Mouse DNA sequences complementary to small nuclear RNA U1.

A mouse genomic library was screened for sequences complementary to U1 nuclear RNA. Out of the eight clones tested, none contained more than one copy of U1. Six of them were identical and one of those (clone 0U1-XIII) was further analyzed. This latter clone contained no other gene for discrete species of small size RNA in the 8 Kb EcoRI fragment encoding U1. A 248 bp Bg1II fragment from 0U1-XIII encompassing the full length of U1 as well as flanking regions on both sides has been subcloned and sequenced in M13 phage. Although the coding region was 96.5% homologous to rat U1a RNA, there is no direct evidence that this clone is a true gene. 3' and 5' flanking sequences of this as well as other published clones have been searched for homologies and the results of this search are discussed.     

Human DNA sequences complementary to the small nuclear RNA U2.

Clones containing sequences complementary to the small nuclear RNA U2 were isolated from a human DNA library (1). Three clones, designated U2/4, U2/6 and U2/7 were purified and characterized by restriction enzyme cleavage, hybridization and heteroduplex analysis. Hybridization showed that the three clones each contained one single region which is complementary to U2 RNA. Restriction enzyme cleavage revealed furthermore that the inserted fragments in the three recombinants are different. Heteroduplex analysis identified a 240-380 bp long duplex region in each heteroduplex which includes sequences complementary to U2 RNA. Heteroduplexes between clones U2/4 and U2/7 as well as between U2/4 and U2/6 revealed two additional approximately 200 bp long homologies. The remainder of the inserts were found to lack measurable sequence homology. Two fragments from clone U2/4 were subcloned in the pBR322 vector and the subclones were used to determine the nucleotide sequence of a region in clone U2/4 which is complementary to U2 RNA. A comparison between the established sequence and the sequence for rat U2 RNA (2) reveals several discrepancies.     

Clustering of the DNA sequences complementary to repetitive nuclear RNA of HeLa cells.

We have studied the hybridization profile of heterogeneous nuclear RNA from HeLa cells across DNA density gradients, and found that components in the high molecular weight fraction of heterogeneous nuclear RNA of HeLa cells hybridize to discrete density fractions on the light and heavy sides of the DNA. The conditions used for hybridization in this work allowed the detection of only those components in the RNA complementary to reiterated sequences in the DNA. These sequences in HnRNA are known to include double-stranded regions, which can be isolated readily. The double-stranded RNA shows a pattern of hybridization across a DNA density gradient which is similar to that of total HnRNA. It is concluded that the repeated sequences in HnRNA are complementary to clusters of repeated sequences in the DNA.     

Synthesis of a complementary DNA to rat liver albumin mRNA.

NADPH reduces both liver microsomal cytochrome P-450 and cytochrome $\text{b}{}_5$. In the presence of CO, ferrous cytochrome P-450 can slowly transfer electrons to amaranth, an azo dye. This reaction is followed by the reoxidation of cytochrome $\text{b}{}_5$ which proceeds at essentially the same rate as does cytochrome P-450 oxidation. It is suggested that cytochrome $\text{b}{}_5$ directly reduces cytochrome P-450 in rat liver microsomes.     

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA)

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.     

Characterization of complementary DNA clones coding for two forms of 3-methylcholanthrene-inducible rat liver cytochrome P-450

