Structural aberrations of the X chromosome in man

Summary Among 209 patients with Shereshevsky-Turner syndrome, 69 women with structural aberrations of X chromosome were detected: 46,X, i(Xq)-11; 45,X/46,X,i(Xq)-24; 45,X/46,X,r(X)-14; 45,X/46,X,f(X or Y)-10; 45,X/46,X,del(Xq)-4; 45,X/46,X,del(Xp)-2; 45,X/46,X,idic(X)-2; 46,X,idic(X)-1; and 46,X,t(X,2)-1. All the patients with structural abnormalities of X chromosome were short in stature, but in no group was it as low on the average as in 45,X cases. Somatic signs were noticed in all structural changes of X, but they were less frequent and less pronounced. In some patients with r(X) and i(Xq), spontaneous menstrual bleeding and breast development was found.The structurally abnormal X chromosome appears to be functionally inactive, the phenotype of patients with structural rearrangements being close to the phenotype of patients with X monosomy. At the same time, the abnormal X might have certain effects in early embryogenesis which mitigated the further development of the Shereshevsky-Turner syndrome.     

Ovarian differentiation in Turner's syndrome

The authors have studied the gonadal histogenesis and the sexual chromosome influence on the gonads of 17 patients with the following complements : 45,X/46,XXqi (1 case); 45,X (4 cases); 45,X/46,XXP--(1 cases); 45,Xq-- (1 case); 45,X/46,XX (8 cases); 45,X/46,XX/46,XXqi (1case); and 45,X/46,XXqi/47,XXqiXqi (1 case). The presence of sexual differentiation structures was investigated : coelomic epithelium, stromal characteristics, follicles sexual cords, medullary tubules, rete ovarii, hilar cells, mesonephric remnants and coelomic epithelium inclusions. All gonads were constituted by rudimentary ovarian stroma with different states of hyalinization. Primordial follicles were noted in two patients with respectively 45,X/46,XX and 45,X/46,XXqi/47,XXqiXqi karyotypes, and a cystic follicle was present in one patient 45,X/46,XXp--. Sexual cords were seen in 6 patients and medullary tubules in 9. Different amounts of hilar cells were found as well. The authors conclude that in Turner's syndrome there exists an ovarian dysgenesis which is probably caused by early involution before reaching the maturation, conditioned by the genetic incapacity of the oogonia to complete the meiotic prophase.     

Turner's syndrome--correlation between karyotype and phenotype

Turner's syndrome is defined as a congenital disease determining by quantitative and/or structural aberrations of one from two X chromosomes with frequent presence of mosaicism. Clinically it is characterized by growth and body proportion abnormalities, gonadal dysgenesis resulting in sexual infantilism, primary amenorrhoea, infertility, characteristic stigmata, anomalies of heart, renal and bones and the presence of some diseases like Hashimoto thyroiditis with hypothyroidism, diabetes mellitus type 2, osteoporosis, hypertension. Turner's syndrome occurs in 1:2000 to 1:2500 female livebirth. The most frequent X chromosome aberrations in patients with phenotype of Turner syndrome are as follows: X monosomy - 45,X; mosaicism (50-75%), including 45,X/46,XX (10-15%), 45,X/46,XY (2-6%), 45,X/46,X,i(Xq), 45,X/46,X,del(Xp), 45,X/46,XX/47,XXX; aberration of X structure: total or partial deletion of short arm of X chromosome (46,X,del(Xp)) isochromosom of long arm of X chromosome (46,X,(i(Xq)), ring chromosome (46, X,r(X)), marker chromosome (46,X+m). Searching of X chromosome and mapping and sequencing of genes located at this chromosome (such as SHOX, ODG2, VSPA, SOX 3) have made possible to look for linkage between phenotypes and adequate genes or regions of X chromosome. In this paper current data concerning correlation between phenotype and karyotype in patients with TS have been presented.     

A Turner patient with a 45,X,t(1;2) (q41;p11.2) karyotype

The most common chromosomal anomaly is 45,X in the Turner syndrome. In addition to this, anomaly, mosaicism such as structural 46,X,i(Xq), 46,X,del(Xp), 46,X,r(X), 46,X,t(X;Y) and numerical 46XO/46,XX/47XXX are seen rather frequently. An infant with the Turner syndrome was found to have a karyotype 45X,t(1;2) (q41;p16) using high resolution banding. Based on our knowledge, we present the first case of 45X,t(1;2) (q41;p11.2), a karyotype in Turner's syndrome in the literature.     

