Ribosome-bound elongation factor 2 escapes phosphorylation by Ca2+/calmodulin-dependent protein kinase III.

The activity of eukaryotic elongation factor 2 is regulated by phosphorylation catalysed by a highly specific Ca2+/calmodulin-dependent protein kinase. Phosphorylated EF2 binds to ribosomes with decreased affinity. The present evidence indicates that EF2 prebound to ribosomes is protected from phosphorylation, just as earlier evidence indicated that ribosome-bound EF2 is protected from ADP-ribosylation catalysed by diphtheria toxin. Ribosome-inactivating proteins ricin and gelonin, by interfering with the EF2-ribosome interaction, allow full phosphorylation of EF2.     

The ribosomal binding site for eukaryotic elongation factor EF-2 contains 5 S ribosomal RNA

The possible location of RNA in the ribosomal attachment site for the eukaryotic elongation factor EF-2 was analysed. Stable EF-2 · ribosome complexes formed in the presence of the non-hydrolysable GTP analogue GuoPP[CH₂]P were cross-linked with the short (4 Å between the reactive groups) bifunctional reagent, diepoxybutane. Non-cross-linked EF-2 was removed and the covalent factor-ribosome complex isolated. No interaction between EF-2 and 18 S or 28 S rRNA could be demonstrated. However, density gradient centrifugation of the cross-linked ribosomal complexes showed an increased density (1.25 g/cm³) of the factor, as expected from a covalent complex between EF-2 and a low-molecular-weight RNA species. Treatment of the covalent ribosome-factor complexes with EDTA released approx 50% of the cross-linked EF-2 from the ribosome together with the 5 S rRNA · protein L5 complex. Furthermore, the complex co-migrated with the 5S rRNA · L5 particle in sucrose gradients. Polyacrylamide gel electrophoresis showed that EF-2 was directly linked to 5 S rRNA in the 5 S rRNA · L5 complex, as well as in the complexes isolated by density gradient centrifugation. No traces of 5.8 S rRNA or tRNA could be demonstrated. The data indicate that the ribosomal binding domain for EF-2 contains the 5 S rRNA · protein L5 particle and that EF-2 is located in close proximity to 5 S rRNA within the EF-2 · GuoPP[CH₂]P · ribosome complex.     

Delineation of structural domains in eukaryotic 5S rRNA with a rhodium probe.

The three-dimensional folding of Xenopus oocyte 5S rRNA has been examined using the coordination complex Rh(phen)2phi3+ (phen = phenanthroline; phi = phenanthrenequinone diimine) as a structural probe. Rh(phen)2phi3+ binds neither double-helical RNA nor unstructured single-stranded regions of RNA. Instead, the complex targets through photoactivated cleavage sites of tertiary interaction which are open in the major groove and accessible to stacking. The sites targeted by the rhodium complex have been mapped on the wild-type Xenopus oocyte RNA, on a truncated RNA representing the arm of the molecule comprised of helix IV-loop E-helix V, and on several single-nucleotide mutants of the 5S rRNA. On the wild-type 5S rRNA, strong cleavage is found at residues U73, A74, A101, and U102 in the E loop and U80 and G81 in helix IV; additional sites are evident at A22 and A56 in the B loop, C29 and A32 in helix III, and C34, C39, A42, and C44 in the C loop. Given the similarity observed in cleavage between the full 5S RNA and the truncated fragment as well as the absence of any long-range effects on cleavage in mutant RNAs, the results do not support models which involve long-range tertiary interactions. Cleavage results with Rh(phen)2phi3+ do, however, indicate that the apposition of several noncanonical bases as well as stem--loop junctions may result in intimately stacked structures with opened major grooves. In particular, on the basis of cleavage results on mutant RNAs, both loops C and E represent structures where the strands constituting each loop are not independent of one another but are intrinsically structured.(ABSTRACT TRUNCATED AT 250 WORDS)     

Binding of periodate-oxidized guanine nucleotides to eukaryotic elongation factor 2

Periodate-oxidized guanine nucleotides (GTPox and GDPox) were shown to bind stoichiometrically to rat liver elongation factor 2 (EF-2). This binding was quantitatively inhibited in the presence of GTP. After binding, oxidized nucleotides remained on EF-2 despite extensive dialysis. They exchanged, however, with free quanine nucleotides in the course of prolonged (greater than 1 h) incubations. The prior reduction EF-2.GTPox with NaBH4 abolished, to a large extent, this slow exchange. Thus, a Schiff's base was implicated to be formed between EF-2 and oxidized guanine nucleotides. Mg2+ increased the GTPox concentration necessary for a stoichiometric binding to EF-2. EF-2-oxidized nucleotide conjugates bound in the presence of ribosomes a second molecule of GTP (or GTPox). GTPox bound to EF-2 in the presence of ribosomes appeared to exchange readily with free GTP. Moreover, GTPox proved to be active as substrate in EF-2 and ribosome-dependent GTPase reaction: Km values found for GTPox and GTP were 7.7 and 3.4 microM, respectively. The binding of GTPox to EF-2 inhibited only partially the subsequent ribosome-dependent GTP binding, and GTPase reaction or polyphenylalanine (polyPhe) synthesis. On the other hand, the binding of GuoPP[CH2]Pox to EF-2 inhibited all of these reactions strongly. The nature of the binding site involved in the direct interactions of EF-2 with guanine nucleotides is discussed in the light of these results.     

