Montmorillonite,Oligonucleotides, RNA and Origin of Life

Na-montmorillonite prepared from Volclay by the titration method facilitates the self-condensation of ImpA, the 5'-phosphorimidazolide derivative of adenosine. As was shown by AE-HPLC analysis and selective enzymatic hydrolysis of products, oligo(A)s formed in this reaction are 10 monomer units long and contain 67% 3',5'-phosphodiester bonds (Ferris and Ertem, 1992a). Under the same reaction conditions, 5'-phosphorimidazolide derivatives of cytidine, uridine and guanosine also undergo self-condensation producing oligomers containing up to 12-14 monomer units for oligo(C)s to 6 monomer units for oligo(G)s. In oligo(C)s and oligo(U)s, 75-80% of the monomers are linked by 2',5'-phosphodiester bonds. Hexamer and higher oligomers isolated from synthetic oligo(C)s formed by montmorillonite catalysis, which contain both 3',5'- and 2',5'-linkages, serve as catalysts for the non-enzymatic template directed synthesis of oligo(G)s from activated monomer 2-MeImpG, guanosine 5'-phospho-2-methylimidazolide (Ertem and Ferris, 1996). Pentamer and higher oligomers containing exclusively 2',5'-linkages, which were isolated from the synthetic oligo(C)s, also serve as templates and produce oligo(G)s with both 2',5'- and 3',5'-phosphodiester bonds. Kinetic studies on montmorillonite catalyzed elongation rates of oligomers using the computer program SIMFIT demonstrated that the rate constants for the formation of oligo(A)s increased in the order of 2-mer < 3-mer < 4-mer ... < 7-mer (Kawamura and Ferris, 1994). A decameric primer, dA(pdA)8pA bound to montmorillonite was elongated to contain up to 50 monomer units by daily addition of activated monomer ImpA to the reaction mixture (Ferris, Hill and Orgel, 1996). Analysis of dimer fractions formed in the montmorillonite catalyzed reaction of binary and quaternary mixtures of ImpA, ImpC, 2-MeImpG and ImpU suggested that only a limited number of oligomers could have formed on the primitive Earth rather than equal amounts of all possible isomers (Ertem and Ferris, 2000). Formation of phosphodiester bonds between mononucleotides by montmorillonite catalysis is a fascinating discovery, and a significant step forward in efforts to find out how the first RNA-like oligomers might have formed in the course of chemical evolution. However, as has been pointed out in several publications, these systems should be regarded as models rather than a literal representation of prebiotic chemistry (Orgel, 1998; Joyce and Orgel, 1999; Schwartz, 1999).     

Non-enzymatic transcription of an oligodeoxynucleotide 14 residues long

The 14-mer oligodeoxynucleotide d(C3GC3GC3GC2) acts as a template to facilitate the cooligomerization of guanosine 5'-phospho-2-methylimidazolide and cytidine 5'-phospho-2-methylimidazolide. The predominant products are a series of 3'-5'-linked oligonucleotides, complementary to the template, ranging in length from GGC to GGCGGGCGGGCGGG. Thus simple, non-enzymatic template-directed reactions can result in the accurate transfer of substantial amounts of information from template to products. The 15-mer oligodeoxynucleotide d(C3GC3GC3GC3) is also an efficient template, but directs the synthesis of the same family of products that are formed on the 14-mer template. This unexpected finding is explained by the preferential conversion of the dimer GG to GGC rather than to GGG. These results are interesting in the context of molecular evolution. They suggest that the detailed kinetics of template-directed synthesis could form the basis for the selection of one replicating oligonucleotide from a family of closely related oligonucleotides.     

Template controlled coupling and recombination of oligonucleotide blocks containing thiophosphoryl groups.