Double-stranded DNA complementary to the partially purified mRNA prepared from 3-methylcholanthrene (MC)-treated rat liver was constructed and cloned in Escherichia coli. Twenty clones were verified to carry a complementary DNA (cDNA) insert coding for MC-inducible cytochrome P-450 by positive hybridization translation assay and immunochemical assay with anti-cytochrome P-450 antibody. The identified cDNA clones were divided into at least two groups on the basis of comparison of restriction maps of the cDNA inserts. A clone pAU157 whose cDNA insert was approximately 2.7 kb in length contained nearly full-length mRNA information for cytochrome P-450MC or P-450c, which is the major form of MC-inducible cytochrome P-450. Other cDNA clones pTZ286-pTZ330 contained the 1.2 kb sequence complementary to cytochrome P-450d mRNA. RNA blot analysis revealed that pAU157 and pTZ286-pTZ330 cDNA clones were derived from 22S and 18S mRNAs, respectively, both of which were induced in rat liver by MC treatment. Sequence analysis revealed that there were closely homologous sequence regions in pAU157 and pTZ286-pTZ330 cDNA inserts and most of the homologous sequences were localized in two limited coding regions of the two cytochrome P-450 species. pAU157 encoded the total amino acid sequence of cytochrome P-450MC or P-450c and pTZ286-pTZ330 coded for the C-terminal 368 amino acid residues of cytochrome P-450d. Two highly homologous regions were found in the amino acid sequences of these cytochrome P-450 species.     

Comparison of cytoplasmic and nuclear poly(A)-containing RNA sequences in Xenopus liver cells.

Poly(A)-containing RNAs from cytoplasm and nuclei of adult Xenopus liver cells are compared. After denaturation of the RNA by dimethysulfoxide the average molecule of nuclear poly(A)-containing RNA has a sedimentation value of 28 S whereas the cytoplasmic poly(A)-containing RNA sediments slightly ahead of 18 S. To compare the complexity of cytoplasmic and nuclear poly(A)-containing RNA, complementary DNA (cDNA) transcribed on either cytoplasmic or nuclear RNA is hybridized to the RNA used as a template. The hybridization kinetics suggest a higher complexity of the nuclear RNA compared to the cytoplasmic fraction. Direct evidence of a higher complexity of nuclear poly(A)-containing RNA is shown by the fact that 30% of the nuclear cDNA fails to hybridize with cytoplasmic poly(A)-containing RNA. An attempt to isolate a specific probe for this nucleus-restricted poly(A)-containing RNA reveals that more than 10(4) different nuclear RNA sequences adjacent to the poly(A) do not get into the cytoplasm. We conclude that a poly(A) on a nuclear RNA does not ensure the transport of the adjacent sequence to the cytoplasm.     

Synthesis and characterization of a DNA probe complementary to rat liver 28S ribosomal RNA.

Conditions for the production of a complementary DNA sequence for use in studies of ribosomal RNA are described. $\text{E}$. $\text{coli}$ DNA polymerase I is used to transcribe highly purified 28S ribosomal RNA from rat liver. The reaction is sensitive to the tertiary structure of the rRNA template-primer. The complementary DNA hybridizes to its rRNA template with a $\text{R}{}_{\mathrm{o}}\text{t}{}_{\mathrm{<mtext>1</mtext><mtext>2</mtext>}}$ of 0.02. The hybrid formed between 28S ribosomal RNA and complementary DNA has a T_m of 73°C. The probe reacts with total rat nuclear RNA with a $\text{R}{}_{\mathrm{o}}\text{t}{}_{\mathrm{<mtext>1</mtext><mtext>2</mtext>}}$ of 1.0.     

The organization of repetitive sequences in the albumin and alpha-fetoprotein gene loci in the rat

Summary The distribution of middle repetitive sequences in the genic and extragenic regions of the rat albumin and -fetoprotein genes was analyzed. Their presence was determined by probing Southern blots of restriction fragments of albumin and -fetoprotein genomic subclones with ³²P-labeled total rat DNA. Repetitive sequences were detected in both genes. They were classified as weak, moderate and intense hybridizing elements according to the intensity of hybridization. Weak repetitive sequences were characterized as dG·dT repeats by using ³²P-labeled poly-(dG·dT)(dC·dA) oligomer probe. They occurred in 5 and 3 extragenic regions of the two genes and in introns 4 and 5 of the albumin gene. The moderate repetitive sequence present in intron 6 of the albumin gene was identified as the rat SINES element, 4D12. The intense repetitive sequence, localized in the 3 non-coding region of the albumin gene, corresponded to the terminal segment of a rat high repeat long interspersed DNA family, L1Rn. 4D12 and L1Rn sequences were also scattered throughout the -fetoprotein locus as moderate and intense repetitive elements, respectively, but their distribution was different from that of the albumin genomic region. These results indicate that repetitive sequences invaded the two loci in a non-conservative manner.     