Domain movements of elongation factor eEF2 and the eukaryotic 80S ribosome facilitate tRNA translocation

An 11.7-A-resolution cryo-EM map of the yeast 80S.eEF2 complex in the presence of the antibiotic sordarin was interpreted in molecular terms, revealing large conformational changes within eEF2 and the 80S ribosome, including a rearrangement of the functionally important ribosomal intersubunit bridges. Sordarin positions domain III of eEF2 so that it can interact with the sarcin-ricin loop of 25S rRNA and protein rpS23 (S12p). This particular conformation explains the inhibitory action of sordarin and suggests that eEF2 is stalled on the 80S ribosome in a conformation that has similarities with the GTPase activation state. A ratchet-like subunit rearrangement (RSR) occurs in the 80S.eEF2.sordarin complex that, in contrast to Escherichia coli 70S ribosomes, is also present in vacant 80S ribosomes. A model is suggested, according to which the RSR is part of a mechanism for moving the tRNAs during the translocation reaction.     

Chemical modification of adenine residues in mouse 5S rRNA with monoperphthalate: the secondary structure of 5S rRNA

The chemical modification of adenine residues in mouse 5S rRNA with monoperphthalate was carried out to investigate the higher ordered structure of 5S rRNA. The adenine residues at positions 11, 22 (or/and 23), 49 (or/and 50), 54 (or/and 55), 77, 83, 88, 90 and 100 (or/and 101) were modified. This result further confirmed the secondary structure of 5S rRNA constituted of 5 helices and 5 loops postulated by other chemical modifications.     

The participation of 5S rRNA in the co-translational formation of a eukaryotic 5S ribonucleoprotein complex

The eukaryotic ribosomal 5S RNA–protein complex (5S rRNP) is formed by a co-translational event that requires 5S rRNA binding to the nascent peptide chain of eukaryotic ribosomal protein L5. Binding between 5S rRNA and the nascent chain is specific: neither the 5S rRNA nor the nascent chain of L5 protein can be substituted by other RNAs or other ribosomal proteins. The region responsible for binding 5S rRNA is located at positions 35–50 with amino acid sequence RLVIQDIKNKYNTPKYRM. Eukaryotic 5S rRNA binds a nascent chain having this sequence, but such binding is not substantive enough to form a 5S-associated RNP complex, suggesting that 5S rRNA binding to the nascent chain is amino acid sequence dependent and that formation of the 5S rRNP complex is L5 protein specific. Microinjection of 5S rRNP complex into the cytoplasm of Xenopus oocytes results in both an increase in the initial rate and also in the extent of net nuclear import of L5. This suggests that the 5S rRNP complex enhances nuclear transport of L5. We propose that 5S rRNA plays a chaperone-like role in folding of the nascent chain of L5 and directs L5 into a 5S rRNP complex for nuclear entry.     

Actin--an inhibitor of eukaryotic elongation factor activities

An inhibitor of diphtheria toxin- and endogenous transferase-dependent ADP-ribosylation of eukaryotic elongation factor 2 (eEF2) has been found in the cytoplasmic fraction from rat liver. We provide evidence that this cytoplasmic inhibitor corresponds to actin, which gives rise also to inhibition of polyphenylalanine (polyPhe) synthesis. Both globular monomeric (G-actin) and filamentous (F-actin) forms of actin appear to be inhibitory on the action of elongation factors 1 and 2 (eEF1 and eEF2) in polyPhe synthesis with the inhibitory effect of G-actin proving to be stronger. Some component(s) in the postribosomal supernatant (S-130) fraction and also DNase I prevent actin-promoted inhibition of polyPhe synthesis.     

5S rRNA Data Bank.

In this paper we present the updated version of the compilation of 5S rRNA and 5S rDNA nucleotide sequences. It contains 1622 primary structures of 5S rRNAs and 5S rRNA genes from 888 species. These include 58 archaeal, 427 eubacterial, 34 plastid, nine mitochondrial and 1094 eukaryotic DNA or RNA nucleotide sequences. The sequence entries are divided according to the taxonomic position of the organisms. All individual sequences deposited in the 5S rRNA Database can be retrieved using the WWW-based, taxonomic browser at http://rose.man.poznan.pl/5SData/5SRNA.html++ + or http://www.chemie. fu-berlin.de/fb_chemie/agerdmann/5S_rRNA.html . The files with complete sets of data as well as sequence alignments are available via anonymous ftp.     

