with bovine serum albumin (BSA) has been undertaken at three temperatures, 289, 296 and 303 K and investigated the effect of common ions and UV C (253.7 nm) irradiation on the binding of artemisinin with BSA. The binding mode, the binding constant and the protein structure changes in the presence of artemisinin in aqueous solution at pH 7.40 have been evaluated using fluorescence, UV–vis and Fourier transform infrared (FT-IR) spectroscopy. The quenching constant K_q, K_sv and the association constant K were calculated according to Stern–Volmer equation based on the quenching of the fluorescence of BSA. The thermodynamic parameters, the enthalpy (ΔH) and the entropy change (ΔS) were estimated to be −3.625 kJ mol⁻¹ and 107.419 J mol⁻¹ K⁻¹ using the van’t Hoff equation. The displacement experiment shows that artemisinin can bind to the subdomain IIA. The distance between the tryptophan residues in BSA and artemisinin bound to site I was estimated to be 2.22 nm using Föster's equation on the basis of fluorescence energy transfer. The decreased binding constant in the presence of enough common ions and UV C exposure, indicates that common ions and UV C irradiation have effect on artemisinin binding to BSA.