The expression of alpha-fetoprotein and albumin genes in rat liver during chemical carcinogenesis

The effect of the hepatocarcinogen 3′-methyl-4-dimethylaminoazobenzene on α-fetoprotein (AFP) and albumin gene expression in rat liver was studied. Serum concentrations of AFP and albumin were measured. Amounts of AFP mRNA and albumin mRNA in rat livers were determined by hybridization of total cytoplasmic RNAs to their cDNAs. Dramatic increases in serum AFP concentrations coincided with increases in AFP biosynthesis and amount of AFP mRNA in livers of carcinogen-treated rats. In contrast, no or little change in albumin mRNA concentration was found in livers of rats treated with 3′-methyl-4-dimethylaminoazobenzene. Concomitantly, there was little change in liver albumin biosynthesis or serum albumin concentrations during hepatocarcinogenesis.     

Cloning and characterization of DNA complementary to rat liver UDP-glucuronosyltransferase mRNA

UDP-glucuronosyltransferase (transferase) clones were isolated from a cDNA bank constructed in pBR322 using transferase-enriched mRNA from the livers of phenobarbital-treated rats. The enrichment of mRNA was accomplished by polysome immunoadsorption with antibody to purified mouse liver transferase. This antibody was shown to bind specifically to rat transferase by Ouchterlony double diffusion analysis, immunoadsorption of glucuronidating activities, and selective inhibition of the immunoadsorption of in vitro synthesized enzyme by purified rat liver transferase. The isolated clones were verified to contain DNA complementary to transferase mRNA by hybrid translation-selection. Three classes of transferase cDNAs were characterized by restriction endonuclease mapping, and the largest insert-containing clone of each class was designated pUDPGTr-1, pUDPGTr-2, and pUDPGTr-3. Their insert sizes were approximately 2,400, 2,000, and 2,000 bp, respectively. All three cDNAs hybridized with a 2,300 +/- 150 bp mRNA, and each selected the translation of a 52,000-dalton polypeptide. Immunoadsorption of the 35S-labeled translation product could be competitively inhibited in each case by the addition of purified rat liver transferase. pUDPGTr-1 and pUDPGTr-3 inserts shared extensive sequence homology. This was demonstrated by Southern blot analysis using purified inserts and electron microscopic heteroduplex analysis. Southern blot analysis revealed that these cDNAs hybridized to overlapping genomic fragments. pUDPGTr-2 shared less sequence homology with the other two classes of cDNAs, based on the above criteria. In addition, mRNA corresponding to pUDPGTr-2 was elevated 5-fold by phenobarbital treatment, whereas the other mRNAs levels were unaffected. These studies demonstrate that in rat liver there are a minimum of three distinct transferase mRNAs, two of which may be associated with a common gene or gene family.     

Frequency distribution of messenger sequences within polysomal mRNA and nuclear RNA from rat liver.

DNA complementary to polysomal poly(A)-containing mRNA (cDNA) of male rat liver was used to study the diversity of messenger sequences in the nucleus and in polysomes. 1. Hybridization of cDNA against an excess of its own polysomal mRNA template revealed that about 10,000 different mRNA species are expressed in the liver tissue. They are distributed in a wide frequency range derived from approximately 0.5% of the total genome. 2. Hybridization of the cDNA against total nuclear RNA shows that messenger sequences comprise less than 1% of the mass of total nuclear RNA. Messenger sequences have a different frequency distribution in nucleus and cytoplasm. 3. In hybridizations using cDNA, which had been fractionated into sequences representing abundant and scarce polysomal mRNA molecules, it was found that although abundant cytoplasmic messenger sequences are also abundant in the nucleus, they exist in a significantly lower frequency range in the nuclear compartment.