Exportin-5-mediated nuclear export of eukaryotic elongation factor 1A and tRNA

Transport of proteins and RNA into and out of the cell nucleus is mediated largely by a family of RanGTP-binding transport receptors. Export receptors (exportins) need to bind RanGTP for efficient loading of their export cargo. We have identified eukaryotic elongation factor 1A (eEF1A) and tRNA as RanGTP-dependent binding partners of exportin-5 (Exp5). Exp5 stimulates nuclear export of eEF1A when microinjected into the nucleus of Xenopus laevis oocytes. Surprisingly, the interaction between eEF1A and Exp5 is dependent on tRNA that can interact directly with Exp5 and, if aminoacylated, recruits eEF1A into the export complex. These data suggested to us that Exp5 might support tRNA export. Indeed, not only the canonical tRNA export receptor, exportin-t, but also Exp5 can drive nuclear export of tRNA. Taken together, we show that there exists an alternative tRNA export pathway which can be exploited to keep eEF1A out of the cell nucleus.     

Affinity labelling of the eukaryotic elongation factor EF-2 with the guanosine nucleotide analogue 5′-p-fluorosulfonylbenzoylguanosine

During the translocation of the nascent peptide chain from the ribosomal aminoacyl-site to the peptidyl-site, GTP is hydrolyzed by a mechanism dependent on both ribosomes and the elongation factor EF-2. For insight into the mechanism of GTP hydrolysis, we studied the ability of the GTP analogue 5′-p-fluorosulfonylbenzoylguanosine (FSO₂BzGuo) to act as an affinity label of the guanine-specific site. Pre-incubation of EF-2 with FSO₂BzGuo at increasing concentrations progressively inactivated the EF-2 and ribosome-dependent GTPase activity. Up to 0.5 mM FSO₂BzGuo, the inactivation of the GTPase activity was stoichiometrically correlated with the covalent binding of [³H]FSO₂BzGuo. Thus, one molecule of covalently bound FSO₂BzGuo completely inactivated the GTPase activity of EF-2. Ribosomes or 60-S ribosomal subunits pre-incubated with FSO₂BzGuo were not inactivated, consistent with the idea that the GTP hydrolysis involved in the ribosomal translocation takes place on EF-2.     

An unusual 5S rRNA, from Sulfolobus acidocaldarius, and its implications for a general 5S rRNA structure.

The nucleotide sequence of the 5S ribosomal RNA of the thermoacidophilic archaebacterium Sulfolobus acidocaldarius was determined. The high degree of evident secondary structure in the molecule has implications for the common higher order structure of other 5S rRNAs, both bacterial and eukaryotic.     

Identification and characterization of eukaryotic initiation factor 5A-2.

The phylogenetically conserved eukaryotic translation initiation factor 5A (eIF5A) is the only known cellular protein to contain the post-translationally derived amino acid hypusine [Nepsilon-(4-amino-2-hydroxybutyl)lysine]. Both eIF5A and its hypusine modification are essential for sustained cell proliferation. Normally only one eIF5A protein is expressed in human cells. Recently, we identified a second human EIF5A gene that would encode an isoform (eIF5A-2) of 84% sequence identity. Overexpression of eIF5A-2 mRNA in certain human cancer cells, in contrast to weak normal expression limited to human testis and brain, suggests EIF5A2 as a potential oncogene. However, eIF5A-2 protein has not been described in human or mammalian cells heretofore. Here, we describe the identification of eIF5A-2 protein in human colorectal and ovarian cancer lines, SW-480 and UACC-1598, that overexpress eIF5A-2 mRNAs. Functional characterization of the human isoforms revealed that either human EIF5A gene can complement growth of a yeast strain in which the yeast EIF5A genes were disrupted. This indicates functional similarity of the human isoforms in yeast and suggests that eIF5A-2 has an important role in eukaryotic cell survival similar to that of the ubiquitous eIF5A-1. Detectable structural differences were also noted, including lack of immunological cross-reactivity, formation of different complexes with deoxyhypusine synthase, and Km values (1.5 +/- 0.2 vs. 8.3 +/- 1.4 microm for eIF5A-1 and -2, respectively) as substrates for deoxyhypusine synthase in vitro. These physical characteristics and distinct amino acid sequences in the C-terminal domain together with differences in gene expression patterns imply differentiated, tissue-specific functions of the eIF5A-2 isoform in the mammalian organism and in cancer.     

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.     

The nucleotide sequence of 5S rRNA from bovine liver.

We have determined the nucleotide sequence of ribosomal 5S RNA from bovine liver. The comparison of this sequence with those from other eukaryotic sources shows that a common secondary structure model for all eukaryotic 5S rRNAs may exist. Analysis of the evolutionary conserved nucleotides in metazoan 5S rRNAs suggests that the tertiary interactions, proposed earlier for plant 5S rRNA, are also possible.     

5S rRNA sequences from eight basidiomycetes and fungi imperfecti.

The 5S rRNA sequences from the basidiomycetes or fungi imperfecti Rhizoctonia crocorum, Rhizoctonia hiemalis, Exobasidium vaccinii, Trichosporon oryzae, Tilletia controversa, Tilletiaria anomala, Dacrymyces deliquescens and Coprinus radiatus were determined. With the exception of Exobasidium, these sequences conform to the association previously found between septal pore type and sequence. The sequence from the supposed ascomycete anamorph Rhizotonia hiemalis clearly is allied with basidiomycete sequences.