Effect of the frequency of X-monosomal cell clone on variability of anthropometric indicators in Shereshevsky-Turner syndrome]

Using methods of mathematical statistics the relationships were determined between 31 anthropometric traits (ATs) and the frequency of the X-monosome cell clone in 53 patients with either 45, X-monosomy or mosaic forms (45,X/46,XX) of the Shereshevsky-Turner syndrome (STS). AT variations were studied in patients untreated with growth hormone and in 25 control fertile healthy women. In 29 patients, the degree of mosaicism was assessed by interphase FISH analysis using X-centromer-specific DNA probe hybridized to the cell nuclei of two types of tissues differing in embryonic origin (lymphocytes and oral epithelium, originating from meso- and ectoderm, respectively). The level of X-monosome mosaicism had a substantial effect on some AT, which depended similarly on the proportion of X-monosome cells in tissues of different embryonic origin. Statistically significant negative correlations were revealed between the size of X-monosome clone and 13 height-weight, longitudinal, and circumference traits, whereas positive correlations were characteristic of seven mostly width traits. Eleven ATs showed no correlation with the X-monosome cell clone. Discriminant analysis of all ATs, whose variations depended on the frequency of X-monosome cell clone, was found to be an essential tool for precise classification of both STS patients with different degree of mosaicism and healthy women. Based on these results, the set of ATs characteristic of the STS phenotype was identified.     

Chromosomal sensitivity to X-rays in lymphocytes from patients with Turner syndrome

Lymphocytes from patients with Turner syndrome were irradiated with X-rays (200 rad) to determine the chromosomal aberration frequency in first-division metaphases. Five patients with 45,X karyotype; three 45,X/46,Xi(X)q mosaics; one 45,X/47,XXX mosaic and 9 female controls were studied. Patients with a 45,X karyotype exhibited a radioinduced chromosomal aberration frequency similar to controls (38.6 +/- 6.37 and 36.2 +/- 5.11 respectively; p = 0.42). In the mosaics, 45,X cells had a mean frequency of 38.75 +/- 2.16; 46,Xi(X)q cells a mean of 38 +/- 2.16 and the control group a rate of 36.25 +/- 4.32. No differences were observed between 45,X and 46,Xi(X)q cells (p = 0.50), 45,X and normal cells (p = 0.24) or 46,Xi(X)q and normal cells (p = 0.35). Apparently neither the X monosomy nor the Xq isochromosome influences the 'in vitro' X-ray-induced chromosomal damage in Turner syndrome lymphocytes.     

45,X/46,XYq dic-Geschlechtschromosomenmosaik

Zusammenfassung Es wird über eine Patientin mit Kleinwuchs, Adipositas und sexuellem Infantilismus berichtet. Die Abklärung ergab ein 45,X/46,XYq dic-Mosaik. Es folgt eine Zusammenfassung der bis jetzt in der Literatur beschriebenen Fälle von Ydic. Das klinische Bild unterscheidet sich nicht wesentlich von jenem des 45,X/46,XY-Mosaiks. Anschließend werden die Zusammenhänge zwischen strukturellen Aberrationen des Y-Chromosoms und Phänotypus diskutiert.

---

45,X/46,XYq dic-Sexchromosome mosaic

Summary This is the report on an obese girl with small stature and sexual infantilism. A 45,X/46,XYq dic mosaic was found in blood and fibroblast cultures. A summary is given of the cases so far reported in the literature. The clinical picture does not differ significantly from that of 45,X/46,XY cases. The relationship of phenotype and structural abnormalities of the Y chromosome is discussed.

     

Deoxyribonucleic acid damage study in primary amenorrhea by comet assay and karyotyping

AIM:

This study aims at evaluating the chromosomal abnormalities and deoxyribonucleic acid (DNA) damage in cases with primary amenorrhea by karyotyping and comet assay.

STUDY DESIGN:

A total of 30 cases of primary amenorrhea were recruited. Secondary sexual characters were assessed by Tanner staging. Chromosomal analysis was performed by conventional phytohemagglutinin stimulated lymphocyte cell culture technique. Alkaline version of comet assay was used to evaluate DNA damage.

RESULTS:

The chromosomal pattern of 20 subjects (66.7%) was found to be normal (46,XX). Two subjects had 46,XY pattern and eight subjects had Turner syndrome (45,X or 45,X/46,XX). The comet parameters were found to be increased among subjects with 45,X monosomy, when compared to the rest of the study group and also in subjects with Tanner stage 1 when compared to stage 2.

CONCLUSION:

Comet assay revealed increased DNA damage in cases with 45,X monosomy, compared with subjects with 46,XX and 46,XY karyotype, which correlated with clinical features.     