Oxidation of a pair of 3'- and 5'-thiophosphoryloligonucleotides in the presence of a complementary oligonucleotide template is shown to provide an effective means for selectively linking oligonucleotide blocks. Coupling proceeds rapidly and efficiently under mild conditions in dilute aqueous solutions (microM range for oligomers, 2-15 min at 0-4 degrees C with K3Fe(CN)6 or KI3 as oxidant). This chemistry was demonstrated by polymerization of a thymidylate decamer derivative (sTTTTTTTTTTs) in the presence of poly(dA) and by coupling oligomers possessing terminal thiophosphoryl groups (ACACCCAATTs + sCTGAAAATGG and ACACCCAATs + sCTGAAAATGG) in the presence of a template (CCATTTTCAGAATTGGGTGT). Efficient linking of 5' to 3' phosphoryl groups can be achieved under conditions where virtually no coupling takes place in absence of a template. A novel feature of the chemistry is that catalyzed recombinations of oligomers containing internal -OP(O)(O-)SSP(O)(O-)O- linkages can be directed by hydrogen bonding to a complementary oligonucleotide. Convenient procedures are reported for solid phase synthesis of the requisite oligonucleotide 3'- and 5'-phosphorothioates.     

Condensation of activated diguanylates on a poly(C) template

We have studied the metal-ion catalysis of a number of reactions of the isomers of ImpGpG on a poly(C) template. In the absence of a catalytic metal ion, oligomers at least up to (pG)20 are obtained from the ImpGpG isomers in a 1-methylimidazole buffer. The Pb2+ ion improves the yield of longer oligomers and changes substantially the distribution of linkage isomers. The Pb2+ ion greatly improves the yield of longer oligomers obtained from G and ImpGpG on a poly(C) template. The self-condensation of ImpGpG in a 2, 6-lutidine buffer is much less efficient than in a 1-methylimidazole buffer. The Zn2+ greatly increases the yield of products from the [3'-5']-linked dimer, but fails to catalyze the formation of long oligomers from the [2'-5']-linked dimer. The bonds formed in the Zn2+-catalyzed self-condensation of ImpG3pG on poly(C) are mainly [3'-5']-linked.     

The template properties of some oligodeoxynucleotides containing cytidine and guanosine

Summary the co-condensation of guanosine- and cytidine-5-phospho-2-methylimidazolide on various oligodeoxynucleotides containing C and G has been studied. We find that GC₇ is an effective template for the incorporation of C into products of the form G_nC, whereas C₇G does not act as a template for C incorporation. The template C₃GC₃GC₃GC₃ directs the synthesis of complementary products, but the yield of long oligomers is very small. Templates in which G residues are contiguous or separated by a single C residue are ineffective, while templates containing the sequence GCCG are very inefficient. The significance of these findings in the context of prebiotic chemistry is discussed.     

Non-enzymatic, template-directed ligation of 2'-5' oligoribonucleotides. Joining of a template and a ligator strand.

Decauridylate containing exclusively a 2'-5' phospho-diester bond ([2'-5']U10) served as a template for the synthesis of oligoadenylates [oligo(A)s] from the 5'-phosphorimidazolide of 2'-5' diadenylate (ImpA-2'p5'A). Joining of [2'-5']U10and ImpA2'p5'A also took place in substantial amounts to yield long-chain oligoribonucleotides in the template-directed reaction. An unusual CD spectrum ascribed to helix formation between [2'-5']U10and [2'-5'](pA)2was observed under the same conditions as that of the template-directed reaction. The 3'-5' linked decauridylate ([3'-5']U10) also promoted the template-directed synthesis of oligo(A)s from ImpA2'p5'A, but more slowly compared with [2'-5']U10. The results indicate that short-chain RNA oligomers with a 2'-5' phosphodiester bond could lead to longer oligoribonucleotides by template-directed chain elongation.     

Oligomerization of (guanosine 5′-phosphor)-2-methylimidazolide on poly(C): An RNA polymerase model

(Guanosine 5′-phosphor)-2-methylimidazolide (2-MeImpG), unlike guanosine 5′-phosphorimidazolide (ImpG), undergoes an efficient, buffer-independent, template-directed oligomerization in the presence of poly(C) at pH values above 7.6. The reaction occurs in a Watson-Crick double helix and yields predominantly 3′-5′-linked oligomers up to the 50-mer in above 80% yield. Synthesis proceeds in the 5′ → 3′ direction and has high fidelity in the sense that nucleotides other than G are not incorporated significantly into oligomers. Under some conditions, oligomers corresponding to approximately one and two turns of the helix are obtained in higher yield than somewhat longer or somewhat shorter oligomers.In the protonated triple-helical structure formed below pH 7, the efficiency of the oligomerization is much lower. Oligomers up to about the 10-mer are obtained. The most abundant products are “capped” at the 5′ terminus with a GppG pyrophosphate group.     