45,X/46,SYq dic-Sexchromosome mosaic]

This is the report on an obese girl with small stature and sexual infantilism. A 45,X/46,XYq dic mosaic was found in blood and fibroblast cultures. A summary is given of the cases so far reported in the literature. The clinical picture does not differ significantly from that of 45,X/46,XY cases. The relationship of phenotype and structural abnormalities of the Y chromosome is discussed.     

Prenatal diagnosis of 45,X/46,XX mosaicism and 45,X: implications for postnatal outcome.

The prognosis for 45,X/46,XX mosaicism diagnosed prenatally has yet to be established. We report our experience with 12 patients in whom prenatal diagnosis of 45,X/46,XX mosaicism was detected by amniocentesis for advanced maternal age or decreased maternal serum alpha-feto protein and compared them with 41 45,X/46,XX patients diagnosed postnatally. The girls in the prenatal group range in age from 3 mo to 10 years. All have had normal linear growth. Four had structural anomalies including: ASD (n = 1); ptosis and esotropia (n = 1); labial fusion (n = 1); and urogenital sinus, dysplastic kidneys, and hydrometrocolpos (n = 1). Gonadotropins were measured in seven; one had elevated luteinizing hormone/FSH at 3 mo of age. One has developmental delay and seizures as well as ophthalmologic abnormalities. None would have warranted karyotyping for clinical suspicion of Turner syndrome. The prevalence of 45,X/46,XX mosaicism is 10-fold higher among amniocenteses than in series of postnatally diagnosed individuals with Turner syndrome, which suggests that most individuals with this karyotype escape detection and that an ascertainment bias exists toward those with clinically evident abnormalities. The phenomenon of a milder phenotype for the prenatal group is similar to that observed for 45,X/46,XY diagnosed prenatally. Prenatal counseling for 45,X/46,XX in the absence of such ultrasound abnormalities as hydrops fetalis should take into account the expectation of a milder phenotype (except, possibly, with respect to developmental delay) than that of patients ascertained postnatally. The same does not hold true for 45,x diagnosed prenatally.     

45,X/46,X,dic(Yq) mosaicism and mixed gonadal dysgenesis. Case report and review of the literature.

A 4 year 7 month-old boy with ambiguous genitalia, histological evidence of mixed gonadal dysgenesis, and 45,X/46,X,dic(Yq) mosaicism is reported. The identity of the dicentric Y chromosome was stablished by its typical fluorescent banding patterns and the presence of two centromeres demonstrated by C-band technique. A review of the literature yielded nine additional cases of mosaic 45,X/46,X,dic(Yq). Phenotypical and histological findings among these cases were compared, and the possible localization of the genes responsible for testicle induction and maturation is discussed.     

Structural aberrations of the Y chromosome and the corresponding phenotype

Summary the literature dealing with structural aberrations of the Y chromosome and their phenotypic effects is reviewed. A new observation of a patient with Turner's syndrome and the karyotype 45,X/46,X,i(Yp) reported here allows some conclusions on the problem of the localization of sex-determining factors on the Y chromosome. The comparative analysis of all these cases leads to the assumption that the genes for the initiation of testicular development are located on the proximal part of the long arm of the Y chromosome, while the genes responsible for the maturation of the testis are localized on the short arm of the Y chromosome.

---

Zusammenfassung Strukturelle Aberrationen des Y-Chromosoms und ihre phänotypischen Auswirkungen werden an Hand der einschlägigen Literatur zusammenfassend diskutiert. Eine eigene Beobachtung eines Turner-Syndroms mit dem Chromosomenbefund 45,X/46,X,i(Yp) erlaubt Aussagen über die Lokalisation von Genen auf dem Y-Chromosom. Auf Grund der Literatur und unseres Falles wird die Annahme gemacht, daß für die Testisanlage zuständige Gene auf dem proximalen Teil des langen Armes des Y-Chromosoms liegen und daß Gene auf dem kurzen Arm des Y-Chromosoms für die Ausreifung der Testes verantwortlich sind.

---

---

Director: Prof. Dr. H.-G. Hillemanns     

Cytogenetic findings in a consecutive series of 478 patients with Turner syndrome. The Leuven experience 1965-1989

In this report, we present the cytogenetic findings in 478 patients with Turner syndrome diagnosed in Leuven in the period 1965-1989. The karyotypic anomalies are classified into seven groups: 1) classic, 45,X karyotype (52.1%); 2) mosaic 45,X/46,XX (10.9%); 3) mosaic 45,X/47,XXX and other "super-female" cell lines (4.6%); 4) isochromosomes i(Xq) and i(Xp) (16.1%); 5) ring chromosomes r(X) (4.4%); 6) other structural aberrations of the X chromosome (7.7%); and finally 7) mosaic 45,X/46,XY patients (4%). The most pertinent chromosomal findings are briefly discussed and compared with previous reported surveys on subject.     