Template-directed synthesis on the oligonucleotide d(C7-G-C7)

When the deoxynucleotide template d(C7-G-C7) is incubated with the activated nucleotides 2-MeImpG and 2-MeImpC, a series of oligomers of G up to the sevenmer and a series of copolymers of composition GnC with n = 3 to 13 are formed. Oligomers GnC with n greater than 7 are completely degraded by pancreatic ribonuclease, establishing that they contain a 3' to 5' internucleotide bond between 5'-C and 3'-G within a sequence of the form (pG)ipC(pG)j. As expected, (pG)7-Cp and (pG)6-Cp are major hydrolysis products. Detailed analysis of the product distribution shows that a substantial fraction of the oligomeric products are of the type (pG)ipC(pG)j with i less than 7. This shows that product synthesis does not necessarily begin at the 3' terminus of the template. The significance of this finding in terms of the origin of molecular replication is discussed.     

Nucleoside analogue substitutions in the trinucleotide DNA template recognition sequence 3'-(CTG)-5' and their effects on the activity of bacteriophage T7 primase

Bacteriophage T7 primase catalyzes the synthesis of the oligoribonucleotides pppACC(C/A) and pppACAC from the single-stranded DNA template sites 3'-d[CTGG(G/T)]-5' and 3'-(CTGTG)-5', respectively. The 3'-terminal deoxycytidine residue is conserved but noncoding. A series of nucleoside analogues have been prepared and incorporated into the conserved 3'-d(CTG)-5' site, and the effects of these analogue templates on T7 primase activity have been examined. The nucleosides employed include a novel pyrimidine derivative, 2-amino-5-(beta-2-deoxy-D-erythro-pentofuranosyl)pyridine (d2APy), whose synthesis is described. Template sites containing d2APy in place of the cryptic dC support oligoribonucleotide synthesis whereas those containing 3-deaza-2'-deoxycytidine (dc(3)C) and 5-methyl-6-oxo-2'-deoxycytidine (dm(5ox)C) substitutions do not, suggesting that the N3 nitrogen of cytidine is used for a critical interaction by the enzyme. Recognition sites containing 4-amino-1-(beta-2-deoxy-D-erythro-pentofuranosyl)-5-methyl-2,6[1H, 3H]-pyrimidione (dm(3)2P) or 2'-deoxyuridine (dU) substitutions for dT support oligoribonucleotide synthesis whereas those containing 5-methyl-4-pyrimidinone 2'-deoxyriboside (d(2H)T) substitutions do not, suggesting the importance of Watson-Crick interactions at this template residue. Template sites containing 7-deaza-2'-deoxyguanosine (dc(7)G) or 2'-deoxyinosine (dI) in place of dG support oligoribonucleotide synthesis. The reduced extent to which dc(7)G is successful within the template suggests a primase-DNA interaction. Inhibition studies suggest that the primase enzyme binds "null" substrates but cannot initiate RNA synthesis.     

Which 3-ribofuranosyl-substituted purine 5′-phosphates undergo template-directed oligomerization?

Summary We have studied the oligomerization reactions of the 2-methylimidazolide derivatives of 3-isoisoguanosine 5-phosphate (2) and 3-isoxanthosine 5-phosphate (5) in the presence of a variety of homopolynucleotide templates. In no case did we observe a substantial template-facilitated production of long oligomers. Polyuridylic acid directed the synthesis of low molecular-weight products from both monomers. Polycytidylic acid, polyadenylic acid, polyinosinic acid, and polyguanylic acid were ineffective as templates in the systems that we investigated.     

Non-enzymic template-directed synthesis on RNA random copolymers. Poly(C, G) templates

Poly(C, G) random copolymer templates direct the oligomerization of 2-Me-ImpG and 2-MeImpC, resulting in the production of a variety of oligo(G, C)s. The efficiency of monomer incorporation into newly synthesized oligomers is greater for 2-MeImpG than for 2-MeImpC, and decreases for both monomers as the guanine content of the template increases. The relatively low efficiency of oligomerization on guanine-rich templates is largely a consequence of intra- and intermolecular template self-structure. The problem of template self-structure is clearly a major obstacle to the development of a system of self-replicating polynucleotides. The distribution of oligomeric products can be characterized in detail using high-pressure liquid chromatography on an RPC-5 column. Oligomers are separated on the basis of chain length, base composition and phosphodiester-linkage isomerism. Oligomers up to about the 12-mer, with base composition Gn, Gn-1C and Gn-2C2, have been identified. The 3' to 5' regiospecificity of the products is high, particularly for oligomers with base composition Gn.     

Nucleosides. 124. 3-Amino-3-deoxyhexopyranosyl Nucleosides. 7. 1-(3-Deoxy-3-Nitro-β-D-glucopyranosyl) Uracil and Its Galactopyranosyl Isomer1

Abstract

Crystalline 1-(3-deoxy-3-nitro-β-D-glucopyranosyl) uracil (3), originally prepared by nitromethane condensation of “uridine dialdehyde,” was found to contain the galactosyl isomer (4). Each isomer was obtained in pure form by 4′,6′-O-benzylidenation of the mixture of 3 and 4, followed by chromatographic separation and subsequent O-debenzylidenation. The structure of each isomer was established by chemical conversion of the isomer into the corresponding known 3′-acetamido-2′,4′,6′-tri-O-acetyl derivative.     

Inhibition of protein synthesis by the cordycepin analog of (2'-5')ppp(Ap)nA, (2'-5')ppp(3'dAp)n3'dA, in intact mammalian cells

The introduction of the cordycepin analog of (2'-5')An, (2'-5')ppp(3'dAp)n3'dA [referred to as (2'-5')p33'dAn], into mouse L929 cells and cultured human fibroblasts resulted in a dose-dependent inhibition of protein synthesis which was comparable to the inhibition observed by (2'-5')ppp(Ap)nA [referred to as (2'-5')p3An]. The inhibition of protein synthesis by (2'-5')p33'dAn was much more persistent than that of the naturally occurring (2'-5')p3An following prolonged incubation of cells. Furthermore, the (2'-5')p3An was cytotoxic to mammalian cells in culture, whereas the (2'-5')p33'dAn was not.     

Mechanisms of degradation of 2′-5′ oligoadenylates

We have studied the mechanisms of breakdown of 2'-5' oligoadenylates. We monitored the time-courses of degradation of ppp(A2'p5')nA (dimer to tetramer) and of 5'OH-(A2'p5')nA (dimer to pentamer) in unfractionated L1210 cell extract. The 5' triphosphorylated 2'-5' oligoadenylates are converted by a phosphatase activity. However, 2'-5' oligoadenylates are degraded mainly by phosphodiesterase activity which splits the 2'-5' phosphodiester bond sequentially at the 2' end to yield 5' AMP and one-unit-shorter oligomers. The nonlinear least-squares curve-fitting program CONSAM was used to fit these kinetics and to determine the degradation rate constant of each oligomer. Trimers and tetramers, whether 5' triphosphorylated or not, are degraded at the same rate, whereas 5' triphosphorylated dimer is rapidly hydrolyzed and 5'-OH dimer is the most stable oligomer. The interaction between degradation enzymes and the substrate strongly depends on the presence of a 5' phosphate group in the vicinity of the phosphodiester bond to be hydrolyzed; indeed, when this 5' phosphate group is present, as in pp/pA2'p5'A/or A2'/p5'A2'p5'A/, affinity is high and maximal velocity is low. Such a degradation pattern can control the concentration of 2'-5' oligoadenylates active on RNAse L either by limiting their synthesis (5' triphosphorylated dimer is the primer necessary for the formation of longer oligomers) and/or by converting them into inhibitory (e.g., monophosphorylated trimer) or inactive (e.g., nonphosphorylated oligomers) molecules.     