G-11 staining in Turner's syndrome with mos 45,X/46,X,r(?)

Mos 45,X/46,X,r(?) in 4 patients with Turner's syndrome and no signs of virilization, and in one pair of monozygotic twins, one of them with clitoral hypertrophy, was studied using combined cytogenetic techniques and specially G-11 staining for the characterization of the X or Y origin of the rings. In all 6 patients the ring was G-11 positive, attesting its Y origin. Both twins were operated and bilateral streak gonads with a bilateral nodule of testicular tissue were found. Similar small rings were also studied in one patient with mos 46,XX/46,X,r(X) and in one nonvirilized Turner's syndrome patient with a larger ring; in these two cases the ring was G-11 negative. It seems that the small rings occasionally found in Turner's syndrome are more frequently from Y origin and therefore prophylactic gonadectomy should be considered.     

Primary amenorrhoea in a patient with mosaicism for monosomy X and a derivative X-chromosome

Primary amenorrhoea is defined as the absence of menstruation in phenotypic women aged 16 years or older, if secondary sexual characteristics are present. X chromosome abnormalities probably comprise about one half of all cases, including Turner syndrome and X chromosome rearrangements. Conventional banding cytogenetic methods might miss the accurate detection of structural chromosome abnormalities. The fluorescence in situ hybridization (FISH) and multicolor FISH techniques are required to interpret specific chromosomal rearrangement. As far as we know, we report the first case with chromosome mosaicism for monosomy X and terminal deletion of Xq26 with duplication of Xp11-->pter. In spite of the fact that a 45,X karyotype was detected in 46% of lymphocytes, she was tall and her secondary sexual characteristics were moderately developed, including breast, pubic and axillary hair stages. Cytogenetic and FISH analyses should be considered for patients presenting primary amenorrhoea even if there are no other clinical features suggestive of chromosome abnormality.     

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

X/X translocation in a patient with Turner's syndrome

Summary An abnormally large X chromosome was found in a girl with Turner's syndrome, and was identified as a X/X translocation (karyotype 45,X/46,X,-X,+t(XqXp)).Aided by contract No. 20. 122 F.W.G.O., Belgium.     

Three cases of sex chromosome mosaicism with a nonfluorescent Y

Summary Clinical and cytogenetic findings in three patients mosaic for sex chromosomes (45,X0/46,XY; 45,X0/46,XY/46,XYq-, and 45,X0/46,XY/46,XYY), each with a nonfluorescent Y, are presented. Hypotheses for the origin and effect of these chromosome constitutions are discussed.     

Birth weight and motor development of infants with Turner's syndrome

There were analysed 61 cases of Turner's syndrome, in this group--48 cases with 45,X karyotype. Author confirmed, that mean birth weight of these children was lower (2920 g), than in healthy girls (3400 g), especially in cases with 45,X karyotype (2894 g). The 1st birth order in 45,X cases decreased birth weight of these children (mean 2693 g). The most retardation of motor development--3 months--in locomotion was observed. Between two genotype groups 45,X (mean 2894 g) and 45,X/46,XX (mean 3015 g) the difference was statistically significant.     

Turner syndrome mosaicism: an unusual case with a de novo large dicentric marker chromosome: mos 45,X/46,X, ter rea(X;X)(p22.3;p22.3)

X/X translocations are quite rare in humans. The effect of this anomaly on the phenotype is variable and depends on the amount of deleted material and whether the chromosomes are joined by their long or short arms. We report an unusual case of Turner syndrome mosaicism in a 16-year-old girl, who was referred to our Institute for primary amenorrhoea associated with short stature. Endocrine evaluation revealed hypergonadotropic hypogonadism, which required a study of the karyotype. Cytogenetic analysis, performed on peripheral blood leucocytes, showed a mos 45,X/46,X,ter rea (X;X)(p22.3;p22.3) de novo karyotype. The prevalent cell line was 45,X (90% cells). A second cell line (10% cells) showed a very large marker chromosome, similar to a large metacentric chromosome. FISH (fluorescent in situ hybridisation) and molecular analysis revealed that the marker chromosome was dicentric and totally derived from the paternal X chromosome.