Inhibition of a novel subspecies of DNA polymerase α by 2′-deoxy-2′-azidoadenosine 5′-triphosphate

DNA polymerase α₁, a subspecies of DNA polymerase α of Ehrlich ascites tumor cells, was associated with a novel RNA polymerase activity and utilized poly(dT) and single-stranded circular fd DNA as a template without added primer in the presence of ribonucleoside triphosphates and a specific stimulating factor. DNA synthesis in the above system was inhibited by the ATP analogue, 2′-deoxy-2′-azidoadenosine 5′-triphosphate more than the DNA synthesis with poly(dT)·oligo(rA) by DNA polymerase α₁ and RNA synthesis by mouse RNA polymerases I and II. Kinetic analysis showed that the analogue inhibited DNA polymerase α₁ activity on poly(dT) competitively with respect to ATP, suggesting that the analogue inhibited RNA synthesis by the associated RNA polymerase activity.     

Minus-strand initiation by brome mosaic virus replicase within the 3' tRNA-like structure of native and modified RNA templates

An RNA-dependent RNA polymerase (replicase) extract from brome mosaic virus-infected barley leaves has been shown to initiate synthesis of (-) sense RNA from (+) sense virion RNA. Initiation occurred de novo, as demonstrated by the incorporation of [gamma-32P]GTP into the product. Sequencing using cordycepin triphosphate to terminate (-) strands during their synthesis by the replicase generated sequence ladders that confirmed that copying was accurate, and that initiation occurred very close to the 3' end. The precise site of initiation was further defined by testing the replicase template activity after stepwise removal of 3'-terminal nucleotides. Whereas removal of the terminal A did not decrease template activity, removal of the next nucleotide (C-2) did. Thus, initiation almost certainly occurs opposite the penultimate 3'-nucleotide (C-2) in vitro. The structure of the double-stranded replicative form of RNA isolated from brome mosaic virus-infected leaves was consistent with such a mechanism occurring in vivo, in that it lacked the 3'-terminal A found on virion RNAs. The specific site of (-) strand initiation and normal template activity were retained for RNAs with as many as 15 to 30 A residues added to the 3' end. However, only limited oligonucleotide 3' extensions can be present on active templates. In order to assess the 5' extent of sequences required for an active template, a 134-nucleotide-long fragment of brome mosaic virus RNA, corresponding to the tRNA-like structure, was generated. This RNA had high template activity, but a shorter 3' (85-nucleotide) fragment was inactive. RNAs with various heterologous sequences 5' to position 134 also showed high template activity. Thus, the 3'-terminal tRNA-like structure common to all four brome mosaic virus virion RNAs contains all of the signals required for initiation of replication, and sequences 5' to it do not play a role in template selection.     

Effects of coordination of diammineplatinum(II) with DNA on the activities of Escherichia coli DNA polymerase I

The effects of the reaction of cis- and trans-diamminedichloroplatinum(II) with DNA have been measured with regard to DNA synthesis, 3'-5' exonuclease (proofreading), and 5'-3' exonuclease (repair) activities of Escherichia coli DNA polymerase I. Both isomers inhibit DNA synthetic activity of the polymerase through an increase in Km values and a decrease in Vmax values for platinated DNA but not for the nucleoside 5'-triphosphates as the varied substrates. The inhibition is a consequence of lowered binding affinity between platinated DNA and DNA polymerase, and of a platination-induced separation of template and primer strands. Strand separation enhances initial rates of 3'-5' excision of [3H]dCMP from platinated DNA (proofreading), while total excision levels of nucleotides are decreased. In contrast to proofreading activity, the 5'-3' exonuclease activity (repair) discriminates between DNA which had reacted with cis- and with trans-diamminedichloroplatinum(II). While both initial rates and total excision are inhibited for the cis isomer, they are almost not affected for the trans isomer. This differential effect could explain why bacterial growth inhibition requires much higher concentrations of trans- than cis-diamminedichloroplatinum(II).     

Thioacyl esters of nucleotides: synthesis of 3''(2'')-O-thiobenzoyl nucleoside 5''-phosphates.

The synthesis of 3'(2')-O-thiobenzoyl nucleoside 5'-phosphates based on the condensation of N-(thiobenzoyl)-imidazole with nucleside 5'-phosphates was carried out. The UV absorption spectra, CD spectra, PMR spectra and chromatographic and electrophoretic characteristics of synthesized compounds were obtained. By means of PMR it was shown that the 2':3' isomer ratio in water at ambient temperature is about 2:3.